DETAILED ACTION
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claim(s) 1-2, 5-6, and 8-14 are pending and under consideration.
Preliminary Amendments
Applicant’s preliminary amendment filed on 04/25/2024 is acknowledged. The claims were amended to (a) cancel claims 2-3 and 7, and (b) amend claims 1, 5, 6, and 8-14. The specification was amended to (a) add a “cross-reference” to related applications statement, (b) amend minor informalities, and (c) amend the abstract.
Applicant’s preliminary amendment filed on 04/29/2024 is acknowledged. Applicant submitted replacement drawings for figures 1-17.
Priority
Acknowledgement is made that this application is a 371 of PCT/ES2022/070693 filed 10/25/2022 and claims priority based on foreign application filed as ESP202131001 on 10/25/2021.
All claims are given the priority date of 10/25/2021.
Information Disclosure Statement
Receipt of the information disclosure statement(s) on 04/25/2024 and 03/13/2026 are acknowledged. The signed and initialed PTO-1449 form(s) has/have been mailed with this action.
Drawings
The drawings are objected to because of the following:
A trademark, i.e., Lipofectamine is in Fig. 7-14;
A trademark, i.e., JetPei is in Fig. 16;
Figure 3A has a bolded number in the condition labels on the left side of the image;
Figure 7 seems to be missing two panels, as well as the “A” is in the middle of a graph axis, there are two “B”s, and two “C”s;
Figure 7A, there is two Cs in “CControl”;
Figure 7A has too many labels for how many images are corresponding to it, i.e., control, control + lipofectamine, CControl, hokDmerged, and ldrBDAPI for only four images;
Figure 8 is split between two pages, as well as missing two panels, and missing labels (A)-(D) for all panels;
Figure 9 is split between two pages;
The label for figure 14 is not on the same page as the actual figure, as well as it seems like two panels are missing or moved; and
Figure 15A’s axis and 15B labels are illegible;
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Specification
Abstract
Applicant is reminded of the proper language and format for an abstract of the disclosure.
The abstract should be in narrative form and generally limited to a single paragraph on a separate sheet within the range of 50 to 150 words in length. The abstract should describe the disclosure sufficiently to assist readers in deciding whether there is a need for consulting the full patent text for details.
The language should be clear and concise and should not repeat information given in the title. It should avoid using phrases which can be implied, such as, “The disclosure concerns,” “The disclosure defined by this invention,” “The disclosure describes,” etc. In addition, the form and legal phraseology often used in patent claims, such as “means” and “said,” should be avoided.
The abstract of the disclosure is objected to because of legal phraseology. The abstract recites “said” in line 4 referring to “said polynucleotides”. A corrected abstract of the disclosure is required and must be presented on a separate sheet, apart from any other text. See MPEP § 608.01(b).
Trademarks and/or Tradenames
The use of the following term(s) which is a trade name or a mark used in commerce, has been noted in this application in at least the following locations:
EnSight (p. 5-6, line 3 of Figures 1-4, 9-10, and 13 description of the figures; and p.9 under ATPlite based assays);
Lipofectamine (p.6, lines 2-5 of Figures 7-8 and 14 description of the figures; p. 9, line 6 of para 3; p.13 line 12; Table 4; Table 5);
ATPlite (p.7, line 6 of Figures 1-4, 9-10; p.9 under ATPlite-based assays; p.11 para 4 line 9; p.13 last line; p.14 first line); and
JetPei (p.10, para 2, line 9).
The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
Claim Objections
Claim 2 is objected to because of the following informalities:
It would be remedial to amend claim 2 from “A genetic construct according to” to “The genetic construct according to” since this claim further limits claim 1 by further limiting the proliferation inhibitor gene.
The recitation of, “according to the preceding claim wherein”, without explicitly reciting which claim number should be amended to recite, “The genetic construct according to claim 1, wherein the proliferation inhibitor gene is ldrB.” Claim 1 is the only preceding claim. Thus, it is clear that claim 2 depends from claim 1.
Claim 5 is objected to because of the following informalities:
It would be remedial to amend claim 5 from “a genetic construct according to” to “the genetic construct according to” since this claim further limits claim 1 by further limiting the construct to a cell comprising.
Claim 6 is objected to because of the following informalities:
“according to” is repeated, it would be remedial to remove one.
Claim 8 is objected to because of the following informalities:
It would be remedial to remove the dash between “construct” and “according”.
Claim(s) 13 and 14 are objected to because of the following informalities:
It would be remedial to amend claims 13 and 14 from “A medical composition according to claim 6” to “The medical composition according to claim 6” since these claims further limit claim 6 with the addition of drugs.
The recitation of “any of the drugs selected from the list consisting of . . . any combination thereof” is redundant. It would be remedial to amend the claims to recite “further comprising one or more of the drugs selected from the list consisting of” and remove “any combination thereof”.
Atezolizumab is misspelled with an additional “o” at the end.
Claim 13:
The medical composition according to claim 6 further comprising one or more of the drugs selected from the list consisting of: Trastuzumab deruxtecan, Pertuzumab, Ado-trastuzumab emtansine, Sacituzumab govitecan, Tucatinib, Neratinib, Lapatinib, Palbociclib, Ribociclib, Abemaciclib, Alpelisib, Everolimus, Olaparib, Talazoparib and Atezolizumab.
