DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
This action is written in response to applicant’s correspondence received on 11/20/2024. Claims 1-2, 7-9, 12, 18, 86, 88-89, and 138-148 are pending. All pending claims are currently under examination.
Nucleotide and/or Amino Acid Sequence Disclosures
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO’s electronic filing system (see Section I.1 of the Legal Framework for EFS-Web or Patent Center (https://www.uspto.gov/patents-application- process/filing-online/legal-framework-efs-web), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via EFS-Web or Patent Center as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via EFS-Web or Patent Center as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiency - The Incorporation by Reference paragraph required by 37 CFR 1.821(c)(1) is missing or incomplete. See item 1) a) or 1) b) above. In particular, the sequence incorporation statement entitled “Sequence Listing” in the specification refers to the sequence listing file in terms of “KB,” but must refer to the size of the file in terms of “bytes.” See MPEP 2422.03, section I, “ASCII Text File Submitted VIA EFS-Web.”
Required response – Applicant must provide:
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required incorporation-by-reference paragraph, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter.
Drawings
The drawings are objected to because the figures are not properly labeled.
37 CFR 1.84 (u)(1) states “The different views must be numbered in consecutive Arabic numerals, starting with 1, independent of the numbering of the sheets and, if possible, in the order in which they appear on the drawing sheet(s). Partial views intended to form one complete view, on one or several sheets, must be identified by the same number followed by a capital letter. View numbers must be preceded by the abbreviation "FIG." Where only a single view is used in an application to illustrate the claimed invention, it must not be numbered and the abbreviation "FIG." must not appear.”
The drawings are objected to because Figures 22-25 are improperly labeled. Figures 22-25 contain partial views on separate sheets. For example, Figure 22 spans multiple sheets and is labeled “Fig. 22” and “Fig. 22 (continued)” but should be labeled “Fig. 22A” and “Fig. 22B”. etc., for each new sheet. The same is true for figures 23-25.
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1-2, 7-9, 86, 88-89, 139, 141, and 144-145 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Krzyzosiak (US 2016/0376586 A1).
Regarding claim 1, Krzyzosiak is a patent document which teaches using RNA interference to target and treat diseases associated with CAG repeat expansions (Title, Abstract, throughout) Krzyzosiak teaches RNA that is double-stranded which comprises a first strand that hybridizes to a target CAG repeat region containing RNA, a second strand that hybridizes to the first strand, and first and second mismatches (e.g., see Table on page 5, SEQ ID NOs 1-14). Krzyzosiak teaches that the interfering RNA is double-stranded (e.g., paragraphs 5 and 42). Regarding specific embodiments recited in claim 1, Krzyzosiak teaches SEQ ID NO: 4, which is aligned with the RNA equivalent of instant SEQ ID NO: 866, below:
GCUGCUGCAGCUGCAGCUGCU (SEQ ID NO: 4, Krzyzosiak, Table on Page 5)
GCUGCUGCUGCUGCUGCUGCU (RNA equivalent of instant SEQ ID NO: 866)
As shown above, SEQ ID NO: 4 of Krzyzosiak is a 100% match of instant SEQ ID NO: 866, with the exception that positions 9 and 15 are exchanged for “A” residues from “U” residues. Thus, Krzyzosiak teaches SEQ ID NO: 866 with a first mismatch at position 9 and a second mismatch at position 15 (i.e., within 7 bases 3’ of the first mismatch). Krzyzosiak therefore teaches the RNA molecule recited in claim 1.
Regarding claim 2, Krzyzosiak teaches that the “U” residues are substituted with “A” residues in SEQ ID NO: 4 with reference to instant SEQ ID NO: 866 (see alignment, above).
Regarding claims 7-9, Krzyzosiak teaches that there are two mismatches with the target CAG repeat region in SEQ ID NO: 4 (Table on page 5).
Regarding claim 86, Krzyzosiak teaches that the complementary strand (the passenger strand) is complementary to the guide strand (paragraph 5, 22, and claim 16).
