Prosecution Insights
Last updated: August 18, 2026
Application No. 18/703,773

PLANT GENOME EDITING METHODS

Non-Final OA §102§103
Filed
Apr 23, 2024
Priority
Nov 08, 2021 — provisional 63/263,736 +1 more
Examiner
KUMAR, VINOD
Art Unit
1663
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Inari Agriculture Technology Inc.
OA Round
2 (Non-Final)
83%
Grant Probability
Favorable
2-3
OA Rounds
0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 83% — above average
83%
Career Allowance Rate
1184 granted / 1432 resolved
+22.7% vs TC avg
Strong +20% interview lift
Without
With
+20.4%
Interview Lift
resolved cases with interview
Fast prosecutor
2y 1m
Avg Prosecution
34 currently pending
Career history
1460
Total Applications
across all art units

Statute-Specific Performance

§101
6.8%
-33.2% vs TC avg
§103
21.9%
-18.1% vs TC avg
§102
16.4%
-23.6% vs TC avg
§112
48.7%
+8.7% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1432 resolved cases

Office Action

§102 §103
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION Status of objections and rejections 1. Claims 1, 2, 4, 5, 7, 11, 13 , 15, 17 and 18 are pending. Claims 3, 6, , 8-10, 12, 14 16, and 19-34 are cancelled by the Applicant. Accordingly, claims 1, 2, 4, 5, 7, 11, 13 , 15, 17 and 18 are examined on merits in the present Office action. Applicant’s response filed March 5, 2026 and March 6, 2026 is entered. 2. The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action. 3. Rejection of Claims 1, 2, 4, 5, 7, 11, 13 , 15, 17 and 18 provisionally rejected for nonstatutory double patenting as being unpatentable over claims 1-10, 12, 14, 16-21, 23, and 24 of copending Application No. 18/851,389 is withdrawn in light of terminal disclaimer filed in the papers of March 5, 2026. 4. Rejection of Claims 1, 2, 4, 5, 7, 11, 13 , 15, 17 and 18 under nonstatutory double patenting as being unpatentable over claims 1, 2, 5, 6, 9, 12, 16, 20, 22, 24, 25, 36, 46, 48, 51, 56, 58, 67, 69, 71, 79, 80 and 85 of copending Application No. 18/875,027 is withdrawn in light of terminal disclaimer filed in the papers of March 6, 2026. 5. Rejection of Claims 1, 2, 4, 5, 7, 13 and 15 under 35 U.S.C. 102(a)(1) as being anticipated by Miki et al. (Nature communications, 9:1967, pages 1-9, 2018) is withdrawn in light of claim amendments to claim 1 filed in the papers of March 5, 2026 and upon further consideration. 6. Rejection of Claim 5 under § 103 as obvious over Miki et al. (Nature communications, 9:1967, pages 1-9, 2018) in view of Svitashev et al. (Plant Physiology, 169:931-945, 2015) and Ma et al. (Molecular Plant, 9:961-974, 2016) is withdrawn in light of claim amendments to claim 5, filed in the papers of March 5, 2026 and upon further consideration. 7. Rejection of Claim 5 under 35 U.S.C. § 103 as obvious over Miki et al. (Nature communications, 9:1967, pages 1-9, 2018) in view of Svitashev et al. (Plant Physiology, 169:931-945, 2015) and Ma et al. (Molecular Plant, 9:961-974, 2016) and further in view of Samach et al. (Plant Journal, 95:30-40, 2018) is withdrawn in light of claim amendments to claim 5 filed in the papers of March 5, 2026 and upon further consideration. Information Disclosure Statement 8. Initialed and dated copy of Applicant’s IDS form 1449 filed in the papers of March 6, 2026 is attached to the instant Office action. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statements are being considered by the examiner. Terminal Disclaimer 9A. The terminal disclaimer filed on March 6, 2026 disclaiming the terminal portion of any patent granted on this application which would extend beyond the expiration date of any patent granted on US Patent Application NO. 18/851,389 has been reviewed and is accepted. The terminal disclaimer has been recorded. 9B. The terminal disclaimer filed on March 6, 2026 disclaiming the terminal portion of any patent granted on this application which would extend beyond the expiration date of any patent granted on US Patent Application NO. 18/875,027 has been reviewed and is accepted. The terminal disclaimer has been recorded. Claim Rejections - 35 USC § 102 10A. Claim(s) 1, 2, 4, 7, 11, 13, 15, 17 and 18 remain rejected under 35 U.S.C. 102(a)(1) as being anticipated by Niu et al. (US Patent Publication NO. US2019/0352655 A1, Published November 21, 2019) for the reasons of record stated in the Office action mailed in the papers of December 5, 2025. Niu et al. disclose a method of producing a genome-edited plant cell. Paragraph [0016] states that “the invention provides a method of modifying a plant cell by creating a plurality of targeted modifications in the genome of the plant cell.” This corresponds to the preamble of claim 1. Regarding step (a) Introducing into a plant cell a polynucleotide encoding one or more polypeptide elements of a genome-editing system, Paragraph [0063] discloses that “one or more vectors driving expression of one or more polynucleotides encoding elements of a genome-editing system (e.g., encoding a guide RNA or a nuclease) are introduced into a plant cell or a plant protoplast, whereby these elements, when expressed, result in alteration of a target nucleotide sequence.” This explicitly discloses introducing polynucleotides encoding genome-editing components. Regarding step (b) Selecting for a plant cell that expresses the polypeptide elements, paragraph [0067] explains that vectors or expression cassettes can include “a polynucleotide encoding a drug resistance or herbicide gene or a polynucleotide encoding a detectable marker such as GFP or GUS, to allow convenient screening or selection of cells expressing the vector.” This teaches selecting plant cells expressing the introduced polypeptide elements. Regarding step (c) Introducing one or more polynucleotide elements of the genome-editing system into the plant cell that expresses the polypeptide elements, paragraph [0064] discloses that “multiple guide RNAs can be expressed from one vector, with the appropriate RNA-guided nuclease expressed