Claim 14:
The medical composition according to claim 6 further comprising one or more of the drugs selected from the list consisting of: Cisplatin, Bevacizumab, Pembrolizumab, Carboplatin, Tisotumab vedotin, Gemcitabine, Ifosfamide, Irinotecan and Paclitaxel.
Appropriate correction is required.
Claim Rejections - 35 USC § 112(b) - indefiniteness
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim(s) 1-2, 5-6, and 8-14 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 1 is vague and indefinite in that the metes and bounds of (1) “A genetic construct comprising a nucleotide sequences corresponding to a gene expression system or vector comprising at least one RNA or DNA polynucleotide of the hokD gene and of a proliferation inhibitor gene. . .” and (2) “ . . . operatively linked to at least one survivin promoter directing transcription of said nucleotide sequence and to other sequences necessary or appropriate for transcription and its regulation in time and place for transcription in vitro or in vivo.”, are unclear.
Regarding (1) it is particularly unclear if (a) the genetic construct of the preamble comprises a nucleotide sequence or if (b) the genetic construct comprises a vector comprising at least one RNA or DNA polynucleotide or if (c) the genetic construct comprises either a gene expression system or vector and subsequently either the expression system or vector comprise at least one RNA or DNA polynucleotide.
Regarding (2) it is particularly unclear that (a) “at least one RNA polynucleotide of the hokD gene” is “operatively linked to at least one survivin promoter”. RNA is not to be linked to a vector or a promoter, thus it is unclear if the polynucleotide is intended to be conformed to RNA or if the intent is to use the DNA as RNA. Also, DNA is “transcribed”, not “RNA” (RNA is translated), which the word “transcription” is used three times in the claim to attempt to define what is happening to the polynucleotide.
The term “necessary or appropriate” in claim 1 is a relative term which renders the claim
indefinite. The term “necessary or appropriate” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. The phrase necessary or appropriate renders the metes and bounds of the genetic construct or vector unclear and does not allow one of skill in the art to ascertain the breadth of the construct.
The term “in time and place” in claim 1 is a relative term which renders the claim
indefinite. The term “in time and place” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. The phrase “in time and place” renders the metes and bounds of the genetic construct or vector unclear and does not allow one of skill in the art to ascertain when (time) and/or where (place) the transcription is occurring.
Claim 1 recites the limitation "the hokD gene" in line 3. Poulsen et al (A family of genes encoding a cell-killing function may be conserved in all Gram-negative bacteria, Molecular Microbiology, vol 3, issue 11, pages 1463-1472, published in 1989) discloses that the hok or hok-homologous proteins are found in a broad range of gram-negative bacteria, including P.putida, and gram-positive bacteria such as Bacillus subtilis (see p.1469, col 2, para 4). Thus, there is insufficient antecedent basis for this limitation in the claim.
With these 35 U.S.C 112(b) rejections in mind, it would be remedial to amend the claim to recite:
“A genetic construct comprising at least one DNA polynucleotide of a hokD gene
and of a proliferation inhibitor gene operatively linked to at least one survivin promoter.”
Accordingly, claim(s) 2, 5-6, and 8-14 are rejected for being dependent upon claim 1.
Claim Interpretation
Claim 1 is being interpreted as “A genetic construct comprising at least one DNA polynucleotide of a hokD gene and of a proliferation inhibitor gene operatively linked to at least one survivin promoter.”
Claim 2 recites, “A genetic construct according to the preceding claim wherein the proliferation inhibitor gene is ldrB.” Since claim 1 is the only claim preceding claim 2. Claim 2 is interpreted as being dependent upon claim 1.
Claim Rejections - 35 USC § 112(d) – improper dependent
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim(s) 6 and 13-14 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
The specification does not define “medical” composition to encompass anything in addition to the genetic construct. Thus, “medical composition” does not further limit the genetic construct of claim 1.
The specification does describe transiently transfecting HeLa and MCF-7 cells with transfection reagents such as lipofectamine® or JetPei®, however, these trademarks cannot be directly inserted into the claim language without inciting a 35 U.S.C 112(b) rejection. These transfection reagents are considered excipients.
Therefore, one way to obviate rejection is to include “pharmaceutical excipient” in the claim to recite:
A medical composition comprising the genetic construct according to claim 1 and a pharmaceutical excipient.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Accordingly, claim(s) 13 and 14 are rejected for being dependent upon claim 6.
Claim Rejections - 35 USC § 112(a) – written description
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claim(s) 1, 5-6, and 8-14 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The fundamental factual inquiry is whether the specification conveys with reasonable clarity to those skilled in the art that, as of the filing date sought, Applicant was in possession of the invention as now claimed. See, e.g., Vas-Cath, Inc., 935 F.2d at 1563-64, 19 USPQ2d at 1117.
Claim 1 is drawn to a genus of “proliferation inhibitor gene” for a genetic construct driven by the survivin promoter. The rejected claim thus comprises a genus of proliferation inhibitor genes and are defined as belonging to the broad class of proliferation inhibitor genes for a genetic construct that is driven by the survivin promoter.
Claim 5 is drawn to a genus of “proliferation inhibitor gene” for cell comprising the genetic construct. The rejected claim thus comprises a genus of proliferation inhibitor genes and are defined as belonging to the broad class of proliferation inhibitor genes for a cell comprising the genetic construct that is driven by the survivin promoter.