Regarding claims 88-89, SEQ ID NO: 4 of Krzyzosiak is 21 nucleotides long (see above alignment in the rejection of claim 1).
Regarding claim 139, Krzyzosiak teaches SEQ ID NO: 7 which is aligned with instant SEQ ID NO: 866, below:
GCUGCUGCUAAAGCAGCUGCU (Krzyzosiak SEQ ID NO 7, Table on page 5)
GCUGCUGCUGCUGCUGCUGCU (RNA equivalent of instant SEQ ID NO: 866)
As shown above, SEQ ID NO: 7 of Krzyzosiak matches instant SEQ ID NO: 866, where positions 10-12 of Krzyzosiak have been changed to “A,” including mutations of the first mismatch being mutated from “G” to “A” and the second mismatch being “C” to “A,” (see alignment above at positions 10 and 11).
Regarding claim 141, SEQ ID NO: 7 of Krzyzosiak reads on the claim language of claim 1 and comprises 4 mismatches relative to the target CAG region (see Table on page 5 and alignment above).
Regarding claim 144, Krzyzosiak teaches that the RNA molecule of their application comprises at least one chemically modified nucleotide (paragraph 9).
Regarding claim 145, Krzyzosiak teaches that the RNA is formulated for use in a eukaryotic host for treatment of a neurological disease (example, claims 28-29). The practitioner can therefore immediately envision that the RNA is in a pharmaceutically acceptable excipient, so that it can be delivered as a therapy as taught by Krzyzosiak (claims 28-29).
Claims 1-2, 9, 12, 18, 86, 88-89, and 141 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Hu (Hu J et al. Chem Biol. 2010 Nov 24;17(11):1183-8).
Regarding claims 1, 12, and 18, Hu is a research article which focuses on allele specific targeting of Huntington alleles using double-stranded duplex RNA (Title, Abstract, and throughout). Hu also teaches the inventive concept of using mismatches in order to improve the selectivity of allele-specific targeting of RNA molecules (Summary, and see Table on page 11). Hu teaches creating mismatches in the central region of a duplex RNA molecule, including an embodiment where positions 8-11 are mismatches, where furthermore such an embodiment increased the selectivity over 21-fold (Table on page 11). Furthermore, an alignment of Hu’s mismatch double-stranded RNA is given below in comparison with instant SEQ ID NO: 866:
GCUGCUGAAAAUGCUGCUGTT (Hu, Table 11, “PM4”)
GCUGCUGCUGCUGCUGCUGCU (Instant SEQ ID NO: 866).
Thus, PM4 of Hu comprises mutations at positions 8-11 relative to instant SEQ ID NO: 866, and therefore comprises a mismatch at position 8 and also three additional mismatches within 8 baes 3’ of position 8 (PM4 of Hu, above). Furthermore, regarding the two “T” residues taught by Hu at the 3’ end of the molecule, such residues can simply broadly be interpreted to be additional mismatches in the molecule. PM4 of Hu therefore anticipates claims 1, 12, and 18.
Regarding claim 2, Hu teaches that the mutations of PM4 are from C, U, and G to A relative to instant SEQ ID NO: 866 (see alignment, above).
Regarding claim 9, Hu teaches P910 which is aligned with instant SEQ ID NO: 866, below (Table on page 11 of Hu):
GCUGCUGCAACUGCUGCUGTT (P910 of Hu, Table on page 11)
GCUGCUGCUGCUGCUGCUGCU (Instant SEQ ID NO: 866).
Thus, Hu teaches a first mismatch at position 9 and 10 (i.e., within 7 bases of the first mismatch relative to instant SEQ ID NO: 866). Furthermore, the two “T” residues at the end of Hu can broadly be interpreted to be mismatches. Hu therefore teaches no more than 4 mismatches in P910, where the criteria of claim 9 read on P910 of Hu (above).
Regarding claim 86, Hu teaches that the strands can be complementary (Summary, throughout). Hu teaches that the mismatch can be on both strands on the RNA molecule, which yields a second strand which is fully complementary to the first strand (Table on page 11, “siRNA containing one mismatched base on both strands”).
