Prosecution Insights
Last updated: October 04, 2026
Application No. 18/702,703

GENOME EDITING COMPOSITIONS AND METHODS FOR TREATMENT OF USHER SYNDROME TYPE 3

Non-Final OA §103§112
Filed
Apr 18, 2024
Priority
Oct 21, 2021 — provisional 63/270,368 +2 more
Examiner
VIJAYARAGHAVAN, JAGAMYA NMN
Art Unit
1633
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Prime Medicine Inc.
OA Round
1 (Non-Final)
62%
Grant Probability
Moderate
1-2
OA Rounds
1y 3m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 62% of resolved cases
62%
Career Allowance Rate
25 granted / 40 resolved
+2.5% vs TC avg
Strong +49% interview lift
Without
With
+49.3%
Interview Lift
resolved cases with interview
Typical timeline
3y 8m
Avg Prosecution
45 currently pending
Career history
85
Total Applications
across all art units

Statute-Specific Performance

§101
5.0%
-35.0% vs TC avg
§103
31.6%
-8.4% vs TC avg
§102
13.2%
-26.8% vs TC avg
§112
33.6%
-6.4% vs TC avg
Black line = Tech Center average estimate • Based on career data from 40 resolved cases

Office Action

§103 §112
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Priority Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Information Disclosure Statement The information disclosure statements (IDS) submitted on 07/12/2024 and 05/19/2026 are in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statements are being considered by the examiner. Status of Claims Claims 1-3, 5, 21, 27, 30, 35, 39-41,44, 46, 50, 52, 55-56, 60, 62, 64, 66-67, 71, 74-75 are pending and under examination. Claim Interpretation Optional embodiments such as those recited in claim 44 are not given patentable weight as they are not necessary embodiments. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1-3, 5, 21, 27, 30, 35, 39-41,44, 46, 50, 52, 55-56, 60, 62, 64, 66-67, 71, 74-75 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as failing to set forth the subject matter which the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the applicant regards as the invention. Claim 1 requires a CLRN1 gene. For the sake of clarity, the full form of acronyms should be spelled out at the first instance of their usage. Similar rejections apply to claims 41 for ngRNA, 55 for HNH domain. Claims 2-3, 5, 21, 27, 30, 35, 39-41,44, 46, 50, 52, 55-56, 60, 62, 64, 66-67, 71, 74-75 are rejected for their dependency on the rejected claims. Claim 21 recites sequence numbers 7-11 as primer binding sequences of the pegRNA. However, it is noted that there are no sequences as recited as SEQ ID NO: 7-11. Further, the claim recites sequence numbers for example, as 12 (SEQ ID NO: 12) etc. The metes and bounds of the phrases recited in the parentheses are indefinite since it is unclear how these limitations relate to the scope of the claimed invention. Claims 27 and 44 require that the spacer sequence, editing template or PBS be selected from any of those listed in “Table 1.” Where possible, claims are to be complete in themselves. Incorporation by reference to a specific figure or table “is permitted only in exceptional circumstances where there is no practical way to define the invention in words and where it is more concise to incorporate by reference than duplicating a drawing or table into the claim. Incorporation by reference is a necessity doctrine, not for applicant’s convenience.” Ex parteFressola, 27 USPQ2d 1608, 1609 (Bd. Pat. App. & Inter. 1993) (citations omitted). Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1-3, 5, 21, 27, 30, 40-41, 44, 46, 50, 52, 55, 62, 64, 66-67, 71, 74 and 75 are rejected under 35 U.S.C. 103 as being unpatentable over Whatley et al ( Front Genet. 2020 Oct 22; hereinafter "Whatley;" See PTO-892) and Chow et al (Nat Biomed Eng. 2021 Feb; hereinafter "Chow;" See PTO-892) in view of Nelles et al (US20210009987A1; Published Jan 14, 2021; hereinafter “Nelles;” See PTO-892). Regarding claim 1: Whatley summarized the knowledge of genetic etiology and treatments for usher syndrome. Whatley taught that “The most common causative mutation for USH type III in Ashkenazi Jews of European and North American descent is the c.144T>G (p.N48K) mutation in CLRN1. This mutation is thought to adversely affect the folding and stability of the clarin-1 protein, ultimately causing progressive vision and HL” (See Whatley p. 16, col. 1, 2nd para). Whatley also taught that “Genome editing-based therapy is another promising approach for treating USH as it attempts to correct the mutation in vivo in a site-specific manner, while preserving endogenous regulation of the repaired gene. Zinc-finger nucleases (ZFN) are chimeric proteins generated by fusing a zinc-finger DNA-binding domain (ZF domains) to a DNA-cleavage domain. ZFN was applied to target a nonsense mutation (p.R31X) in Ush1c cell line, leading to recovered harmonin protein expression, with no apparent off-target effects” (See Whatley p. 15, col. 1, last