Claim(s) 6 and 13-14 are drawn to a genus of “proliferation inhibitor gene” for medical composition comprising the genetic construct driven by the survivin promoter. The rejected claims thus comprise a genus of proliferation inhibitor genes and are defined as belonging to the broad class of proliferation inhibitor genes for a medical comprising the genetic construct that is driven by the survivin promoter and/or further comprising the drugs listing in claims 13 or 14.
Claim(s) 8-12 is drawn to a genus of “proliferation inhibitor gene” for prevention, amelioration, alleviation or treatment of a proliferative disease comprising administering the genetic construct that is driven by the survivin promoter. The rejected claims thus comprise a genus of proliferation inhibitor genes and are defined as belonging to the broad class of proliferation inhibitor genes for prevention, amelioration, alleviation or treatment of a proliferative disease comprising administering the genetic construct. Further wherein the proliferative disease is cancer, cancer characterized by the presenting of cancer stem cells, breast cancer, or cervical cancer.
To satisfy the written description requirement, MPEP §2163 states, in part “… a patent
specification must describe the claimed invention in sufficient detail that one skilled in the art can reasonably conclude that the inventor had possession of the claimed invention.” Moreover, the written description requirement for a genus may be satisfied through sufficient description of a representative number of species by “… disclosure of relevant, identifying characteristics, i.e.,
structure or other physical and/or chemical properties, by functional characteristics coupled with
a known or disclosed correlation between functional and structure, or by a combination of such
identifying characteristics, sufficient to show the applicant was in possession of the claimed genus.”
The specification envisions the proliferation inhibitor genes as the following:
“In a preferred embodiment of this aspect of the invention, the proliferation inhibitor gene is ldrB. When we speak of the ldrB Gene we refer to an isolated RNA or DNA polynucleotide, which has an identity of at least 80%, preferably 85%, 90%, 90%, 95% and most preferably 99% with the polynucleotide sequence of the ldrB gene (SEQ ID NO: 2). More preferably the polynucleotide is the ldrB gene, of nucleotide sequence SEQ ID NO: 2.
SEQ ID NO: 2 ATGACGCTCGCGCAGTTTGCCATGACTTTCTGGCACGACCTGGCGGCA
CCGATCCTGGCGGGAATTATTACCGCAGCGATTGTCGGCTGGTGGCGTAACCGGAAGTAA Isolated RNA or DNA polynucleotide, hereinafter second polynucleotide of the invention, capable of translating into an amino acidic sequence comprising a peptide having at least 90% identity to the amino acidic sequence of the LDRB protein (SEQ ID NO: 4). More preferably it refers to an isolated RNA or DNA polynucleotide capable of translation into an amino acid sequence comprising a peptide having at least 95%, 96%, 97%, 98% or 99% identity to the amino acid sequence of the LDRB protein. SEQ ID NO: 4 MTLAQFAMTFWHDLAA
PILAGIITAAIVGWWRNRK.”, (see page 4 of the instant specification).
Also see figures 2, 4, and 6-15.
Even if one accepts that the examples described in the specification meet the claim limitations of the rejected claims regarding structure and function, the examples are only representative one proliferation inhibitor gene used for a genetic construct driven by the survivin promoter. These results are not necessarily predictive of all “proliferation inhibitor genes” capable of use in a genetic construct driven by the survivin promoter and/or (a) a cell comprising the genetic construct driven by the survivin promoter, (b) a medical composition comprising the genetic construct and/or further comprising the listed drugs in claims 13 and 14, and (c) for prevention, amelioration, alleviation or treatment of a proliferative disease comprising administering the genetic construct that is driven by the survivin promoter. Thus, it is impossible for one to extrapolate from the one example of proliferative inhibitor gene described herein that the genus would necessarily meet the structural/functional characteristics of the rejected claims.
The prior art does not appear to offset the deficiencies of the instant specification in that it does not describe a set of “proliferation inhibitor genes” capable of use in a genetic construct driven by the survivin promoter and/or (a) a cell comprising the genetic construct driven by the survivin promoter, (b) a medical composition comprising the genetic construct driven by the survivin promoter and/or further comprising the listed drugs in claims 13 and 14, and (c) for prevention, amelioration, alleviation or treatment of a proliferative disease comprising administering the genetic construct that is driven by the survivin promoter.
Jie et al (Inhibition of cell proliferation by Tas of foamy viruses through cell cycle arrest or apoptosis underlines the different mechanisms of virus–host interactions, Virulence, Vol 13, issue 1, pages 342-354, published February 8th, 2022) teaches that “In this study, we found that the transactivator Tas in two foamy viruses isolated from Old World Monkey (OWM) induced obvious inhibition of cell proliferation via the upregulation of Foxo3a expression. It was mediated by the generation of ROS and the initiation of ER stress, and ultimately, the mitochondrial apoptosis pathway was triggered.”, (abstract).
Further, Fribley et al (Regulation of Apoptosis by the Unfolded Protein Response, Methods Mol Biol, vol 559, pages 191-204, published June 17th, 2013) teaches that “Biochemical, physiological, and pathological stimuli that interfere with ER function can disrupt ER homeostasis, impose stress to the ER, and subsequently cause accumulation of unfolded or misfolded proteins in the ER lumen. To deal with accumulation of unfolded or misfolded proteins, the cell has evolved highly specific signaling pathways collectively called the “unfolded protein response” (UPR) to restore normal ER functions. However, if the overload of unfolded or misfolded proteins in the ER is not resolved, the prolonged UPR will induce ER stress-associated programmed cell death, apoptosis, to protect the organism by removing the stressed cells.”, (abstract).
