DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
The present application, 18/702,323 was filed on 17 April 2024 and is a 371 of PCT/CN2023/094729, filed 17 May, 2023, and claims Foreign Priority to CHINA 202210551546.0, filed 18 May 2022.
Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55. It is noted that no English language translation of the certified copy of the foreign priority document CHINA 202210551546.0 has been filed.
Election/Restrictions
Applicant's election with traverse of “Group I, claims 1-15, drawn to products” in the reply filed on July 22, 2026 is acknowledged. The traversal is on the grounds that:
“The traverse is based on the reason that claims 1-20 share a common technical feature “a locked nucleic acid modification is made in the molecular barcode of primers,” “so that the recognition and binding ability of the base in the primers modified by the locked nucleic acid to the base of the target gene is stronger than that of the complementary primer. The direct binding between the adapter primers is avoided, thereby the adapter self-connection between the forward primers and the reverse primers can be inhibited, and the number of non-specific amplification products generated by the adapter self-connection between the forward primers and the reverse primers is reduced.” (See paragraph [0035] in US 2024/0409924 A1). None of Krjutskov et al… or Glezer et al… discloses or suggests such technical effects…”.
This assertion has been thoroughly reviewed and is not found persuasive for each of the following reasons.
The asserted “common technical feature” of “a locked nucleic acid modification is made in the molecular barcode of primers” is defined by the claims, not the specification. As such, the common technical feature was correctly identified in the requirement for restriction: “A locked nucleic acid-modified molecular barcode”. This common technical feature was addressed as obvious over the prior art in view of Krjutskov et al. in view of Glezer et al. (see quotation from the relevant section of the requirement for restriction below). It is noted that the assertion “None of Krjutskov et al… or Glezer et al… discloses or suggest such technical effects…” appears to constitute a mere allegation of patentability and does not distinctly and specifically point out the supposed errors in the restriction requirement.
The extended quotation from the specification, “so that the…. reduced” (reproduced above for clarity of the record) is not part of the claims. Furthermore, even if this section were a claimed feature, the substance of the quoted section appears to be a non-limiting statement of a desired outcome in a particular intended use of the products defined by the claims.
The requirement is still deemed proper and is therefore made FINAL.
Claims 16-20 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected invention, there being no allowable generic or linking claim. Applicant timely traversed the restriction (election) requirement in the reply filed on July 22, 2026.
Claim Status/Action Summary
This action is in response to the papers filed on July 22, 2026.
Claims 1-20 are currently pending in the present application. Claims 16-20 are withdrawn as directed to a non-elected invention. Claims 1-15 are under examination.
Drawings
The drawings filed on April 17, 2024 are acceptable.
Nucleotide and/or Amino Acid Sequence Disclosures
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiency - This application contains sequence disclosures in accordance with the definitions for nucleotide and/or amino acid sequences set forth in 37 CFR 1.821(a)(1) and (a)(2). However, this application fails to comply with the requirements of 37 CFR 1.821 - 1.825.
The sequence disclosures are located on page 14 and 23 (SEQ ID NO: 1) and page 19 and 23 (SEQ ID NO: 2). It is noted that the sequence listing contains the following entries for SEQ ID NO: 1 and 2:
PNG
media_image1.png
107
482
media_image1.png
Greyscale
PNG
media_image2.png
110
505
media_image2.png
Greyscale
Required response – Applicant must provide:
A "Sequence Listing" part of the disclosure, as described above in item 1); as well as
An amendment specifically directing entry of the "Sequence Listing" part of the disclosure into the application in accordance with 1.825(b)(2);
A statement that the "Sequence Listing" includes no new matter in accordance with 1.825(b)(5); and
A statement that indicates support for the amendment in the application, as filed, as required by 37 CFR 1.825(b)(4).
If the "Sequence Listing" part of the disclosure is submitted according to item 1) a) or b) above, Applicant must also provide:
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required incorporation-by-reference paragraph, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter;
If the "Sequence Listing" part of the disclosure is submitted according to item 1) b), c), or d) above, Applicant must also provide:
A replacement CRF in accordance with 1.825(b)(6); and
Statement according to item 2) a) or b) above.