para). As such it was known in the art that c.144T>G (p.N48K) mutation in CLRN1 and leads to the Usher Syndrome. Chow reported a web tool, named pegFinder,“for the rapid design of pegRNAs from reference and edited DNA sequences. pegFinder can incorporate sgRNA on-target and off-target scoring predictions into its ranking system, and nominates secondary nicking sgRNAs for increasing editing efficiency.” (See Chow, p. 2, first para). Chow further taught that pegRNAs are customized for particular target sequences and desired genomic modification by selecting appropriate spacer, Primer binding sites and reverse transcription region sequences based on the target locus. (See Chow Abstract). Chow taught that “[t]he 3’ extension is composed of a RT template that encodes the desired edit and a primer binding site (PBS) that anneals to the target genomic site to prime the RT reaction” (See Chow, p. 2, para 2). Chow taught that “[t]he 3’ extension is composed of a RT template that encodes the desired edit and a primer binding site (PBS) that anneals to the target genomic site to prime the RT reaction.” Further, Chow taught that “the precise lengths of the RT template and PBS sequence have both been demonstrated to significantly affect prime editing efficiency” (See Chow p.2, para 2). As such Chow taught that the PBS is selected from the target genomic sequence and that PBS sequence and length are routine design parameters that can be optimized for a given editing target. It is further noted that Chow taught that “Cas9 variants with expanded targeting ranges are also supported” (See Chow p. 2, Abstract). Therefore selection of a PBS comprising a sequence complementary to a portion of the spacer-targeted region, including the claimed reverse complement of nucleotides 10-14 of the spacer sequence would have constituted routine pegRNA design optimization absent evidence that the particular PBS yields unexpected results or possesses criticality. It is further noted that the claimed SEQ ID NO: 1 indicated as the spacer sequence for CLRN1 gene editing was known in the art. For example, Nelles (US20210009987A1; Published Jan 14, 2021; hereinafter “Nelles;” See PTO-892) taught a gRNA spacer sequence of a SEQ ID NO: 15416. (See Nelles [0456]). Query Match 100.0%; Score 17; Length 26; Best Local Similarity 100.0%; Matches 17; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GTCCAGCTCCTGCCCTG 17 ||||||||||||||||| Db 1 GTCCAGCTCCTGCCCTG 17 Sequence alignment between SEQ ID NO: 15416 of Nelles and SEQ ID NO: 1 of instant application. According to the teachings of Whatley and Chow in view of Nelles, it would have been obvious to a person of ordinary skill in the art, to edit the CLRN1 c.144T>G mutation to design a pegRNA targeting the CLRN1 locus using the routine pegRNA design principles taught by Chow, including selecting a spacer targeting the CLRN1 mutation site and designing an RT template encoding the corresponding wild-type CLRN1 sequence at the mutation position and designing an RT template encoding the corresponding wild-type CLRN1 sequence at the mutation position to effect correction of the mutation. It would further have been obvious to select an appropriate PBS from the target genomic region capable of annealing to the nicked strand, including sequences derived from the spacer-targeted locus, because Chow teaches that PBS sequence and length are routine design variables that are optimized based on target-site sequence context and editing efficiency. Regarding claims 2, 5, 21, 27, 40-41, 44, 52, 55, 66-67, 71, 74 and 75: Chow taught that “an appropriate RT template and PBS sequence to generate the desired edit by evaluating the positioning of the edited bases and the GC content of the sgRNA, respectively” (See Chow p. 3, para 2) can be identified by their pegFinder software. It is further noted that Chow taught that “optimization of pegRNAs for each experimental application may be necessary[,] [s]ince the efficiency of prime editing has been shown to vary widely depending on the length and/or base composition of the RT template and PBS” (See Chow, p. 3, para 3). Chow taught that the RT template is a modular component of the pegRNA that encodes the desired edit and is routinely varied in sequence and length depending on the intended genomic modification. Accordingly, selection of RT template comprising SEQ ID NO: 22-26 would have been an obvious design choice representing one of finite number of predictable RT template sequences generated for the same target mutation and desired corrective edit, absent evidence of unexpected results. Therefore, the claimed pegRNA represents the predicable result of applying known pegRNA design methodologies of Chow to a known disease-causing mutation in CLRN1, with routine optimization of spacer, PBS and RT template parameters. Regarding claim 3: The claimed SEQ ID NO: 2 indicated as the spacer sequence