Ultimately, any gene can be overexpressed to a high enough level to activate cellular mechanisms that prevent/inhibit cellular proliferation (Fribley). For instance, in Jie et al, the transactivator Tas induced cell proliferation via Foxo3a expression, which was mediated by ROS generation, ER stress, and ultimately apoptosis. However, this overexpression is dependent upon the type of promoter driving the construct.
Garg et al (Improved nonviral cancer suicide gene therapy using survivin promoter-driven mutant Bax; Cancer Gene Therapy; vol 17, pages 155-163, published October 9th, 2009) teaches, “Suicide gene vectors are being developed in many laboratories as an attractive approach to cancer therapy. However, the development of these therapies is hampered by safety concerns and limitations of efficacy. The use of tumor-specific promoters, such as survivin promoter, can provide much needed specificity to target tumor cells. However, the expression levels from these promoters is often suboptimal and hence it is imperative to enhance the activity of the cytotoxic gene of interest.”, (abstract and see p. 161, col 2, para 1).
Thus, any gene driven by survivin is not adequately described if survivin cannot enhance activity of the gene to a high enough level to be a proliferation inhibitor gene.
Therefore, the art does not appear to offset the deficiencies of the specification. Merely describing a “proliferation inhibitor gene” capable of use in a genetic construct driven by the survivin promoter and/or (a) a cell comprising the genetic construct, (b) a medical composition comprising the genetic construct and/or further comprising the listed drugs in claims 13 and 14, and (c) for prevention, amelioration, alleviation or treatment of a proliferative disease comprising administering the genetic construct without sufficient detail relating to the genus of proliferation inhibitor gene in a genetic construct driven by the survivin promoter and/or (a) a cell comprising the genetic construct, (b) a medical composition comprising the genetic construct and/or further comprising the listed drugs in claims 13 and 14, and (c) for prevention, amelioration, alleviation or treatment of a proliferative disease comprising administering the genetic construct driven by the survivin promoter does not allow the skilled artesian to reasonably conclude that the Applicants were in possession of the claimed invention in claim(s) 1, 5-6, and 8-14.
The addition of the limitation of claim 2 into claim 1 would obviate this rejection.
Claim Rejections - 35 USC § 112(a) – lack of enablement
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claim(s) 8-12 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for a method of treating breast cancer or cervical cancer, the method comprising intratumoral administration of a medical composition comprising a genetic construct comprising at least one DNA polynucleotide of a hokD gene and a lrdB gene operatively linked to at least one survivin promoter; wherein the medical composition further comprises a pharmaceutically acceptable excipient, does not reasonably provide enablement for the prevention, amelioration, or alleviation of all proliferative diseases with a naked genetic construct comprising all proliferation inhibitor genes driven by the survivin promoter via all routes of administration. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention commensurate in scope with these claims.
Enablement is considered in view of the Wands factors (MPEP 2164.01(A)). These include: the breadth of the claims, the nature of the invention, the state of the prior art, the level of one of ordinary skill, the level of predictability in the art, the amount of direction provided by the inventor, the existence of working examples, and the quantity of experimentation needed to make or use the invention. All of the Wands factors have been considered with regard to the instant claims, with the most relevant factors discussed below.
Nature of the invention:
Claim 8 is drawn to a method for prevention, amelioration, alleviation, or treatment of a proliferative disease comprising administering the genetic construct according to claim 1. The nature of the invention is complex in that the genetic construct according to claim 1 must be capable of preventing, ameliorating, alleviating, and/or treating any/all proliferative disease through any/all routes of administration with any/all proliferation inhibitor genes driven by the survivin promoter
Claim(s) 9-12 limit the proliferative disease to (a) cancer (of claim 9), (b) cancer characterized by presenting cancer stem cells (of claim 10 depending from claim 9), (c) breast cancer (of claim 11 depending from claim 9), and (d) of cervical cancer (of claim 12 depending from claim 9). The nature of the invention is complex in that the genetic construct according to claim 1 must be capable of preventing, ameliorating, alleviating, and/or treating any/all forms of cancer, and/or cancer characterized by presenting cancer stem cells, and/or breast cancer, and/or cervical cancer, through any/all routes of administration with any/all proliferation inhibitor genes driven by the survivin promoter.
Breadth of the claims:
The broadest reasonable interpretation of claim 8 is that it encompasses a method of preventing, ameliorating, alleviating, and/or treating any/all proliferative disease through any/all routes of administration with the genetic construct of claim 1 which contains the survivin promoter, any/all hokD gene polynucleotides, and any/all proliferation inhibitor genes.
The complex nature of the subject matter of this invention is greatly exacerbated by the breadth of the claims.
Guidance of the specification:
Looking to the specification for guidance on (1) genetic constructs with a survivin promoter, hokD gene, and a proliferation inhibitor gene; (2) prevention of any proliferation disease; (3) treatment of any/all proliferation disease with the construct of claim 1; and (4) any/all routes of administration.