Regarding claims 88-89, Hu teaches that the RNA molecules are 21 nucleotides in length (e.g., P910, Table on page 11).
Regarding claim 141, P910 has 4 mismatches relative to SEQ ID NO: 866 (see alignment, above).
Regarding claim 145, Hu teaches that their compositions have therapeutic application (e.g., page 5, fifth paragraph). A practitioner can therefore immediately envision using such RNA molecules in a pharmaceutical composition with excipient.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 138, 140, and 142-143 are rejected under 35 U.S.C. 103 as being unpatentable over Krzyzosiak (US 2016/0376586 A1) in view of Hu (Hu J et al. Chem Biol. 2010 Nov 24;17(11):1183-8).
Regarding the teachings of Krzyzosiak as they relate to claims 1-2, 7-9, 86, 88-89, 139, 141, and 144-147, these claims and their rejection as they relate to Krzyzosiak are discussed in the 102 rejection above and incorporated herein.
Regarding claim 138, Krzyzosiak teaches the development of mismatched double-stranded RNA molecules which can selectively target mutated, pathogenic disease alleles comprising CAG repeats, where normal, wildtype alleles are not affected (paragraph 49, Figure 3). Krzyzosiak further teaches that it is advantageous to have higher selectivity when using RNA targeting technologies because such higher selectivity increases the ability of RNA to target the desired, pathogenic allele (paragraph 10, “It is recommended to show at least 5-fold selectivity in silencing of mutant allele expression in comparison with normal allele”). Thus, Krzyzosiak already teaches the inventive concept of creating double-stranded RNAs with mismatches of between 1-4 bases relative to a CAG repeat region, where such mismatches enhance the selectivity of targeting mutated, pathogenic alleles (Table 1 of page 5, paragraph 10, paragraph 49). Krzyzosiak teaches mismatches in base sequences, where the base sequences are CUG repeats beginning at C (CUGn), U (UGCn), and G (GCUn), where such base sequences are equivalent to instant SEQ ID NOs 743, 866, and 867 (see Table on page 5 of Krzyzosiak). Krzyzosiak teaches that position 9 can be a mismatch sequence (e.g., SEQ ID NO: 4 of Krzyzosiak, below):
GCUGCUGCAGCUGCUGCAGCUGC (SEQ ID NO: 3 of Krzyzosiak, where positions 9 and 18 are changed to “A” from “U”)
Krzyzosiak, while teaching a mutation at position 9 relative to instant SEQ ID NO 866, and also a second mutation at position 18, does not teach that the second mutation is 7 bases away (as 18 is 9 bases away from position 8, the first mismatch).
Hu is a research article which focuses on allele specific targeting of Huntington alleles using double stranded duplex RNA (Title, Abstract, and throughout). Hu and Krzyzosiak therefore directly overlap in subject matter and field of endeavor because they both teach the same disease, as well as the same molecule types used to target CAG repeats regions (throughout). Hu also teaches the inventive concept of using mismatches in order to improve the selectivity of allele-specific targeting of RNA molecules (Summary, and see Table on page 11). Hu teaches RNA duplexes labeled P9 and P16, which are shown in alignment below relative to Krzyzosiak’s SEQ ID NO: 3 and instant SEQ ID NO: 866:
GCUGCUGCAGCUGCUGCUGTT (P9, Hu, Table on page 11, 31-fold selectivity increase)
GCUGCUGCUGCUGCUACUGTT (P16, Hu, Table on page 11, 7-fold selectivity increase)
GCUGCUGCAGCUGCUGCAGCUGC (SEQ ID NO: 3, Krzyzosiak)
GCUGCUGCUGCUGCUGCUGCU (Instant SEQ ID NO: 866)
As shown above, P9 and P16 of Hu, where positions 9 and 16 relative to SEQ ID NO: 866 are mismatched, are taught by Hu, who furthermore teaches that P9 and P16 yield 31-fold and 7-fold increases in selectivity (see Table on page 11). Hu therefore teaches that the 9 and 16 position mutations are known, where both mutations are known to improve the selectivity of the RNA molecule for targeting mutated CAG region elements (Table on page 11, Hu). Furthermore, Hu teaches that using combinations of 2, 3, and 4 mismatches is known to yield improvements of selectivity relative to RNAs without mismatches (Table on page 11). Thus, Hu teaches the inventive concept of combining mismatch sites. Furthermore Hu provides a direct motivation to generate multiple RNAs with different mismatch patterns: “it is known that the binding of multiple mismatch-containing duplex RNAs to mRNA can yield synergistic increases in potency for miRNAs,” (page 3, first paragraph).