from a second vector,” and that additional vectors encoding guide RNAs “are delivered to a cell … that expresses the appropriate RNA-guided nuclease.” Paragraph [0068] further describes “modified plant cells comprising subsets of targeted modifications (e.g., one, two, three or more targeted modifications).” These teachings correspond to sequential introduction of genome-editing elements. Regarding step (d) Identifying a genome-edited plant cell from the plant cell obtained in step (c), paragraph [0067] again describes the use of selectable or detectable markers for “convenient screening or selection of cells expressing the vector.” Paragraph [0068] notes that modified plant cells having different targeted modifications “can be compared to determine the function of modified sequences.” These passages disclose identifying and selecting genome-edited plant cells. This addresses limitations of claim 1. Niu et al. disclose the method of claim 1 further comprising regenerating a genome-edited plant from the genome-edited plant cell of step (d). See Niu et al. at paragraph [0029], which discloses that “the modified plant is genetically identical to the original plant with the exception of the targeted modification and any changes as a consequence of regenerating or growing said plant from a plant cell of claim 1, and—optionally—further propagating said plant.” This expressly describes regeneration of a plant from a genome-edited plant cells (callus is bunch of plant cells, emphasis added) as recited in claim 2. This addresses limitations of claim 2. Niu et al. further disclose the method of claim 1 wherein the plant cell that expresses the polypeptide element(s) in step (c) has not been obtained from a regenerated plant that expresses the polypeptide element(s). See Niu et al. at paragraph [0045], explaining that the term “cultivar” refers to a plant line created by human intervention and distinct from a regenerated wild-type plant. The passage further encompasses breeding material, lines, and research material, which indicate plant cells not derived from a regenerated plant expressing the polypeptide element(s). This addresses limitations of claim 1. Niu et al. further disclose the method of claim 1 wherein the polypeptide element of the genome-editing system comprises an RNA-guided nuclease. See Niu et al. at paragraph [0064], disclosing that “elements of a genome-editing system (e.g., an RNA-guided nuclease and a guide RNA) are operably linked to separate regulatory elements on separate vectors.” This explicitly identifies an RNA-guided nuclease as part of the genome-editing system. Niu et al. further disclose the method of claim 1 wherein the polynucleotide element of the genome-editing system comprises a donor template polynucleotide. See Niu et al. at paragraph [0075], which discloses providing a donor template to the plant cell or protoplast in an amount sufficient to achieve insertion of a donor polynucleotide sequence, and further explains that such donor polynucleotides do not persist after a defined period. This corresponds to the donor template polynucleotide recited in claim 4. Niu et al. also disclose that wherein the polynucleotide element of the genome-editing system comprises a guide RNA (gRNA) for use with an RNA-guided nuclease, or a DNA encoding such gRNA. See Niu et al. at paragraph [0014], which states that “the gRNA is provided as a polynucleotide, or as a ribonucleoprotein including the gRNA and the RNA-guided nuclease.” This addresses limitations of claim 1. Niu et al. further disclose the method of claim 1, wherein the introducing step (a) is performed by Agrobacterium-mediated transformation. See Niu et al. at paragraph [0068] (“the expression cassette is adjacent to or located between T-DNA borders or contained within a binary vector, e.g., for Agrobacterium-mediated transformation”). Niu et al. also disclose that wherein the introducing step (c) of claim 1 is performed by biolistic. See Niu et al. at paragraph [0097], which discloses a polynucleotide composition including multiple gRNAs and an mRNA encoding the RNA-guided nuclease, combined with gold particles and delivered to a plant cell or protoplast by biolistic. This addresses limitations of claim 7. Niu et al. further disclose the method of claim 1, wherein the polynucleotide element of the genome-editing system is introduced into callus comprising the plant cell that expresses the polypeptide element(s). See Niu et al. at paragraph [0008], which describes providing plant cells, protoplasts, plant callus, tissues or parts, whole plants, and seeds having altered genetic sequences. This addresses limitations of claim . Niu et al. further disclose the method of claim 1, wherein the polynucleotide element of the genome-editing system is introduced into an explant comprising the plant cell that expresses the polypeptide element(s). See Niu et al. at paragraph [0552], which describes embedding soy explants in pre-bombardment medium with the shoot apical meristem oriented toward the trajectory of gold microparticles. This addresses limitations of claims 1 and 7. Niu et al. further disclose the method of any one of claims 1, wherein the time between introducing step (a) and introducing step (c) is about 4 to about 5 weeks. See Niu et al. at paragraph [0563], which describes repeated cycles of introducing editing reagents into meristems during vegetative development, with subculturing performed every two weeks, enabling multiple cycles over a 4–5 week period. At paragraph [0452], Niu et al. also disclose, wherein the time between introducing step (a) and introducing step (c) is several days which encompasses instantly claimed 72hrs -144 hrs (implying 3 to 6 days). Also see paragraphs [0553], [[0565] and [0584] which also disclose that the time between introducing step (a) and introducing step (c) is can be 2-4 days or several days which encompasses instantly claimed 72hrs -144 hrs. This addresses limitations of claims 1 and 11. Niu et