(1) genetic constructs with a survivin promoter, hokD gene, and a proliferation inhibitor gene driven by the survivin promoter
“A first aspect of the invention is constituted by a genetic construct, hereinafter referred to as "genetic construct of the invention", comprising a nucleotide sequence corresponding to a gene expression system or vector comprising at least one RNA or DNA polynucleotide of the hokD gene and of a proliferation inhibitor gene, operatively linked to at least one promoter that directs transcription of said nucleotide sequence, and to other sequences necessary or appropriate for transcription and their regulation appropriate in time and place for transcription in vitro or in vivo.”, (see bottom of page 3).
Wherein the hokD gene corresponds to SEQ ID NO: 1, and the proliferation inhibitor gene of the invention is only described to be ldrB, which is SEQ ID NO:2 (see bottom of page 3 and middle of page 4).
“In a most preferred embodiment of this aspect of the invention, the transcription-directing promoter is selected from the list consisting of telomerase promoter, epidermal growth factor receptor promoter, transferrin receptor promoter, carcinoembryonic antigen promoter and survivin promoter or any combination thereof. In an even more preferred embodiment of this aspect the promoter directing transcription is the survivin promoter.”, (see middle to bottom of page 4).
“As expected, the efficacy of the TRE3G-Dox promoter is much more potent than that of the survivin promoter. However, the mice had not shown any damage or metastasis, which means that the survivin promoter could be used as a tissue-specific promoter against breast and cervical cancer safely.”, (see line 3 of page 16).
(2/3) prevention/treatment of any proliferation disease
“Another aspect of the invention is based on the genetic construct of the invention, the cell of the invention, and/or the composition of the invention for the prevention, amelioration, alleviation or treatment of a proliferative disease. In a preferred embodiment of this aspect of the invention, the proliferative disease is cancer. In a more preferred embodiment the cancer is characterized by presenting cancer stem cells. Preferably, it is a cancer where the stem cells give rise to metastasis, resistance, recurrence or relapse of the disease. In other preferred embodiments the proliferative disease is breast cancer or cervical cancer. Another aspect of the invention is the use as a medicament for the prevention, amelioration, alleviation, or treatment of breast cancer of the genetic construct of the invention, the cell of the invention, and/or the composition of the invention, in combination with any of the drugs selected from the list consisting of: . . .”, (see top third of page 5).
The most closely related disease to the working examples of the specification were cervical cancer with the HeLa cells/spheroids and breast cancer with MCF-7 cells/spheroids.
(4) any/all routes of administration
The specification describes transfecting the cell lines.
The specification describes “Treated mice were administered 3 times per week intratumorally with 20 pg of DNA in 100 pl of 5% sucrose solution and a N/P=6 ratio of jetPEl. In the case of control mice, the same solution was administered without DNA.”, (see top third of page 10).
“Mice with HeLa CSCs tumors were injected intratumorally with plasmid containing hokD or IdrB under the control of the survivin promoter.”, (see third paragraph on page 19).
Working examples:
Figure 1 and 5 demonstrate a construct with only hokD. Figure 2 and 6 demonstrate a construct with on ldrB. In HeLa spheroid cells (i.e., cervical cancer cell line).
Figure 3 demonstrates a construct with only hokD. Figure 4 demonstrates a construct with on ldrB. In MCF-7 spheroid cells (i.e., breast cancer cell line).
Figure 7 shows individually hokD or ldrB under control of the survivin promoter, the gene expression and the inhibition of HeLa proliferation.
Figure 8 shows individually hokD or ldrB under control of the survivin promoter, the gene expression and the inhibition of MCF-7 proliferation.
Figure 9 shows individually hokD or ldrB under control of the survivin promoter, the gene expression and the inhibition of HeLa spheroid proliferation.
Figure 10 shows individually hokD or ldrB under control of the survivin promoter, the gene expression and the inhibition of MCF-7 spheroid proliferation.
Figure 15 shows HeLa tumors that were transfected with individual constructs of hokD or ldrB under control of the TRE3G-Dox promoter. “We observed no significant differences in the growth of HeLa and HeLa-Dox tumors. The proliferation of HeLa hokD and HeLa /drB tumors was significantly inhibited after 35 days with 91.6 % and 95.7 % respectively. This antitumor effect was maintained until the end of the experiment, maintaining an average tumor volume about 80% lower compared to the control group for hokD gene and about 98% for IdrB gene (Figure 15A).”, (see paragraph 4 of page 15).
Figure 16 shows HeLa tumors that were transfected with individual constructs of hokD or ldrB under control of the survivin promoter. “The results obtained in this in vivo experiment demonstrated significant inhibition of tumor proliferation in HeLa CSCs expressing hokD and /drB under the control of the survivin promoter after 54 days of treatment. The proliferation of HeLa hokD and HeLa /drB tumors was significantly inhibited after 32 days with 76.21 % and 79.3 %, respectively. This antitumor effect was maintained until the end of the experiment, maintaining an average tumor volume about 66% lower compared to the control group for the hokD gene and about 67% for the ldrB gene (Figure 16A).”, (see paragraph 4 of page 15).
To summarize the guidance of the specification and working examples, the specification lacks working examples for (1) a construct comprising a survivin promoter and both hokD gene and any/all proliferation inhibitor genes, (2) proliferation diseases other than cancer and/or other than cervical and breast cancer subtypes, (3) prevention of any sort, and (4) administration routes other than intratumorally for the constructs.