It would be obvious to a person of ordinary skill in the art before the effective filing date of the present invention to modify the RNA molecules taught by Krzyzosiak with the teachings of Hu because Hu has already taught and reduced to practice the recited mutational positions. The combination is therefore the simple combination of known prior art elements with predictable outcomes because the mismatch positions were already known in the art and reduced to practice. Furthermore, Hu provides a motivation to generate different RNA mismatch patterns because they teach that using multiple mismatch RNAs is advantageous, where furthermore RNAs with multiple mismatches are known to be potent and effective (Table on page 11, Hu).
Regarding claims 140 and 142-143, Krzyzosiak teaches G to A and C to A mutations (claim 140). For instance, Krzyzosiak teaches SEQ ID NO: 7 which is aligned with instant SEQ ID NO: 866, below:
GCUGCUGCUAAAGCAGCUGCU (Krzyzosiak SEQ ID NO 7, Table on page 5)
GCUGCUGCUGCUGCUGCUGCU (RNA equivalent of instant SEQ ID NO: 866)
As shown above, SEQ ID NO: 7 of Krzyzosiak matches instant SEQ ID NO: 866, where positions 10-12 of Krzyzosiak have been changed to “A,” including mutations of the first mismatch being mutated from “G” to “A” and the second mismatch being “C” to “A,” (see alignment above at positions 10 and 11).
Krzyzosiak does not specifically teach that the RNA sequence in claim 138 comprises a first G to A mutation and a second C to A mutation (claims 140). Krzyzosiak does not teach the specific mutation pattern recited in claims 142-143.
Furthermore, Hu also teaches that C, G, and U mutations to A are all amenable to generating highly selective mismatch RNAs to target pathogenic CAG repeat regions (Table on page 11). Thus, mutating the positions recited in the present claims as well as generating functional mutations where both G and C are changed to A are known in the art (see P4-P16 on page 11 of Hu). Furthermore, both Hu and Krzyzosiak teach that mutational strategies can be combined to generate RNAs with multiple mismatches to CAG repeat regions (Table on page 5 of Krzyzosiak and page 11 of Hu). Furthermore, Krzyzosiak teaches that positions 1-7 comprise Watson-base pairing with a CAG repeat (e.g., SEQ ID NO: 7 of Krzyzosiak).
It would have been obvious to a person of ordinary skill in the art before the effective filing date to modify the RNA molecules taught by Krzyzosiak and Hu to include G to A and C to A mutations at positions 8 and 15 or 9 and 16 because such a combination is the simple substitution of one known prior art element for another with predicable success. In the present case, the practitioner is selecting from a known, defined CAG RNA molecules, where furthermore mutations at positions 8-9 and 15-16 have been performed and reduced to practice by Hu and Krzyzosiak. The outcome is therefore predictable. Furthermore, it is obvious to try, where the practitioner is selecting from a finite, defined RNA molecule, where each option of A, C, G, and U is known, and where the results are reasonably predictable given that mutations at these positions have already been taught and reduced to practice, where it was furthermore known that combinations of mismatches yield increased selectivity relative to RNA molecules without mismatches.
Furthermore, given that all of the experimental parameters are known, as well as a reasonable motivation to combine mismatch mutations, a practitioner could arrive at the presently recited RNA molecules simply by routine laboratory optimization and experimentation.
Claims 146-148 are rejected under 35 U.S.C. 103 as being unpatentable over Krzyzosiak (US 2016/0376586 A1) in view of Kaemmerer (WO 2004/047872 A2).