al. further disclose the method of any one of claims 1, wherein the polynucleotide encoding one or more polypeptide elements of the genome-editing system comprises a first selectable marker. In particular, Niu et al. at paragraph [0067] disclose that “a vector or an expression cassette includes additional components, e.g., a polynucleotide encoding a drug resistance or herbicide gene or a polynucleotide encoding a detectable marker such as GFP or GUS to allow convenient screening or selection of cells expressing the vector.” Additionally, Niu et al. also disclose that wherein the first selectable marker comprises a phosphinothricin acetyltransferase marker or an imazapyr tolerance marker, Niu et al. also specifically, describe at paragraph [0280] that the “pCas9TPC-GmPDS vector also includes lac operon, aminoglycoside adenylyl transferase, and phosphinothricin acetyltransferase sequences for convenient selection of the plasmid in bacterial or plant cultures.” This addresses limitations of claim 13. Niu et al. further disclose the method of claim 1, wherein the one or more polynucleotide elements of the genome-editing system comprise a second selectable marker. Niu et al. disclose the inclusion of various selectable or detectable markers, stating that analogous plasmids may include “different promoters, terminators, selectable or detectable markers, a cell-penetrating peptide, a nuclear localization signal, a chloroplast transit peptide, or a mitochondrial targeting peptide, etc.” (see paragraph. [0278]), and also identifies aminoglycoside adenylyl transferase and phosphinothricin acetyltransferase as selectable markers (see paragraph [0282]). Additionally, Niu et al. disclose that wherein the second selectable marker comprises a phosphinothricin acetyltransferase marker or a fluorescent marker. See Niu et al. at paragraph [0067] which discloses identification of detectable markers such as GFP and GUS for selection. Also Niu et al. at paragraphs [0278] and [0282] further support the use of selectable markers including phosphinothricin acetyltransferase. This addresses limitations of claim 15. Niu et al. further disclose the method of claim 1 wherein the polypeptide elements of the genome-editing system further comprise one or more homology-dependent repair (HDR)-enhancing polypeptides. Niu et al. disclose at paragraph [0576] delivery of the HDR template as part of the Cas9 complex, stating: “Our method delivers the HDR template directly to the intended DNA cut site as a component of the Cas9 complex and uses a non-heritable form of the Cas9 complex.” (para. [0576]). This reflects the inclusion of HDR-enhancing functional components. This addresses limitations of claim 17. Niu et al. further disclose the method of claim 1, wherein the plant cell is a maize or soybean plant cell. Niu et al. at paragraph [0237] discloses “a modified maize cell comprising four targeted modifications…” and also “a modified soybean cell comprising a targeted modification… resulting in reduced pod shattering.” This addresses limitations of claim 18. Regarding claim 1, Niu et al. discloses a method of producing a genome-edited plant callus, as follows: Regarding step (a) of introducing into a plant cell a polynucleotide encoding one or more polypeptide element(s) of a genome-editing system, Niu et al. explicitly disclose introducing into a plant cell one or more vectors encoding elements of a genome-editing system. Paragraph [0016] of Niu et al. states that “the invention provides a method of modifying a plant cell by creating a plurality of targeted modifications in the genome of the plant cell,” and Niu et al. at [paragraph 0008] discloses methods for generating plant cells, protoplasts, and callus having altered genetic sequences. Niu et al. at paragraph [0063] further discloses introducing “one or more vectors driving expression of one or more polynucleotides encoding elements of a genome-editing system (e.g., encoding a guide RNA or a nuclease) … whereby these elements, when expressed, result in alteration of a target nucleotide sequence.” Regarding step (b) of selecting callus that expresses the polypeptide element(s), wherein the callus is obtained from the plant cell of step (a). Niu et al. at paragraph [0067] discloses selection of cells expressing the introduced genome-editing components. Niu et al. at paragraph [0067] describes vectors including selectable or detectable markers (e.g., drug-resistance genes, GFP, GUS) “to allow convenient screening or selection of cells expressing the vector.” Niu et al. at paragraph [0008] discloses obtaining plant callus having altered genetic sequences Niu et al. at paragraph [0585] discloses that transfected protoplasts are collected and transferred to callus induction medium “to regenerate edited plant candidates,” with candidates subsequently analyzed to determine whether they contain the intended edits. Regarding step (c) Introducing into cells of the callus that expresses the polypeptide element(s) one or more polynucleotide elements of the genome-editing system. Niu et al. further teaches iterative or multi-component delivery of genome-editing elements. Niu et al. Paragraph [0064] discloses expressing multiple guide RNAs from one vector while expressing the nuclease from another vector, and also delivering vectors encoding guide RNAs to a plant cell already expressing the nuclease. Additional support is found in Niu et al. at paragraphs [0068] and [0587]. Regarding step (d) of identifying a genome-edited plant callus comprising a genome-edited plant cell produced from step (c), Niu et al. discloses at paragraph [0067] identification and selection of edited cells or callus. Niu et al. at paragraph [0067] again describes selectable/detectable markers facilitating screening. Niu et al. at Paragraph [0008] discloses methods for generating plant callus having altered genetic sequences. Niu et al. at paragraphs [0586]–[0587] describe identifying edited events in regenerated callus