Predictability and state of the art:
Regarding the gene construct:
Jie et al (supra) teaches that “In this study, we found that the transactivator Tas in two foamy viruses isolated from Old World Monkey (OWM) induced obvious inhibition of cell proliferation via the upregulation of Foxo3a expression. It was mediated by the generation of ROS and the initiation of ER stress, and ultimately, the mitochondrial apoptosis pathway was triggered.”, (abstract).
Further, Fribley et al (supra) teaches that “Biochemical, physiological, and pathological stimuli that interfere with ER function can disrupt ER homeostasis, impose stress to the ER, and subsequently cause accumulation of unfolded or misfolded proteins in the ER lumen. To deal with accumulation of unfolded or misfolded proteins, the cell has evolved highly specific signaling pathways collectively called the “unfolded protein response” (UPR) to restore normal ER functions. However, if the overload of unfolded or misfolded proteins in the ER is not resolved, the prolonged UPR will induce ER stress-associated programmed cell death, apoptosis, to protect the organism by removing the stressed cells.”, (abstract).
Thoidinjam et al (Oncolytic virus-based suicide gene therapy for cancer treatment: a perspective of the clinical trials conducted at Henry Ford Health, Translational Medicine Communications, vol 8, issue 11, pages 1-21, published April 10th, 2023) teaches, “Other challenges include the limited number of genes that can be used in clinical trials for cancer gene therapy, inefficient vectors, development of treatment resistance leading to recurrence of tumor and shorter survival of patients, lack of success in targeting metastatic cells etc.” (see p. 17, col 1, para 1).
Garg et al (supra) teaches, “Suicide gene vectors are being developed in many laboratories as an attractive approach to cancer therapy. However, the development of these therapies is hampered by safety concerns and limitations of efficacy. The use of tumor-specific promoters, such as survivin promoter, can provide much needed specificity to target tumor cells. However, the expression levels from these promoters is often suboptimal and hence it is imperative to enhance the activity of the cytotoxic gene of interest.”, (abstract and see p. 161, col 2, para 1).
Ardini et al (From Immunotoxins to Suicide Toxin Delivery Approaches: Is There a Clinical Opportunity? Toxins (Basel), vol 14, issue 9, pages 1-21, published August 23rd, 2022) teaches, “Cancer gene therapy may be thus approached using “suicide genes” within two possible alternatives: delivery of a toxin gene that is transduced directly into tumor cells inducing their death, or delivery of genes coding for enzymes modifying prodrugs, which in turn can release toxic metabolites (Gene-Directed Enzyme Prodrug Therapy, GDEPT). Two crucial points need to be considered to result in a successful application of SGT [suicide gene therapy]. First, an ideal delivery system should allow the toxic enzyme or the prodrug activating enzyme to be expressed solely in cancer cells, with the limit of its expression level being sufficient to reach a minimal concentration of the toxin or the active enzyme to exert its toxic/enzymatic activity. Second, the targeted cancer cells that might express different levels of the suicide gene, so that in a complex tumor environment, a “bystander” effect might be desirable. The so-called bystander effect indicates transduction of the enzyme activity needed to induce the prodrug/toxicity in the neighboring cells, by transferring the cell death signals in the untransfected cells.”, (page 1, paras 2 and 3).
Ultimately, any gene can be overexpressed to a high enough level to activate cellular mechanisms that prevent/inhibit cellular proliferation (Fribley). For instance, in Jie et al, the transactivator Tas induced cell proliferation via Foxo3a expression, which was mediated by ROS generation, ER stress, and ultimately apoptosis. However, Thoidinjam et al teaches that there are only a limited number of genes that can be used in clinical trials for cancer gene therapy to begin with. Garg et al teaches expression levels of genes by the survivin promoters relating to suicide gene vectors are suboptimal, and Ardini et al teaches that the expression level must reach a minimal concentration of the toxin or the active enzyme to exert its toxic/enzymatic effects.
Thus, any gene driven by survivin is not full enabled if survivin cannot enhance activity of the gene to a high enough level to be a proliferation inhibitor gene.
Regarding prevention:
Thoidinjam et al teaches, “One of the main challenges impeding clinical translation of cancer gene therapy trials is that patients that are enrolled in trials already have advanced and therapy resistant cancers. Gene therapies may show better results in patients with early-stage cancers or when used as an adjuvant therapy after radiation or chemotherapy with potential for enhanced results. Including a wide range of patients as well as tumor genomic analysis, and evaluation of host immune response may help in improving selection of gene therapy most appropriate for the patients.”, (p. 17, col 1, para 1).
Thus, Thoidinjam et al teaches that gene therapies are typically only sought out once a cancer has developed, not before the cancer has developed, i.e., treatment versus prevention.
Regarding routes of administration:
Ardini et al also teaches preferred routes of administration: “Another key strategy is promoters that can drive exogenous gene expression solely in the malignant tissue, to avoid leaky expression of the transfected suicide gene(s). Local delivery in the stromal environment or intratumoral gene delivery would seem the best options to avoid non-specific toxicities or, for certain tumor masses, after removal by surgery, for minimal residue therapy approaches. Targeted therapies may therefore be able to maximize anti-tumor efficacy while minimizing treatment-related toxicities, as often observed with the heavy side-effects due to chemotherapy first-line therapeutic approaches.”, (see p.4, para 5).