Claim Objections
Claims 5-6 are objected to because of the following informalities: It appears that the claims omit the definite article “the” between “is” and “same” in the clause, “wherein the number of bases in at least two segments in the molecular barcode is same”. Appropriate correction is required.
Claim Interpretation
Claim 2 recites “the molecular barcode according to claim 1, wherein m satisfies
[Q/4]≤m≤[Q/3],
In the formula, Q denotes the total number of bases in the molecular barcode, [Q/3] denotes a maximum integer not exceeding Q/3, and [Q/4] denotes a maximum integer not exceeding Q/4.”
Because integers do not include fractional values, the claim has been interpreted as encompassing whole-number values of “m” wherein q/4 or q/3 are rounded down to the nearest whole number when q/4 or q/3 are not whole numbers. For example, when Q=10, Q/3=3.33 (the maximum integer not exceeding 3.33 is 3) and Q/4=2.5 (the maximum integer not exceeding 2.5 is 2), so when Q=10, m=2 or 3.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
Claims 1-15 are rejected under 35 U.S.C. 112(b) as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor regards as the invention.
Claim 1 recites the phrase “locked nucleic acid-modified sites, which divide the molecular barcode into m+1 segments, wherein the number of bases in each segment is 2 to 4”. It is not clear whether the claim includes the “locked nucleic acid-modified site”, which comprises a “base” in the length of the segment(s). Furthermore, if the claim does include the “locked nucleic acid-modified site” comprising a nucleic acid base in the length of the segments, it is unclear whether this locked nucleic acid (LNA) nucleotide is intended to be counted in the segment closer to the 5’ end of the molecular barcode or in the segment closer to the 3’ end of the molecular barcode. For example, under these conflicting definitions, wherein the claim includes the LNA nucleotide in the more 5’ segment, the claim includes the LNA nucleotide in the more 3’ segment, or wherein the claim does not count the LNA nucleotide in either of the segments, it is unclear which of the following exemplary molecular barcode species of the following form are encompassed by the claim when: Q=10, m=2:
SEQUENCE L included 5’ L included 3’ L not counted
5’-nnLnnnnLnn-3’ nnL(3)-nnnnL(5)-nn(2) nn(2)-Lnnnn(5)-Lnn(3) 2,4,2
5’-nnnLnnnLnn-3’ nnnL(4)-nnnL(4)-nn(2) nnn(3)-Lnnn(4)-Lnn(3) 3,3,2
5’-nnnnLnnLnn-3’ nnnnL(5)-nnL(3)-nn(2) nnnn(4)-Lnn(3)-Lnn(3) 4,2,2
5’-nnLnnnLnnn-3’ nnL(2)-nnnL(4)-nnn(3) nn(2)-Lnnn(4)-Lnnn(4) 2,3,3
5’-nnLnnLnnnn-3’ nnL(3)-nnL(3)-nnnn(4) nn(2)-Lnn(3)-Lnnnn(5) 2,2,4
Claims 3 and 4 recite the limitation "the number of the degenerate bases N". There is insufficient antecedent basis for this limitation in the claim.
Claim 7 recites: “the molecular barcode according to claim 1, wherein… Q is 10, and the locked nucleic acid-modified sites comprise a position k site and a position k+4 site along the direction from the 5’ end to the 3’ end… wherein k is greater than 2.”
This claim appears to encompass any polynucleotide sequence of the following forms, wherein “n” is any naturally-occurring nucleotide and “L” is a locked nucleic acid-modified site:
K SEQUENCE (L included 5’) OR (L included 3’) OR (L not counted)
K=3 nnLnnnLnnn segment lengths: (3,4,3) OR (2,4,4) OR (2,3,3)
K=4 nnnLnnnLnn segment lengths: (4,4,2) OR (3,4,3) OR (3,3,2)
K=5 nnnnLnnnLn segment lengths: (5,4,1) OR (4,4,2) OR (4,3,1)
K=6 nnnnnLnnnn segment lengths: (6,4) OR (5,5) OR (5,4)
However, because of the ambiguity in the definition of “the number of bases in each segment is 2 to 4” described above, it is unclear whether polynucleotides of the form K=5 are encompassed by, or are excluded by the claim (note, the bold segment length combinations violate “each segment is 2 to 4”. Furthermore, K has an implicit upper limit of 5, because K=6 violates [Q/4]≤m≤[Q/3] because when Q=10, m is limited to 2 or 3, and K=6 results in a polynucleotide with only 1 LNA site (i.e. m=1).