and candidates. Thus, Niu et al. disclose each of the limitations of claim 1. Niu et al. disclose regeneration of modified plants. See Niu et al. at paragraph [0029] which states that “the modified plant is genetically identical to the original plant with the exception of the targeted modification and any changes as a consequence of regenerating or growing said plant from a plant cell … and—optionally—further propagating said plant.” This directly supports regeneration from edited callus. This addresses limitations of claim 1. Niu et al. at paragraph [0045] describe “cultivar” as a human-created variety distinct from a naturally occurring (“wild”) plant. The disclosure emphasizes generation of modified callus and edited plants directly from engineered cells and protoplasts, not from regenerated plants that themselves express the editing system, thus meeting the claim requirement. This addresses limitations of claim 1. Niu et al. at paragraph [0064] states that elements of the genome-editing system “(e.g., an RNA-guided nuclease and a guide RNA)” may be operably linked to regulatory elements on separate vectors. This addresses limitations of claim Niu et al. at paragraph [0075] clearly disclose use of donor templates for targeted insertions. Paragraph [0075] explains that donor templates are provided to the plant cell in sufficient quantities to support insertion of the donor polynucleotide sequence, and that donor polynucleotides do not persist in the cell after a period of time. Furthermore, Niu et al. at paragraph [0014] disclose that the polynucleotide element of the genome-editing system comprises a guide RNA (gRNA) for use with the RNA-guided nuclease, or a DNA encoding a gRNA for use with the RNA-guided nuclease. See Niu et al. at paragraph [0014] which states (“the gRNA is provided as a polynucleotide, or as a ribonucleoprotein including the gRNA and the RNA-guided nuclease”). This addresses limitations of claim 1. Niu et al. at paragraphs [0071], [0072], [0073], [0075], [0578], [0579] clearly teach using a donor polynucleotide by introducing in step (c). Also see all the examples wherein the use of donor template/molecule in repairing the new sequence in CRISPR based gene editing system is clearly disclosed. Niu et al. at paragraph [0068] clearly disclose that wherein the introducing of step (a) is by Agrobacterium-mediated transformation or by biolistic. Niu et al. at paragraph [0068] states “the expression cassette is adjacent to or located between T-DNA borders or contained within a binary vector, e.g., for Agrobacterium-mediated transformation”. Likewise Niu et al. at paragraph [0097] disclose that wherein the introducing of step (c) is by biolistic. Niu et al. at paragraph [0097] describes a polynucleotide composition including multiple gRNAs, an mRNA encoding the RNA-guided nuclease, and gold particles, delivered to a plant cell or protoplast via Biolistic. This addresses limitations of claim 7. Niu et al. at paragraph [0563] clearly disclose the time between the introducing of step (a) and step (c) is about 4–5 weeks. Niu et al. at paragraph [0563] describes repeated cycles of introducing editing reagents into meristems during vegetative development, with subculturing every two weeks and up to four cycles, corresponding to approximately a 4- to 5-week interval. It is also important to note that At paragraph [0452], Niu et al. also disclosed disclose, wherein the time between introducing step (a) and introducing step (c) is several days which encompasses instantly claimed 72hrs -144 hrs (implying 3 to 6 days). Also see paragraphs [0553], [[0565] and [0584] which also disclose that the time between introducing step (a) and introducing step (c) is can be 2-4 days or several days which encompasses instantly claimed 72hrs -144 hrs. It also addresses the limitations of claims 1 and 11. Niu et al. at paragraph [0576] clearly disclose that the polypeptide elements of the genome-editing system further comprise one or more HDR-enhancing polypeptides. Niu et al. at paragraph [0576] describes delivery of an HDR template as part of the Cas9 complex to improve homology-directed repair. This addresses limitations of claim 17. Niu et al. at paragraph [0237] the plant cell is a maize or soybean plant cell. Niu et al. at paragraph [0237] discloses modified maize cells containing targeted modifications (e.g., insertion of a nitrogen responsive element in NRT2.2) and modified soybean cells with targeted edits (e.g., insertion of a SHAT1-5 repressor sequence causing reduced pod shattering). This addresses limitations of claim 18. Accordingly, it is maintained that Niu et al. anticipated the claimed invention. 10B. Applicant’s arguments: Applicant traverses the rejection in the papers filed March 6, 2026. Applicant primarily argues that claim 1 is amended to recite time between the introducing of step (a) and the introducing of step (c) is 72 hours to 114 hours and Niu et al. at paragraphs [0563]-[0564] fail to disclose this claim limitation (response, pages 6-8). Applicant’s arguments are carefully considered but are deemed to be unpersusaive. Applicant’s attention is drawn to paragraph [0452], for example, wherein Niu et al. also disclose that wherein the time between introducing step (a) and introducing step (c) is several days which encompasses instantly claimed 72 hrs -144 hrs (implying 3 to 6 days). Also see paragraphs [0553], [0550], [0565] and [0584] which also disclose that the time between introducing step (a) and introducing step (c) is can be 2-4 days or several days which encompasses instantly claimed 72 hrs -144 hrs. Furthermore, Applicant has not identified any structural or procedural feature in amended claim 1 that is not taught by Niu et al. As discussed in the previous Office Action, Niu et al. disclose introduction of genome-editing system components into plant cells, selection of cells expressing those components, subsequent introduction of additional genome editing elements such as gRNAs or