A discussion of Krzyzosiak as it relates to claim 1 is given above in the 102 rejection and is incorporated here.
Regarding claims 146-148, Krzyzosiak teaches that methods of delivering effective amounts of RNA formulations to patients in need are known (e.g., paragraph 12). Furthermoe, Krzyzosiak teaches and claims that their RNA compositions are to be used in treatments of neurodegenerative disorders, including Huntington disease (paragraphs 12-15, claims 28-30). Krzyzosiak therefore teaches motivation to use their RNA constructs in treatment methods of neurodegenerative diseases such as Huntington disease, as such methods are a therapeutic goal of Krzyzosiak (e.g., paragraphs 12-15 and claims 28-30).
Krzyzosiak does not teach a specific method for administering their RNA compositions to treat Huntington disease by reducing translation of disease-associated CAG repeats (claims 146-147) where the composition is injected directly to the central nervous system (claim 148).
However, Krzyzosiak teaches and directly references Kaemmerer when discussing treatment of neurological diseases such as Huntington disease (paragraph 12). Thus, Krzyzosiak and Kaemmerer directly overlap in scope and subject matter because both relate to the treatment of CAG-dependent neurological disorders using RNA formulations, and furthermore Krzyzosiak directly references Kaemmerer as a suitable method of administration (paragraph 12). Kaemmerer teaches a method of delivering RNA formulations directly to the central nervous system to treat Huntington disease (e.g., see Abstract, and also see throughout).
It would have been obvious to a person of ordinary skill in the art before the effective filing date to modify the therapeutic RNAs compositions taught by Krzyzosiak to be used in a method of treating Huntington disease by directly injecting such RNA into the brain (i.e., part of the CNS) as taught by Kaemmerer because such a combination is the simple combination of known prior art elements with predictable success. Additionally, Krzyzosiak directly references Kaemmerer, and therefore leads the practitioner directly to the method of use to be combined with the RNA therapeutics taught by Krzyzosiak. Further, the results are predictable because Kaemmerer has reduced the method to practice using similar targets, diseases, and therapeutic RNA molecules.
Claim Rejections - 35 USC § 112
Claims 146-148 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for reducing translation of a disease associated-CAG repeat which is associated with a known neurodegenerative disease (claim 146) and administration of the composition of claim 1 to an individual by direct injection to the brain (claim 148), does not reasonably provide enablement for reducing the translation of a disease-associated CAG repeat containing RNA that is not associated with a known CAG repeat expansion disorder (claim 146) or methods of general administration including such methods as intravenous administration (claim 148). The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention commensurate in scope with these claims.
Factors to be considered in determining whether a disclosure meets the enablement requirement of 35 U.S.C. 112, first paragraph, have been described by the court in In re Wands, 8 USPQ2d 1400 (Fed. Cir. 1988). Wands states, on page 1404:
Factors to be considered in determining whether a disclosure would require undue experimentation have been summarized by the board in Ex parte Forman. They include (1) the quantity of experimentation necessary, (2) the amount of direction or guidance presented, (3) the presence or absence of working examples, (4) the nature of the invention, (5) the state of the prior art, (6) the relative skill of these in the art, (7) the predictability or unpredictability of the art, and (8) the breadth of the claims.
Nature of Invention/Breadth of the Claims
Regarding claims 146-147, these claims are broadly drawn to a method of administering the RNA composition of claim 1 to an individual in vivo, where the route of administration is not restricted or defined such as direct injection to the CNS as recited in claim 148, a dependent claim. Thus, claim 146 broadly encompasses any means of administration, where furthermore claim 147 specifies that the method is associated with targeting conditions of the brain such as Huntington’s disease. Thus, claims 146-147 are broadly drawn to the delivery of the recited RNA to the brain or CNS. However, this claim language is problematic because targeted delivery of such RNA is known in the art to face several challenges in vivo, where furthermore the specification has not offered solutions to the known problems of the art.