Therefore, to summarize, it is unclear whether claim 7 further limits the polynucleotides of claim 1 to those having the form wherein: “k is 3 or 4” OR the form wherein: “k is 3 or 4 or 5”.
Claims 9 and 11 require that “the sequence of the molecular barcode is set forth in SEQ ID NO:” “1” (claim 9) or “2” (claim 11). However, the sequence listing for these SEQ ID NOs. does not contain a valid polynucleotide sequence. In examples, the specification (page 15, example 1) provides:
PNG
media_image3.png
87
656
media_image3.png
Greyscale
And (page 19, example 6):
PNG
media_image4.png
121
653
media_image4.png
Greyscale
It is unclear whether these sequences in the examples of the specification are meant to be limiting upon the claims because the sequence listing for SEQ ID 1 and 2 does not match these sequences.
Claim 14 requires “the forward primer comprises at least one of FR1 forward primer, FR2 forward primer, and FR3 forward primer”. “FR1”, “FR2”, and “FR3” do not identify any particular nucleic acid sequence, but rather each represent genera of different sequences identified in the specification in table 1, pages 15-16: FR1: SEQ ID NO: 5-10), FR2: SEQ ID NO: 11-16, and FR3: SEQ ID NO: 17-23. As presently written, it is unclear whether the claim requires only one of the sequences SEQ ID NO: 5-23 (i.e. at least one polynucleotide selected from FR1, FR2, and FR3), OR whether the claim requires at least three sequences (i.e. at least one polynucleotide from FR1, at least one polynucleotide from FR2, and at least one polynucleotide from FR3).
Furthermore, MPEP 2173.05(s) states:
“Where possible, claims are to be complete in themselves. Incorporation by reference to a specific figure or table “is permitted only in exceptional circumstances where there is no practical way to define the invention in words and where it is more concise to incorporate by reference than duplicating a drawing or table into the claim. Incorporation by reference is a necessity doctrine, not for applicant’s convenience.” Ex parte Fressola, 27 USPQ2d 1608, 1609 (Bd. Pat. App. & Inter. 1993) (citations omitted).”
In the instant case, “FR1”, “FR2”, and “FR3” do not identify a particular polynucleotide, but rather are references to Table 1 of the specification listing genera of polynucleotides.
Claims 2-15 are also indefinite because of their dependence from, and thus inclusion of all limitations of, the claim(s) identified as indefinite above.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 1-2 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Asari et al., “Rapid genotyping of 25 autosomal STRs in a Japanese population using fluorescent universal primers containing locked nucleic acids” Journal of Forensic and Legal Medicine 31 (2015) 36-41.
Regarding claim 1, Asari et al. teach a locked nucleic acid-modified primer comprising a 10-nucleotide long 5’ portion that does not anneal to the template genomic nucleic acid and identifies the amplification products from template polynucleotides (i.e. a “barcode”) (Asari et al., figure 1, reproduced below).
PNG
media_image5.png
581
593
media_image5.png
Greyscale
The sequence of the 5’ end “barcode” in Asari is “ 5’-cgCcaGggTt-3’ ” wherein the uppercase bases are LNA modified sites. This sequence is 10 nucleotides long (i.e. Q=10), and comprises LNA sites at position 3, 6, and 9 (m=3), dividing the barcode into 4 segments. Under one interpretation of claim 1 discussed above wherein LNA sites are counted at the 5 end of the subsequent segment, this barcode would be “divided” as: “cg-Cca-Ggg-Tt”, having segment lengths of 2, 3, 3, and 2 (i.e. the number of bases in each segment is 2 to 4).