donor templates, and identification of edited plant cells (Niu et al., e.g., paras. [0063], [0064], [0067], [0075]). Dependent claims 2, 4, 5, 7, 11, 13, 15, 17, and 18 recite features that are also disclosed by Niu et al., including regeneration of plants from edited cells, use of donor templates, selectable markers, Agrobacterium transformation and biolistic delivery, HDR-related elements, and the use of maize or soybean cells (see Niu et al., e.g., paras. [0029], [0067], [0075], [0068], [0097], [0237], [0576]). Applicant has not presented arguments separately addressing these dependent claim limitations. It is important to note that should Applicant’s response, overcome this rejection, claims will be still be rejected under 102/103 with KSR, keeping into consideration that one of ordinary skill in the art would have expected that testing intervals such as approximately 3 to several days would be routine to allow adequate Cas9 expression, selection and recovery of viable cells before subsequent delivery of gRNA/donor, and would not involve any non-routine or inventive step. Accordingly, the rejection is maintained. Rejections - 35 USC § 103 11A. Claims 1, 2, 4, 7, 11, 13, 15 and 18 remain rejected under § 103 as obvious over Miki et al. (Nature communications, 9:1967, pages 1-9, 2018) in view of Svitashev et al. (Plant Physiology, 169:931-945, 2015) and Ma et al. (Molecular Plant, 9:961-974, 2016) for the reasons of record stated in the Office action mailed December 5, 2025. Miki et al. teach a clear and enabling method of sequential Agrobacterium-mediated transformation in which plant tissues are first transformed with a binary plant transformation vector that includes an expression cassette encoding a CRISPR-associated nuclease (Cas9) together with a selectable marker such as hygromycin phosphotransferase (HPT). Miki et al. teach selection of transformed cells expressing the Cas9 protein by hygromycin selection, regeneration of those selected cells into transgenic parental plants that stably express Cas9 and hygromycin resistance, and use of those parental Cas9-expressing lines as recipients for subsequent transformation with a second construct comprising an HDR donor sequence, an sgRNA targeting a genomic locus of interest, and a selectable marker (Basta resistance) to enable selection of plants that received the donor construct. Miki et al. further teach analysis of gene targeting events in progeny (T2) following bulk PCR screening and subsequent isolation of individual positive plants, and report that the heritable GT events obtained were precise, heritable, produced at high efficiency, and did not show unexpected mutations or rearrangements at the targeted loci. Miki et al. also teach using donor DNA (same as donor template polynucleotide) in their construct (see abstract; first three paragraphs, left column, p. 2; Results pp. 2–6; Discussion pp. 2–8; Methods p. 8; supplementary data). Thus, Miki et al. disclose each of the principal features recited in the claims: (a) initial introduction of a Cas9 expression cassette and selection for Cas9-expressing parental lines, (b) subsequent introduction of an HDR donor and sgRNA into those parental lines, and (c) recovery and molecular analysis of gene targeting events in progeny. Miki et al., however, do not teach or suggest delivery of the second construct by particle bombardment (biolistics), transforming explants to produce transgenic callus which is subsequently regenerated into plants, nor do they specifically disclose the timing interval between the initial introduction of the Cas9 cassette and the subsequent introduction of the sgRNA/donor construct. These particular procedural aspects are taught by Svitashev et al., who teach biolistic-mediated delivery of gRNAs (as DNA expression cassettes with markers or as in vitro-transcribed RNA) into maize immature embryos that had been pre-transformed to express Cas9 (UBI:Cas9 or MDH:Cas9) and a visible selectable marker. Svitashev et al. teach procedures whereby blue-fluorescing embryos containing preintegrated Cas9 are excised and incubated at defined temperatures (e.g., 28°C for UBI:Cas9 and 37°C for MDH:Cas9) for specified intervals, and describe post-bombardment incubation regimens, recovery of transformed embryos, generation of transgenic callus from bombarded immature embryos, and subsequent regeneration of transgenic plants. Importantly, Svitashev et al. also teach that simultaneous delivery of Cas9 and DNA-encoding gRNAs yields high somatic mutation rates and chimeric plants, and that separating delivery of Cas9 and gRNA (i.e., staged delivery) substantially reduces somatic mutation frequency—reportedly by up to approximately 100-fold—thereby improving the quality and uniformity of recovered events (see right column p. 934 through the end of the second paragraph, left column p. 936; Figures 1–4; Tables I–IV; Results, Discussion, Materials and Methods; supplemental data). Ma et al. reviews and contrasts the two widely used delivery strategies—Agrobacterium-mediated transformation and biolistic delivery—and explicitly discusses reasons to use and optimize these methods, alone or in combination, across diverse plant species (including maize and soybean), providing clear support that a skilled artisan would view the two methods as complementary and amenable to staged application (see in particular, Tables 1–2, Figures 1–3; pp. 971–972). A person having ordinary skill in the art (PHOSITA) before the earliest filing date of the subject application, seeking to increase editing efficiency, reduce undesirable integrations, and minimize somatic mosaicism in edited plants, would have been motivated to combine the teachings of Miki et al. and Svitashev et al. Specifically, it would have been obvious to first introduce Cas9 into plant tissues using Agrobacterium-mediated transformation as taught by Miki et al., select and regenerate parental lines that stably express Cas9 via the selectable marker (HPT), and