Furthermore, claim 146 broadly recites the category of “CAG repeat expansion disorder.” This claim language is problematic because CAG repeat expansion disorders are known in the art to be limited to only a few known neurodegenerative disorders. The specification is therefore not enabling for “CAG repeat expansion disorders” which are not already known in the art (see below)
Guidance in the Specification
Regarding the guidance provided in the specification, the Applicant has provided Examples 1-9 (pages 291-313). Examples 1 concerns the design of optimized expression of CAG shRNA. Example 2 relates to a selective reduction in CAG repeat elements in HEK293 in vitro cells. Example 3 concerns the knockdown of Huntington gene expression in primary patient derived cells, where Example 4 describes the determination of the abundance of mismatched vs. perfect matched guide sequences. Thus, Examples 1-4 relate to in vitro testing of the recited constructs.
Examples 5-7 describe in vivo mouse models, where RNA templates are packages into AAV vectors and directly injected using bilateral striatal injection (i.e., direct brain injection, Examples 5-6), unilateral (right hemisphere) intracerebral ventricular injection (Example 7),
Example 8 describes in vitro transfection of shRNA into fibroblasts, while example 9 recites additional in vitro HEK293T testing using a luciferase assay.
Thus, the Applicant has performed administration of their RNA constructs using direct injection of the constructs to the brain. The Applicant has not tested or reduced to practice general, global administration procedures such as intravenous administration of the RNA therapeutic, nor shown that such administration routes would be efficacious to target CAG repeats associated with, for instance, Huntington’s disease, a neurological disorder.
Furthermore, regarding the category of “CAG expansion disorder” as presently recited in claim 146, the specification defines a “CAG expansion disorder” as being primarily neurodegenerative disorders (page 15, third paragraph). Thus, the specification, while defining expansion disorders and stating that they are “primarily” neurodegenerative disorders, does not limit the definition to being strictly known neurodegenerative disorders. Indeed, as claim 147 depends from claim 146 and lists specifically known CAG expansion disorders, claim 146 broadly encompasses the general category of “expansion disorders” which may or may not be one of the known, neurodegenerative disorders listed in claim 147.
State of the Art
Regarding the state of the art, it is known that generalized methods of administration for gene therapies are unpredictable and often ineffective. For instance, Ye (Ye D et al. Adv Drug Deliv Rev. 2024 Aug;211:115363) is a review article that focuses on the use of AAV vectors for the delivery of therapeutic payloads to the brain (Title, Abstract, and throughout). Ye teaches that “the blood–brain barrier (BBB) poses a significant challenge to successfully delivering AAV vectors to the brain,” (Abstract). Ye further teaches regarding intravenous injections of AAV vectors that:
“only a few of these naturally existing AAVs have demonstrated the capability to cross the BBB effectively and target the CNS. Recognizing these limitations, recent research efforts have been directed toward engineering novel AAV capsids capable of crossing the BBB to enhance brain transduction,” (page 4, right column, second paragraph).
Ye teaches that:
“AAV9 is a naturally exist AAV and was proven to achieve spreaded transduction in the brain. Although the mechanism remains unclear, it is believed that AAV9 crosses the BBB by active-transport mechanisms, such as receptor-mediated vesicular transport…However, although proven the most effective in transducing the brain, the transduction efficiency of IV administered AAV9 is age-dependent. AAV9 transgene is widely distributed in neonatal animals, predominantly in neurons across numerous brain regions (olfactory bulb, striatum, cerebral cortex, hippocampus, and brainstem). In contrast, most transduced cells for adult mice are glial (astrocytes or endothelial cells) with sparse neuronal transduction. For instance, one study found that when administered at birth, AAV9 infected approximately 60 % of motor neurons and 30 % of astrocytes in amyotrophic lateral sclerosis mice; however, when injected into the adult mice, AAV9 more efficiently transduced astrocytes (around 50 %), compared to motor neurons (8 %). Similar trends have also been observed in NHPs [47,64,67,69,74]. The mechanisms underlying these age-related differences in transduction are not fully
understood but could be related to developmental changes in the brain,” (page 4, right column, final paragraph).