Amount of experimentation necessary:
The quantity needed to carry out the scope of the invention is large. (1) One would need make multiple genetic constructs driven by the survivin promoter to cover the broad genus of proliferation inhibitor gene in combination with the hokD gene and test said constructs in art-accepted models covering the broad genus of proliferation disease. (2) Once a construct is selected, one would need to administer the construct to multiple control models that do not have a proliferation disease, then induce the development of a proliferation disease (covering the broad genus of proliferation disease), to test prevention. (3) Lastly, once a construct and model have been selected that both cover the broad genera of (a) proliferation inhibitor gene and (b) proliferation disease, one must test various routes of administration that cover the broad genus of routes of administration, i.e., oral, nasal, intravenous, intrathecal, intratumorally. This type of experimentation is not routine in the art and would require a large amount of inventive effort. Further considering that any positive results (e.g., successful prevention and/or treatment of all proliferation diseases via any route of administration with any/all combinations of the survivin promoter, hokD gene, and any proliferation inhibitor gene) would amount to a significant advancement in the state of the art, additional experimentation required is considered undue.
In view of the breadth of the claims and the lack of guidance provided by the specification as well as the unpredictability of the art, the skilled artisan would have required an undue amount of experimentation to make and/or use the claimed invention.
Therefore, claims 8-12 are not considered to be fully enabled, but are scoped by the instant disclosure.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claim 5 is rejected under 35 U.S.C. 101 because Section 33(a) of the America Invents Act reads as follows:
Notwithstanding any other provision of law, no patent may issue on a claim directed to or encompassing a human organism.
Claim 5 is rejected under 35 U.S.C. 101 and section 33(a) of the America Invents Act as being directed to or encompassing a human organism. See also Animals - Patentability, 1077 Off. Gaz. Pat. Office 24 (April 21, 1987) (indicating that human organisms are excluded from the scope of patentable subject matter under 35 U.S.C. 101).
Claim 5 does not explicitly recite “human organism”, however the instant specification discloses, “Another aspect of the invention is based on the genetic construct of the invention, the cell of the invention, and/or the composition of the invention for use as a medicament”, (see page 4, last two lines).
Therefore, claim 5 encompasses a human cell that can be modified ex vivo and reintroduced into a human, i.e., “for use as a medicament”, which encompasses cells in vivo in a human (i.e., a human organism), which is excluded from the scope of patentable subject matter.
Limiting claim 5 to “an isolated cell” would obviate the rejection.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claim(s) 1-2 and 5-6 are rejected under 35 U.S.C. 103 as being obvious over Boulaiz-Tassi et al (WO 2020/234498 A2, published November 26th, 2020, filing date of May 15th, 2019; on IDS filed 04/25/2024 as Foreign Patent Document #1, as evidenced by the machine translational accessed September 2, 2026 and provided with this action in the PTO 892) in view of Lin et al (Use of a Novel Integrase-Deficient Lentivirus for Targeted Anti-Cancer Therapy With Survivin Promoter-Driven Diphtheria Toxin A, Medicine (Baltimore), vol 94, issue 31, pages 1-9, published August of 2015).
Regarding claims 1 and 2, Boulaiz-Tassi et al teaches a genetic construct comprising two polynucleotides (paras [0076]), the “first polynucleotide” of the invention is hokD (para [0037]), the “second polynucleotide” of the invention is ldrB (para [0053]), and that these constructs are driven by the PTRE3G promoter (paras [0032] and [0112]).
Regarding claim 5, Boulaiz-Tassi et al teaches cell line generation to have HCT-116, MCF-7, and HeLA express hokD and ldrB genes (see [0092]).
Regarding claim 6, Boulaiz-Tassi et al teaches compositions comprising the genetic construct (para [0069], [0076-0077], and [0079]).
Boulaiz-Tassi et al does not teach a survivin promoter.
Lin et al teaches using Diptheria toxin A with the survivin promoter as an anti-cancer therapy.
Regarding claim 1, Lin et al teaches, “To achieve safer cancer therapy, we replaced the CMV promoter with the Survivin promoter, a specific promoter that is dramatically activated in cancer tissues and cells, but not in normal tissues and cells, and that will impose greater therapeutic potential because a significant expression difference occurred between these 2 groups.”, (abstract).
Therefore, it would have been obvious to one of skill in the art before the effective filing date of the claimed invention to substitute the PTRE3G promoter of Boulaiz-Tassi et al with the survivin promoter of Lin et al to yield the predictable results of a survivin promoter driving expression of a genetic construct containing a hokD polynucleotide and a ldrB polynucleotide. The structure and function of both promoters was well-known in the art before the effective filing date. One of skill would have been motivated to do so because Lin et al teaches that a Survivin promoter is a safe and targeted promoter for cancer therapy. One of skill in the art could have looked to the teachings of Lin et al, i.e., a Dipetheria toxin A driven by the survivin promoter for anti-cancer therapy, and looked to the teachings of Boulaiz-Tassi et al, i.e., two bacterial toxin genes in the same genetic construct being used in combination with cancer cell lines, and arrived at the claimed invention with a high likelihood of success.
Accordingly, claim(s) 1-2 and 5-6 are rejected as being unpatentable over Boulaiz-Tassi et al in view of Lin et al.
Claim 13 is rejected under 35 U.S.C. 103 as being unpatentable over Boulaiz-Tassi et al (supra) in view of Lin et al (supra) as applied to claims 1-2 and 5-6 above, and in view of Martin (Thesis: Development of Suicide Enzyme-based Therapeutics for Cancer Therapy, Washington State University, pages 1-171, published August 2015).