then, in a subsequent operation, deliver guide RNA and/or HDR donor sequences to those Cas9-expressing parental lines using particle bombardment as taught by Svitashev et al. This combination is a straightforward application of known, alternative nucleic acid delivery techniques that Ma et al. recognizes as complementary. The motivation to combine is reinforced by Svitashev et al.’s explicit teaching that staged delivery of Cas9 and gRNA reduces somatic mutations and chimerism relative to simultaneous delivery; a PHOSITA would have understood that separating delivery steps addresses a known problem (high somatic mutation/chimerism) and thus would have had a reasonable expectation that staged delivery would yield improved, more uniform heritable editing outcomes. Claims reciting the mode of introducing the second construct by biolistics, the use of explant-to-callus regeneration, and the recited sequencing of steps map directly to the combined teachings of Miki et al. and Svitashev et al., and Ma et al. provides the general background support that these particular delivery choices are within standard options a skilled artisan would select and optimize. Claims 1 and 11, which recites timing or intervals between the initial introduction of Cas9 and the subsequent introduction of the guide/donor, are likewise obvious because timing is a matter of routine empirical optimization in plant transformation and tissue culture work. The prior art (including transient expression studies and conventional Agrobacterium transformation/tissue culture protocols) demonstrates that a skilled worker routinely varies expression windows—from hours to days or several weeks—to determine the interval that yields optimum expression, selection, or regeneration. A PHOSITA would have expected that testing intervals such as approximately 72 hours or several days would be routine to allow adequate Cas9 expression, selection and recovery of viable cells before subsequent delivery of gRNA/donor, and would not involve any non-routine or inventive step. In this regard, the legal standard articulated in KSR Int’l Co. v. Teleflex Inc., 550 U.S. 398 (2007), and applied in Ex parte Smith (B.P.A.I. June 25, 2007), teaches that predictable use of prior art elements according to their established functions renders combinations obvious even where there is no explicit express teaching or suggestion in a single reference. Here, the claimed combination merely applies established transformation and delivery methods (Agrobacterium for Cas9, biolistics for gRNA/donor) according to their known functions to address known limitations (somatic mutation/chimerism) and thus is unpatentable as obvious. For these reasons, the claimed subject matter as a whole is prima facie obvious over the combined teachings of Miki et al., Svitashev et al., and Ma et al. 11B. Applicant’s arguments: Applicant traverses the rejection in the papers filed March 6, 2026. Applicant primarily argues that Miki et al. fail to teach all elements of claim 1, particularly new limitations of 72 hours to 144 hours in the amended claim. Applicant further argues that deficiencies of Miki et al. are not remedied by Svitashev et al. and/or Ma et al. In light of these arguments, Applicant argues that combined teachings of Miki et al., Svitashev et al. and Ma et al. cannot render instantly claimed method obvious (response, pages 9-11). Applicant’s arguments are carefully considered but are deemed to be unpersusaive. It may be noted that Applicant’s arguments directed to the anticipation rejection do not overcome the obviousness rejection. Even if the exact timing interval of 72–144 hours were not explicitly disclosed in the primary reference, determining an optimal time interval between transformation events is a routine optimization parameter in plant transformation and tissue culture workflows. As explained previously, plant transformation protocols commonly require waiting periods of hours to several days for recovery, expression of introduced constructs, or selection of transformed cells. Adjusting the interval between transformation events to achieve optimal expression or editing efficiency would have been a routine matter of experimentation for a person of ordinary skill in the art. In response to these Applicant’s arguments, see for example, teachings of Jones et al. (Plant Methods, 2005, I:5 doi:10.1186/1746-4811-1-5, pages 1-9; see table 1, page 6); and Harmonis et al. (Asian Journal of Biological Sciences, 9(3):53-59, 2016; see abstract, material and methods at page 55, discussion at pages 57-58). It is maintained that Miki et al. teach sequential transformation involving initial introduction of Cas9 followed by introduction of sgRNA and donor constructs. Svitashev et al. further teach staged delivery of genome editing components into plant tissues and explain that separating delivery of Cas9 and gRNA reduces somatic mutation and chimerism. Ma et al. teach that Agrobacterium-mediated transformation and biolistic delivery are complementary methods that may be combined or optimized depending on the application. A person of ordinary skill in the art would therefore have been motivated to combine the teachings of these references to introduce Cas9 using Agrobacterium-mediated transformation, followed by delivery of gRNA and donor sequences using biolistic methods after an appropriate recovery interval. Selecting an interval such as 72–144 hours would have been an obvious matter of routine optimization to allow adequate expression of Cas9 before delivery of guide RNAs. Accordingly, the claims remain prima facie obvious over the cited combination of the cited prior art. 12A. Claims 1, 2, 4, 7, 11, 13, 15, 17 and 18 remain rejected under 35 U.S.C. § 103 as obvious over Miki et al. (Nature communications, 9:1967, pages 1-9, 2018) in view of Svitashev et al. (Plant Physiology, 169:931-945, 2015) and Ma et al. (Molecular Plant, 9:961-974, 2016) and further in view of Samach et al. (Plant Journal, 