Therefore, the polynucleotide taught by Asari et al. teaches all of the structural limitations required by the product claim 1 as presently recited.
Regarding claim 2, as described above, the “barcode” sequence taught by Asari et al. is 10 nucleotides in length and comprises 3 LNA sites (i.e. Q=10 and m=3, therefore: integer(10/4) ≤ 3 ≤ integer (10/3) holds as 2 ≤ 3 ≤ 3).
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 1-12 are rejected under 35 U.S.C. 103 as being unpatentable over Krjutskov et al., US 2019/0323074 A1 (published October 24, 2019) in view of Glezer et al., US 2021/0198730 A1 (published July 1, 2021).
Regarding claim 1, Krjutskov et al. teach a locked nucleic acid-modified molecular barcode “barcode primer LNA (Seq ID No: 4) having the following sequence: 5’-CTGGAGCTGTCTGCGACTTT-3’, wherein the bold and underlined bases are locked nucleic acids.
SEQ ID NO: 4 taught by Krjutskov et al. is 20 bases in length (Q=20; greater than or equal to 10), and comprises 3 LNA sites (i.e. m=3; greater than or equal to 2) that divide the oligonucleotide into 4 segments of lengths: a) (3,6,6,5) [5’ LNA counting], b) (2,6,6,6) [3’ LNA counting], or c) (2,5,5,5) [no LNA counting].
Glezer et al. teach locked nucleic acid-modified molecular barcodes comprising a sequence of degenerate bases “N” (Glezer et al., Seq ID No: 11, length approximately 16-25 nucleotides) that is a unique molecular index wherein the melting temperature of the barcode sequences can be increased by the addition of 2-6 LNA bases to increase binding stability (i.e. optimize binding stability) (Glezer et al., paragraphs 0077 and 0083) (i.e. Q=16-25; m=2-6; segment length varies from a minimum of ~ 1 (where Q=16 and m=6 to a maximum of ~21 where Q=25 and m=2) (i.e. the number of possible bases per segment varies from about 1 to about 21 depending on the length of the barcode).
Therefore, it would have been prima facie obvious prior to the effective filing date of the claimed invention for one of ordinary skill in the art to have modified the locked nucleic acid-modified molecular barcodes taught by Krjutskov et al. with the teachings of Glezer et al. that the number and position of LNA bases within a particular molecular index can be altered to optimize the melting temperature of the barcode sequences to increase binding stability.
Regarding claim 2, Glezer et al. teach barcodes satisfying: integer(Q/4) ≤ m ≤ integer(Q/3): integer([16,25]/4) ≤ m ≤ integer([16,25]/3): [4,6] ≤ [2,6] ≤ [5,8].
Regarding claim 3, Glezer et al. teach a molecular barcode having 12 degenerate bases N (i.e. greater than 8) (SEQ ID NO: 11).
Regarding claim 4, Glezer et al. teach molecular barcodes include about 8 nucleotides (Glezer et al., paragraph 0082).
Regarding claims 5-6, Krjutskov et al. teach molecular barcodes having adjacent segments having the same number of constituent bases (Krjutskov et al., SEQ ID NO: 4, (see above)).
Regarding claims 7-11, considering the sequences SEQ ID NO: 1 and 2 in the specification, Glezer et al. teach locked nucleic acid-modified molecular barcodes comprising a sequence of degenerate bases “N” (Glezer et al., Seq ID No: 11, length approximately 16-25 nucleotides) that is a unique molecular index wherein the melting temperature of the barcode sequences can be increased by the addition of 2-6 LNA bases to increase binding stability (i.e. optimize binding stability) (Glezer et al., paragraphs 0077 and 0083) (i.e. Q=16-25; m=2-6; segment length varies from a minimum of ~ 1 (where Q=16 and m=6 to a maximum of ~21 where Q=25 and m=2) (i.e. the number of possible bases per segment varies from about 1 to about 21 depending on the length of the barcode).