for CLRN1 gene editing was known in the art. For example, Nelles (US20210009987A1; Published Jan 14, 2021; hereinafter “Nelles;” See PTO-892) taught a gRNA spacer sequence of a SEQ ID NO: 15414. (See Nelles [0456]). Query Match 100.0%; Score 18; Length 26; Best Local Similarity 100.0%; Matches 18; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 TGTCCAGCTCCTGCCCTG 18 |||||||||||||||||| Db 2 TGTCCAGCTCCTGCCCTG 19 Sequence alignment for SEQ ID NO: 2 and SEQ ID NO: 15414 of Nelles Regarding claims 30 and 50: The claimed SEQ ID NO: 665 indicated as the core gRNA sequence was known in the art. For example, Nelles taught a gRNA scaffold sequence of a SEQ ID NO: 405. (See Nelles [0456]). Query 1 GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT 60 Query 61 GGCACCGAGTCGGTGC 76 |||||||||||||||| Sbjct 61 GGCACCGAGTCGGTGC 76 Sequence alignment for SEQ ID NO: 665 and SEQ ID NO: 405 of Nelles Regarding claim 46: Chow taught that “[n]icking the opposite strand can increase the efficiency of prime editing (PE3)2” (See Chow p. 7, para 2) can be identified by their pegFinder software. It is further noted that Chow taught that “To design “secondary” nicking sgRNAs to be used for PE3, pegFinder identifies sgRNA spacers de novo, based on the chosen CRISPR enzyme. pegFinder considers an sgRNA to be a candidate for secondary nicking if: 1) the sgRNA targets the strand opposite of the primary nicking sgRNA, 2) the secondary nick occurs 40-150nt away (default range, can be specified by user) from the primary nick, 3) no poly(T) tracts that would terminate U6 transcription, and if applicable, 4) the sgRNA has a sum “off-target” Tier I Bin I + Bin II score ≤ 1 (Broad designer) or the number of “seed off-targets” is 0 (CRISPRscan). pegFinder then selects the sgRNA spacer that nicks closest to ± 50nt from the primary nicking sgRNA. When incorporating on-target efficacy predictions, pegFinder chooses the sgRNA spacer with the highest on-target score among the candidate secondary nicking sgRNAs. All candidate secondary nicking sgRNA spacers are returned by pegFinder for ease of experimental optimization.” (See Chow p. 7, para 2). As such Chow taught a method to design and arrive at a ngRNA, even if specific ngRNA is not taught by the reference. Accordingly selection of ngRNA would have been an obvious design choice representing one of finite number of ngRNA spacer sequences generated for the same target mutation and desired corrective edit, absent evidence of unexpected results. Regarding claims 62 and 64: Chow taught delivery of prime editing machinery using lipofectamine (See Chow p 8, para 2). It is also noted that Chow taught that prime editing “approach involves two key components: 1) a catalytically impaired CRISPR-associated protein 9 (Cas9) nickase fused to a reverse transcriptase (PE2)” (See Chow p.2, 1st para). As such this requires that Cas9 nickase and the nucleic acid encoding the reverse transcriptase are the same mRNA molecule. Claim 35 is rejected under 35 U.S.C. 103 as being unpatentable over Whatley et al ( Front Genet. 2020 Oct 22; hereinafter "Whatley;" See PTO-892) and Chow et al (Nat Biomed Eng. 2021 Feb; hereinafter "Chow;" See PTO-892) in view of Nelles et al (US20210009987A1; Published Jan 14, 2021; hereinafter “Nelles;” See PTO-892) further in view of Liu et al (Cell Res; hereinafter “Liu;” See PTO-892). Regarding claim 35: The teachings of Whatley and Chow in view of Nelles are set forth above. It is noted that the cited references did not teach use of a 3’ hairpin in the pegRNA. However, it was known that “the PBS, which is generally 10–16 nt at the 3′ end of pegRNA, is complementary to part of the spacer at the 5′ end of pegRNA, and their annealing is expected to cause pegRNA circularization, which can potentially hamper editing” (See Liu p. 1134, col. 1, para 1). Liu indicated that they “fused the 20-nt Csy4 recognition site to the 3’ end of canonical pegRNA. This site, naturally present at Type I-F CRISPR-Cas systems, forms a hairpin,3 which might inhibit circularization when appended to the pegRNA. Indeed, the extended pegRNA outperformed the canonical pegRNA in inducing Cas9-meidated indels, increasing the efficiencies from 14.2% to 23.8% at FBN1, 55.4% to 74.9% at ALDOB, 6.0% to 32.2% at SITE1 and 14.7% to 23.8% at FTL, respectively” (See Liu p. 1134, col. 1, para 2). As such Liu taught the advantages of a 3’ hairpin in a pegRNA. Liu did not teach the claimed hairpin structure. However, it was well known that secondary structures for incorporation into gene editing systems can be easily engineered. For example, Kocak taught that “RNA hairpins are composed of two components, stems and loops, which we create by extending the PAM-distal end of the spacer to generate hp-sgRNAs. All designs were informed through the use of in silico structure determination.” In view of the teachings of the prior art that incorporation of 3’ hairpin enhances prime editing and that hairpin RNAs can be easily engineered in silico, it is submitted that a person of ordinary skill in the art would have been motivated to modify the pegRNA of Whatley and Chow to incorporate a hairpin at the 3’ end of pegRNA. Such modification would have involved routine optimization of RNA-secondary structuresto achieve the goal of improving pegRNA stability. Additionally, absent evidence of unexpected results, the selection of a particular hairpin would have been a routine design choice among a finite number of predictable RNA-stem-loop structures known in the art. Claim 39 is rejected under 35 U.S.C. 103 as being unpatentable over Whatley et al ( Front Genet. 