Thus, Ye teaches that vector delivery mechanisms to the brain to deliver a gene therapy are known to be unreliable, where furthermore specifically engineered vectors are required in order to access the brain, where furthermore the exact mechanisms of blood-brain barrier crossing are unclear (above). Additionally, Ye teaches that, through an unknown mechanism, the specific cell-types which gene therapies efficiently target changes over time without known cause when using IV administration (above). Thus, Ye teaches a high degree of unpredictability and uncertainty when using generic delivery vectors with respect to functional and effective delivery to the brain using intravenous administration routes, such as would be required to target the repeat expansion disorder Huntington’s disease (claim 147).
Similarly, Ye teaches regarding intranasal delivery of gene therapies that:
the mechanisms and distribution patterns of AAV in the brain post-IN delivery still require further exploration to fully leverage this promising delivery route,” (page 5, right column, second paragraph).
Thus, Ye teaches that distribution of gene therapies using intranasal administration (“IN”) relies upon an unknown and unpredictable mechanism. Ye therefore teaches inherent unpredictability when delivering a gene therapy to an intended cellular target in the brain.
Furthermore, regarding the broadly recited category of “CAG repeat expansion disorders,” it is known in the art that, with respect to CAG repeat expansion disorders, only neurodegenerative disorders are known. Specifically, Tenchov (Tenchov R t al. ACS Chem Neurosci. 2024 Aug 7;15(15):2665-2694) teaches that:
“A total of nine polyQ disorders have been identified, including Huntington’s disease, six spinocerebellar ataxias, dentatorubral pallidoluysian atrophy (DRPLA), and spinal and bulbar muscular atrophy (SBMA),” (Abstract). Thus, Tenchov teaches that only a few CAG repeat expansion disorders are known, all of which are neurodegenerative diseases.
Additionally, Stoyas (Stoyas CA et. al. Handb Clin Neurol. 2018;147:143-170) also teaches that CAG expansion repeat disorders are only known to be a handful of neurodegenerative disorders, and further teaches that “despite widespread expression of the different polyQ-expanded disease proteins throughout the body, each CAG-polyglutamine disease strikes a particular subset of neurons, although the mechanism for this cell-type selectivity remains poorly understood,” (Abstract). Thus, the art teaches that only a few art-recognized CAG repeat expansion disorders are known, where furthermore the underlying mechanism of what neurons or cells will be affected by CAG expansion genes is unclear (Stoyas, Abstract).
Experimental Burden
A practitioner is beset with experimental burden when attempting to practice the presently recited methods of the claims. For instance, the practitioner would be required to develop efficient and reliable administration methods to an in vivo organism to deliver the recited RNA therapeutics, where such in vivo delivery to the brain is known to be unpredictable and challenging as taught by Ye (above). The Applicant has not reasonably shown enablement of such a method by solving known issues associated with delivering gene therapies across the blood-brain barrier as taught by Ye. The practitioner would therefore be burdened by having to work out these known mechanistic issues in order to effectively practice the recited methods.
Additionally, as claim 146 broadly encompasses the category of “CAG expansion repeat disorder” the practitioner is faced with experimental burden with respect to the class of disease “expansion repeat disorder.” The practitioner would have to discover novel, currently unknown repeat disorders and diseases, where it is known in the art that such repeat expansion disorders are 1) only a few known neurodegenerative disorders and 2) the exact cellular and molecular underpinnings of why a specific cell is affected by CAG expansion RNAs is unknown, as taught by Stoyas. Thus, a practitioner would be burdened by having to discover a novel set of diseases, as claim 146 presently encompasses unknown, non-neurodegernative diseases which are not recognized as known CAG repeat expansion diseases.
Claim Rejections - 35 USC § 112 – Written Description
Claims 146-148 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
MPEP 2163.II.A.3.(a).i) states, “Whether the specification shows that applicant was in possession of the claimed invention is not a single, simple determination, but rather is a factual determination reached by considering a number of factors. Factors to be considered in determining whether there is sufficient evidence of possession include the level of skill and knowledge in the art, partial structure, physical and/or chemical properties, functional characteristics alone or coupled with a known or disclosed correlation between structure and function, and the method of making the claimed invention”.