Therefore, it would have been prima facie obvious prior to the effective filing date of the claimed invention for one of ordinary skill in the art to have modified the locked nucleic acid-modified molecular barcodes taught by Krjutskov et al. with the teachings of Glezer et al. that the number and position of LNA bases within a particular molecular index can be altered to optimize the melting temperature of the barcode sequences to increase binding stability.
Regarding claim 12, which depends from claim 1, Krjutskov et al. further teach a “right amplification primer 50” having a common sequence (i.e. an adapter primer), a barcode sequence, a ligation oligonucleotide binding site (i.e. a specific primer), wherein the barcode is a UMI (i.e. a molecular barcode as described in the rejection of claim 1 above) (Krjutskov et al., paragraph 0048-0049 and corresponding figures 1D, 1E, and 2).
Claims 13-15 are rejected under 35 U.S.C. 103 as being unpatentable over Krjutskov et al. in view of Glezer et al., as applied to claims 1-12 above, and further in view of Illumina Document #1000000002694 v01, February 2016, GenBank AM082295.1 (published 2006) and HM774966.1 (published 2010), Fu et al., WO 2016160844 A2 (published 2016), Rychlik (Nucleic Acids Research, Vol 17, No. 21, Pg. 8543-8551, 1989), and Buck (Biotechniques, Vol. 27, Pg. 528-536, 1999).
Regarding claim 13, which depends from claim 12, the sequence SEQ ID NO: 3 and 4: 5’ GACTGGAGTTCAGACGTGTGCTCTTCCGATC-[10 bp barcode]-CTTACCTGAGGAGACGGTG 3’
Wherein [10 bp barcode] =
NNNANNNTNN (in SEQ ID NO: 3) is SEQ ID NO: 1 OR
NNCNNNANNN (in SEQ ID NO: 4) is SEQ ID NO: 2,
It is noted that the sequence GACTGGAGTTCAGACGTGTGCTCTTCCGATC is 100% identical to the 3’ end of the Illumina TruSeq Index PCR primers (Illumina, page 20):
Illumina TruSeq Index Primer:
5’ CAAGCAGAAGACGGCATACGAGAT[6 bases]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
5’ end of SEQ 3/4: GACTGGAGTTCAGACGTGTGCTCTTCCGATC
The 3’ end of SEQ ID NOs: 3/4 is 100% identical to naturally occurring sequences found in the human IGHV3-23*01 gene for immunoglobulin heavy chain variable region exemplified by the following alignment to GenBank ID AM082295.1:
PNG
media_image6.png
247
1067
media_image6.png
Greyscale
Furthermore, Fu et al. teach gene specific primers comprising Illumina adapter sequences, unique molecular indices, and a gene specific primer sequence: Fu et al., paragraph 0204-0207 and figure 1, reproduced below):
PNG
media_image7.png
322
682
media_image7.png
Greyscale
Even more, Rychlik teaches it is routine and predictable to make primers for DNA amplification wherein primers are designed to a known oligonucleotide sequences. Rychlik teaches criteria to design/choose suitable primers for DNA amplification (see whole document and Abstract). Buck further expressly provides evidence of the equivalence of primers. Specifically, Buck invited primer submissions from a number of labs (39) (Pg. 532, Column 3), with 69 different primers being submitted (Pg. 530, column 1). Buck also tested 95 primers spaced at 3 nucleotide intervals along the entire sequence at issue, thereby testing more than 1/3 of all possible 18-mer primers on the 300 base pair sequence (Pg. 530, column 1). When Buck tested each of the primers selected by the methods of the different labs, Buck found that every single primer worked (Pg. 533, Column 1). Further, every single control primer functioned as well (Pg. 533, column 1). Buck expressly states, “The results of the empirical sequencing analysis were surprising in that nearly all of the primers yielded data of extremely high quality (Pg. 535, Column 2).” Therefore, Buck provides direct evidence that all primers would be expected to function, and in particular, all primers selected according to the ordinary criteria. This clearly shows that every primer would have a reasonable expectation of success.