2020 Oct 22; hereinafter "Whatley;" See PTO-892) and Chow et al (Nat Biomed Eng. 2021 Feb; hereinafter "Chow;" See PTO-892) in view of Nelles et al (US20210009987A1; Published Jan 14, 2021; hereinafter “Nelles;” See PTO-892) further in view of Anzalone et al (Nature; published 2019; hereinafter “Anzalone;” See PTO-892). The teachings of Whatley and Chow in view of Nelles are set forth above. It is noted that the cited references did not teach a template with PAM silencing mutations as required by the claim. It is however noted that introduction of a PAM-modifying silent mutation lead to improved editing efficiency and product purity. For example, Anzalone taught that the editing efficiency and product purity improved from 26-52% to 58% correction with 1.4% indels. (See Anzalone p. 155, col. 2, last para). It would have therefore been obvious to a person of ordinary skill in the art to encode PAM-silencing edit in the editing template of the pegRNA in order to reduce repeated targeting of the editing template and improve editing efficiency. Claims 56 and 60 are rejected under 35 U.S.C. 103 as being unpatentable over Whatley et al ( Front Genet. 2020 Oct 22; hereinafter "Whatley;" See PTO-892) and Chow et al (Nat Biomed Eng. 2021 Feb; hereinafter "Chow;" See PTO-892) in view of Nelles et al (US20210009987A1; Published Jan 14, 2021; hereinafter “Nelles;” See PTO-892) further in view of Zhi et al (Mol Ther. 2022 Jan 5; E.Pub Jul 21, 2021; hereinafter “Zhi;” See PTO-892). The teachings of Whatley and Chow in view of Nelles are set forth above. It is noted that the cited references did not teach a split prime editor system. Zhi taught four split-PE (split-PE994, split-PE1005, split-PE1024, and split-PE1032) using Rma intein (Rhodothermus marinus) for accommodating the prime editor system in AAV gene delivery systems. (See Zhi, Abstract). Zhi “then demonstrated that split-PEs delivered by dual-AAV1, especially split-PE1024, could mediate base transversion and insertion at four endogenous sites in human cells” As such it would have been obvious for a person of ordinary skill in the art to use intein-extein system to deliver prime editors to a human cell to edit a genome locus. The person would have been motivated to use the system in view of the teachings of Zhi that use of such systems enables insertion of primer editors in AAV, in order to overcome the limited loading capacity of such vectors. As such, use of such systems would have constituted use of a known technique for reconstituting a large genome-editing proteins to a known prime editing system and would have yielded expected result of correcting the intended mutation in CLRN1 locus. Conclusion No claim is allowed Any inquiry concerning this communication or earlier communications from the examiner should be directed to JAGAMYA VIJAYARAGHAVAN whose telephone number is (703)756-5934. The examiner can normally be reached 9:00a-5:00p. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Christopher M. Babic can be reached at 571-272-8507. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /JAGAMYA NMN VIJAYARAGHAVAN/ Examiner, Art Unit 1633 /EVELYN Y PYLA/ Primary Examiner, Art Unit 1633
Read full office action

Prosecution Timeline

Apr 18, 2024
Application Filed
Jun 26, 2026
Non-Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12709733
CELL CULTURE MEDIA
4y 3m to grant Granted Aug 18, 2026
Patent 12681006
METHODS OF GENERATING HUMAN ENDOMETRIAL STROMAL FIBROBLASTS AND THREE-DIMENSIONAL MULTI-LAYERED HUMAN ENDOMETRIAL TISSUE COMPOSITIONS
4y 2m to grant Granted Jul 14, 2026
Patent 12667621
RNA FORMULATIONS SUITABLE FOR THERAPY
4y 6m to grant Granted Jun 30, 2026
Patent 12637700
NOVEL METABOLIC PATHWAY FOR PRODUCING ITACONIC ACID AND METHOD FOR PRODUCING ITACONIC ACID USING SAME
2y 5m to grant Granted May 26, 2026
Patent 12618045
AUTOMATED METHOD FOR PREPARING RETINAL PIGMENT EPITHELIUM CELLS
4y 4m to grant Granted May 05, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
62%
Grant Probability
99%
With Interview (+49.3%)
3y 8m (~1y 3m remaining)
Median Time to Grant
Low
PTA Risk
Based on 40 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month