For claims drawn to a genus, MPEP § 2163 states the written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. See Regents of the University of California v. Eli Lilly & Co, 119 F.3d at 1568, 43 USPQ2d at 1406.
Regarding claim 146, claim 146 is drawn to a method of reducing translation of a disease-associated CAG repeat-containing RNA, and therefore broadly recites the genus of “disease-associated CAG repeat containing RNA.” However, the Applicant has not demonstrated possession of this genus, as it is known in the art that each gene associated with a CAG expansion disorder is unique, where furthermore the exact cell type and disease states based upon the presence of a CAG repeat-containing RNA are unpredictable (see below). The Applicant has therefore not shown sufficient written description to claim the scope of the present subject matter.
Regarding the guidance provided in the specification, the Applicant has provided Examples 1-9 (pages 291-313). Examples 1 concerns the design of optimized expression of CAG shRNA. Example 2 relates to a selective reduction in CAG repeat elements in HEK293 in vitro cells. Example 3 concerns the knockdown of Huntington gene expression in primary patient derived cells, where Example 4 describes the determination of the abundance of mismatched vs. perfect matched guide sequences. Thus, Examples 1-4 relate to in vitro testing of the recited constructs.
Examples 5-7 describe in vivo mouse models, where RNA templates are packages into AAV vectors and directly injected using bilateral striatal injection (i.e., direct brain injection, Examples 5-6), unilateral (right hemisphere) intracerebral ventricular injection (Example 7),
Example 8 describes in vitro transfection of shRNA into fibroblasts, while example 9 recites additional in vitro HEK293T testing using a luciferase assay.
The Applicant has performed testing which has focused on the Huntington RNA CAG repeat (e.g., Examples 5-7). The Applicant has not broadly characterized disease -associated CAG repeat containing RNA, as presently recited.
Regarding the State of the Art, it is known in the art that disease-causing CAG expansion RNA is an unpredictable genus. For instance, Tenchov (Tenchov R t al. ACS Chem Neurosci. 2024 Aug 7;15(15):2665-2694) teaches that:
“A total of nine polyQ disorders have been identified, including Huntington’s disease, six spinocerebellar ataxias, dentatorubral pallidoluysian atrophy (DRPLA), and spinal and bulbar muscular atrophy (SBMA),” where furthermore each causative RNA agent in the disease is associated with a unique gene (Abstract). Thus, Tenchov teaches that only a few CAG repeat expansion disorder RNAs are known, each of which is associated with a unique gene.
Additionally, Stoyas (Stoyas CA et. al. Handb Clin Neurol. 2018;147:143-170) also teaches that CAG expansion repeat disorders are only known to be a handful of neurodegenerative disorders, and further teaches that “despite widespread expression of the different polyQ-expanded disease proteins throughout the body, each CAG-polyglutamine disease strikes a particular subset of neurons, although the mechanism for this cell-type selectivity remains poorly understood,” (Abstract). Thus, the art teaches that only a few art-recognized CAG repeat expansion disorders and their associated RNAs are known, where furthermore the underlying mechanism of what neurons or cells will be affected by CAG expansion genes is unclear (Stoyas, Abstract).
The Applicant was not in possession of “disease-associated CAG repeat-containing RNA” because it is known in the art that each individual CAG-repeat containing RNA is associated with a unique gene, where furthermore the status of a disease state is dependent upon a specific cell type, where the underlying mechanism of why a particular cell type is susceptible to a disease state is still unknown (Stoyas, Tenchov, above).
Claims 147-148 depend from claim 146 and do not resolve this issue and are therefore also rejected.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to DOUGLAS CHARLES RYAN whose telephone number is (571)272-8406. The examiner can normally be reached M-F 8AM - 5PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)-272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/D.C.R./Examiner, Art Unit 1635
/RAM R SHUKLA/Supervisory Patent Examiner, Art Unit 1635
Prosecution Insights