Therefore, it would have been prima facie obvious prior to the effective filing date of the claimed invention for one of ordinary skill in the art to have combined the molecular indices comprising LNA modified sites taught by Krjutskov et al. in view of Glezer et al. with the well-known and widely used Illumina indexing primer and the known nucleic acid sequence of a naturally occurring target sequence (e.g. AM082295.1) as taught by Genbank and Fu et al. Furthermore, the ordinary artisan would have had a reasonable expectation of success with the resulting Illumina-molecular index-target sequence primers as clearly demonstrated by Rychlik and Buck.
Regarding claim 14, the claim requires a primer set comprising a forward primer comprising at least one of the polynucleotides in Table 1 (FR1-FR3), and the reverse primer according to claim 12.
All of the polynucleotides of FR1-FR3 are of the form:
5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCGGCCTCAGGAAGGTCTCCTGCAAG-3’, wherein the underlined 5’ terminus is shared among all of the primers, which is 100% identical to a portion of the TruSeq Universal Adapter taught by Illumina:
5’ AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT 3’
5’ 5’ACACTCTTTCCCTACACGACGCTCTTCCGATC 3’,
the italicized portion is a 10 bp molecular barcode according to claim 1 (NNCNNNANNN),
and the 3’ terminus is 100% identical to a naturally occurring portion of the human IGHV1-24 gene (see UCSC genome browser short sequence match below) (this example is SEQ ID NO: 5).
PNG
media_image8.png
211
1445
media_image8.png
Greyscale
Similarly to claim 13, Fu et al. teach gene specific primers comprising Illumina adapter sequences, unique molecular indices, and a gene specific primer sequence: Fu et al., paragraph 0204-0207 and figure 1, reproduced below):
PNG
media_image7.png
322
682
media_image7.png
Greyscale
Even more, Rychlik teaches it is routine and predictable to make primers for DNA amplification wherein primers are designed to a known oligonucleotide sequences. Rychlik teaches criteria to design/choose suitable primers for DNA amplification (see whole document and Abstract). Buck further expressly provides evidence of the equivalence of primers. Specifically, Buck invited primer submissions from a number of labs (39) (Pg. 532, Column 3), with 69 different primers being submitted (Pg. 530, column 1). Buck also tested 95 primers spaced at 3 nucleotide intervals along the entire sequence at issue, thereby testing more than 1/3 of all possible 18-mer primers on the 300 base pair sequence (Pg. 530, column 1). When Buck tested each of the primers selected by the methods of the different labs, Buck found that every single primer worked (Pg. 533, Column 1). Further, every single control primer functioned as well (Pg. 533, column 1). Buck expressly states, “The results of the empirical sequencing analysis were surprising in that nearly all of the primers yielded data of extremely high quality (Pg. 535, Column 2).” Therefore, Buck provides direct evidence that all primers would be expected to function, and in particular, all primers selected according to the ordinary criteria. This clearly shows that every primer would have a reasonable expectation of success.
Therefore, it would have been prima facie obvious prior to the effective filing date of the claimed invention for one of ordinary skill in the art to have combined the molecular indices comprising LNA modified sites taught by Krjutskov et al. in view of Glezer et al. with the well-known and widely used Illumina indexing primer and the known nucleic acid sequence of a naturally occurring target sequence (e.g. HM774966.1) as taught by Genbank and Fu et al. Furthermore, the ordinary artisan would have had a reasonable expectation of success with the resulting Illumina-molecular index-target sequence primers as clearly demonstrated by Rychlik and Buck.
Regarding claim 15, Fu et al. teach kits comprising barcoding reagents, primers, buffers, and DNA polymerase (Fu et al., paragraph 0166).
Conclusion
No claim is allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ZACHARY MARK TURPIN whose telephone number is (703)756-5917. The examiner can normally be reached Monday-Friday 8:00 am - 5:00 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Winston Shen can be reached at 5712723157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/Z.M.T./Examiner, Art Unit 1682
/WU CHENG W SHEN/Supervisory Patent Examiner, Art Unit 1682
Prosecution Insights