95:30-40, 2018) for the reasons of record stated in the Office action mailed December 5, 2025. Miki et al. teachings are taught as supra. Svitashev et al. teachings are taught as supra. Ma et al. teachings are taught as supra. The combined teachings of Miki et al., Svitashev et al., and Ma et al. supply the structural and procedural framework for staged delivery of genome editing components—introducing and selecting for Cas9-expressing parental lines and subsequently introducing sgRNAs and HDR donor sequences by an alternative delivery modality (e.g., biolistics) to reduce somatic mutation and improve editing outcomes—as explained in detail above. Miki et al., Svitashev et al., and Ma et al. do not explicitly teach the inclusion of HDR-enhancing polypeptides within the genome editing system Samach et al. add the specific teaching that overexpression of HDR-enhancing polypeptides in plants increases the frequency of HDR-mediated repair. Samach et al. thus identify specific polypeptide elements that, when overexpressed in plant cells, bias repair toward homologous recombination and improve targeted gene integration or gene targeting outcomes (see abstract, Introduction, Figures 1–5, Results, Discussion, Experimental Procedures pp. 30–39). While Miki et al., Svitashev et al., and Ma et al. do not explicitly teach the inclusion of HDR-enhancing polypeptides within the genome editing system. Nevertheless, a PHOSITA would have been motivated to incorporate an expression cassette encoding an HDR-enhancing polypeptide into the transformation constructs taught by Miki et al. and Svitashev et al., because Samach et al. teach that overexpression of such polypeptides increases HDR efficiency and would therefore be an obvious modification to improve the known Miki et al. and Svitashev et al. workflow. The proposed modification is a straightforward design choice grounded in established principles: when the technical problem is to increase homologous recombination-mediated repair (and thereby increase frequency and fidelity of GT events), the art of record (Miki et al. and Svitashev et al.) provides a direct solution—overexpress HDR-promoting factors—and a skilled artisan would have had a reasonable expectation of success in applying this solution in the context of the sequential transformation methods of Miki et al. and Svitashev et al., and the staged delivery modalities described by Miki et al. and Svitashev et al., and reviewed by Ma et al. In other words, incorporation of HDR-enhancing polypeptide expression cassettes into known transformation strategies would have been an obvious optimization to increase HDR rates in CRISPR/Cas9-mediated genome editing in plants. Additionally, as with the combination discussed in rejection above, the legal principles set forth in KSR and applied in Ex parte Smith establish that predictable results from combining known elements according to their established functions render the combination obvious. Here, the straightforward substitution or addition of an HDR-enhancing polypeptide expression cassette into the Miki et al. and Svitashev et al., protocol is such a predictable application: the elements (Cas9 expression, staged gRNA/donor delivery, selectable markers, tissue-regeneration protocols) are all known, and Samach et al. provides the further known functional element (HDR enhancement) that would be logically added to achieve the expected technical benefit. Therefore, the claimed inventions reciting HDR-enhancing polypeptide elements, and the other limitations previously discussed, are prima facie obvious over the combined teachings of Miki et al., Svitashev et al., Ma et al., and Samach et al. 12B. Applicant’s arguments: Applicant traverses the rejection in the papers filed March 6, 2026. Applicant primarily argues that Miki et al., Svitashev et al., and Ma et al. fail to disclose the combination of steps as recited in claim 1 which has been amended to recite 72 hours to 144 hours. Applicant further argues that there is nothing in Samach et al. teachings that can overcome the deficiencies of the combined teachings of Miki et al., Svitashev et al., and Ma et al. (response, pages 11-12). Applicant’s arguments are carefully considered but are deemed to be unpersusaive. It may be noted that Applicant’s arguments directed to the anticipation rejection do not overcome the obviousness rejection. It is noted that Applicant did not present arguments specifically addressing the rejection relating to HDR-enhancing polypeptides. It is maintained that Samach et al. teach that overexpression of certain recombination-related polypeptides enhances homologous recombination and increases HDR efficiency in plants. Because Miki et al. and Svitashev et al. already teach CRISPR/Cas-based genome editing systems utilizing donor templates for HDR-mediated gene targeting, a person of ordinary skill in the art would have been motivated to incorporate HDR-enhancing polypeptides as taught by Samach et al. to improve the efficiency of HDR-mediated repair events. The modification would represent a predictable application of a known technique to improve the efficiency of a known process. The combined references therefore render claim 17 obvious. As discussed above, even if the exact timing interval of 72–144 hours were not explicitly disclosed in the primary reference, determining an optimal time interval between transformation events is a routine optimization parameter in plant transformation and tissue culture workflows. As explained previously, plant transformation protocols commonly require waiting periods of hours to several days for recovery, expression of introduced constructs, or selection of transformed cells. Adjusting the interval between transformation events to achieve optimal expression or editing efficiency would have been a routine matter of experimentation for a person of ordinary skill in the art. In response to these Applicant’s arguments, see for example, teachings of Jones et al. (Plant Methods, 2005, I:5 doi:10.1186/1746-4811-1-5, pages 1-9; see table 1, page 6); and Harmonis et al. (Asian Journal of Biological Sciences, 9(3):53-59, 2016; see abstract, material and methods at page 55, discussion at pages 57-58). Accordingly, the claims remain prima facie obvious over the cited combination of the cited prior art. 13. Claims 1, 2, 4, 5, 7, 11, 13, 15 and 18 are rejected under § 103 as obvious over Niu et al. (US Patent Publication NO. US2019/0352655 A1, Published November 21, 2019) in view of Van Ex et al. (US Patent Publication NO. 2024/0132908 A1, Published April 25, 2025, seeks priority to Provisional Application No. 63/120,844, filed December 3, 2020). This rejection has been necessitated due to amendments to claim 5 filed in the papers of March 5, 2026. Niu et al. teachings are discussed in detail above in item 10A, wherein Niu et al. teach CRISPR/Cas-mediated genome editing methods in plant cells that include introducing a nuclease and guide RNA targeting a genomic locus and providing a donor DNA template to enable homology-directed repair for insertion of desired nucleotide sequences at the target site. Thus, Niu et al. teach the overall genome editing framework recited in the claims, including the use of donor templates to introduce defined sequences into plant genomes. Niu et al. do not teach donor template comprising a DNA molecule comprising the sequence of SEQ ID NO: 2. Van Ex et al. teach synthetic donor DNA molecules used in plant genome engineering and disclose specific nucleotide sequences suitable for use as donor templates. In particular, Van Ex et al. disclose donor template sequences including SEQ ID NO:768 and SEQ ID NO:770, which have100% nucleotide sequence identity with instant SEQ ID NO: 2 as shown below. Also see for example, paragraphs [0077]-[0081], [0387], [0394], Table 00027; Table 00025. The sequence homology is shown as below: US-18-255-671-770 Sequence 770, US/18255671 Publication No. US20240132908A1 GENERAL INFORMATION APPLICANT: Van Ex, Fred APPLICANT: Toth, Katalin TITLE OF INVENTION: PEST AND PATHOGEN RESISTANT SOYBEAN PLANTS FILE REFERENCE: P13477WO00 CURRENT APPLICATION NUMBER: US/18/255,671 CURRENT FILING DATE: 2023-06-02 PRIOR APPLICATION NUMBER: US 63/120,844 PRIOR FILING DATE: 2020-12-03 NUMBER OF SEQ ID NOS: 781 SEQ ID NO 770 or SEQ ID NO: 768 LENGTH: 1600 TYPE: DNA ORGANISM: Artificial FEATURE: OTHER INFORMATION: synthetic Query Match 100.0%; Score 36; Length 1600; Best Local Similarity 100.0%; Matches 36; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GTAAGCGCTTACGTAAGCGCTTACGTAAGCGCTTAC 36 |||||||||||||||||||||||||||||||||||| Db 964 GTAAGCGCTTACGTAAGCGCTTACGTAAGCGCTTAC 999 However, Niu et al. do not explicitly disclose a donor template comprising the specific nucleotide sequence of SEQ ID NO: 2. Given, Van Ex et al. demonstrate that synthetic donor DNA molecules containing such sequences were known and used in plant genetic engineering systems, it would have been therefore, obvious to a person having ordinary skill in the art prior to earliest filing date of the instantly claimed invention to utilize a donor template sequence such as that disclosed by Van Ex et al. within the CRISPR genome editing method taught by Niu et al. in order to introduce a desired nucleotide sequence into a plant genome. Both references are directed to plant genetic engineering and rely on the same homology-directed repair mechanism for targeted sequence insertion. Substituting a known donor DNA sequence within a known CRISPR editing framework represents the predictable use of prior art elements according to their established functions, consistent with the reasoning of KSR International Co. v. Teleflex Inc. 550 U.S. 398 (2007). Therefore, selecting a donor template comprising the nucleotide sequence recited in claim 5 would have been a routine and predictable variation of the methods taught in the prior art with a reasonable expectation of success. It would have been also obvious and within the scope of an ordinary skill in the art prior to earliest filing date of instantly claimed invention to have used any donor template DNA, including the one taught by Van Ex et al. as a matter of design choice to arrive at the Applicant’s claimed method with a reasonable expectation of success and without any surprising results. Conclusions 14. Claims 1, 2, 4, 5, 7, 11, 13, 15, 17 and 18 remain ejected. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Contact Information Any inquiry concerning this communication or earlier communications from the examiner should be directed to Vinod Kumar whose telephone number is (571) 272-4445. The examiner can normally be reached on 8.30 a.m. to 5.00 p.m. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad A. Abraham can be reached on (571) 270-7058 The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA). /VINOD KUMAR/Primary Examiner, Art Unit 1663
Read full office action

Prosecution Timeline

Apr 23, 2024
Application Filed
Dec 05, 2025
Non-Final Rejection mailed — §102, §103
Mar 04, 2026
Examiner Interview Summary
Mar 04, 2026
Applicant Interview (Telephonic)
Mar 05, 2026
Response Filed
May 06, 2026
Final Rejection mailed — §102, §103
Jun 25, 2026
Response after Non-Final Action

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12702111
ALFALFA VARIETY C0417A3151
2y 5m to grant Granted Aug 11, 2026
Patent 12696869
Hybrid Tomato Variety 'H2239'
3y 7m to grant Granted Aug 04, 2026
Patent 12696860
PENNYCRESS VARIETIES WITH IMPROVED SHATTER RESISTANCE AND EARLY MATURITY
2y 9m to grant Granted Aug 04, 2026
Patent 12690538
PLANTS AND SEEDS OF HYBRID CORN VARIETY CH010547
2y 7m to grant Granted Jul 28, 2026
Patent 12677790
SOYBEAN VARIETY 01098315
2y 7m to grant Granted Jul 14, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

2-3
Expected OA Rounds
83%
Grant Probability
99%
With Interview (+20.4%)
2y 1m (~0m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 1432 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month