Boulaiz-Tassi et al teaches that the compositions of the invention can be used together with drugs for combination therapies (para [0069]).
Boulaiz-Tassi et al and Lin et al do not explicitly teach cancer antibodies in combination with the genetic construct.
Martin teaches, “Targeted suicide gene therapy represents a novel cancer treatment strategy where systemic administration of a non-toxic drug results in the production of toxic metabolites at sites expressing the suicide enzyme. Since approval for gene therapy in a clinical setting is often hindered by gene delivery methods, suicide enzyme targeting represents a mechanism to bridge the cancer cell killing potential of suicide gene therapy with regulatory approval. Two novel payload delivery molecules include small molecules and affibodies, and these targeting molecules can be adapted to target suicide enzymes to cancer sites.”, (p. 43-44, under conclusions para 1).
“Novel suicide gene therapy modalities will allow for therapeutically relevant levels of toxic metabolites to be produced at tumor sites, and the ablation of cancer cells.”, (p. 44 para 2).
Martin teaches Pertuzumab, Ado-trastuzumab-emtansine, and Lapatinib as potential affibodies to use with suicide gene therapy (p. 35 para 3, p.36, para 1-2, and figure 1.7).
Therefore, it would have been obvious to one of skill in the art before the effective filing date of the claimed invention to combine the teachings of Boulaiz-Tassi et al and Lin et al, i.e., a medical composition comprising a survivin promoter driving hokD and lrdB in a genetic construct with Martin, i.e., the combination of suicide gene therapies and affibodies (e.g., Pertuzumab, Ado-trastuzumab-emtansine, or Lapatinib) to yield the predictable results of medical composition comprising a survivin promoter driving hokD and lrdB in a genetic construct further comprising Pertuzumab, Ado-trastuzumab-emtansine, or Lapatinib. One would be motivated to do so because Boulaiz-Tassi et al teaches combination therapies, and Martin teaches that (a) suicide enzyme targeting represents a mechanism to bridge the cancer cell killing potential of suicide gene therapy with regulatory approval, and (b) will allow for therapeutically relevant levels of toxic metabolites to be produced at tumor sites, and the ablation of cancer cells.
One of skill could have looked to the teachings of Martin and Boulaiz-Tassi et al and Lin et al and arrived at the claimed invention with a high likelihood of success.
Accordingly claim 13 is unpatentable over Boulaiz-Tassi et al in view of Lin et al in further view of Martin.
Claim 14 is rejected under 35 U.S.C. 103 as being unpatentable over Boulaiz-Tassi et al (supra) in view of Lin et al (supra) as applied to claims 1-2 and 5-6 above, and further in view of Dong et al (Advanced Malignant Pleural or Peritoneal Effusion in Patients Treated with Recombinant Adenovirus p53 Injection plus Cisplatin, The Journal of International Medical Research, vol 36, issue 6, pages 1-6, published in 2008).
Boulaiz-Tassi et al teaches that the compositions of the invention can be used together with drugs for combination therapies (para [0069]).
Boulaiz-Tassi et al and Lin et al do not teach explicitly teach cisplatin in combination with the genetic construct.
Dong et al teaches a clinical trial using a suicide gene therapy and cisplatin or cisplatin alone (table 1).
Regarding claim 14, Dong et al teaches, “. . . for those patients with advanced malignant pleural or peritoneal effusion, whose systemic condition is poor, rAd-p53 gene therapy combined with cisplatin can enhance their immune function and is offers the promise of a new and effective therapy.”, (p. 5, col 2, para 3).
Therefore, it would have been obvious to one of skill in the art before the effect filing date of the claimed invention to combine the teachings of Boulaiz-Tassi et al and Lin et al, i.e., a medical composition comprising a survivin promoter driving hokD and lrdB in a genetic construct with Dong et al, i.e., the use of cisplatin with a suicide gene therapy, to yield the predictable results of a medical composition comprising a genetic construct of a survivin promoter driving hokD and lrdB, and further comprising cisplatin. One would be motivated to do so because Dong et al teaches that the combination of the gene therapy with cisplatin can enhance the immune function of patients with advanced malignant pleural or peritoneal effusion. One of skill could have looked to the teachings of Dong et al and Boulaiz-Tassi et al in view of Lin et al and arrived at the claimed invention with a high likelihood of success.
Accordingly, claim 14 is unpatentable over Boulaiz-Tassi et al in view of Lin et al in further view of Dong et al.
Claim(s) 1-2 and 5-6 are rejected under 35 U.S.C. 103 as being obvious over 872 (US 2022/0211872 A1, published July 7th, 2022, filing date of May 15th, 2019; on IDS filed 04/25/2024 as Foreign Patent Document #1, as evidenced by the machine translational accessed September 2, 2026 and provided with this action in the PTO 892) in view of Lin et al (supra).
Regarding claims 1 and 2, 872 teaches a genetic construct comprising two polynucleotides (paras [0065]), the “first polynucleotide” of the invention is hokD (para [0035]), the “second polynucleotide” of the invention is ldrB (para [0047]), and that these constructs are driven by the PTRE3G promoter (paras [0031] and [0097]).
Regarding claim 5, Boulaiz-Tassi et al teaches cell line generation to have HCT-116, MCF-7, and HeLA express hokD and ldrB genes (see [0093]).
Regarding claim 6, Boulaiz-Tassi et al teaches compositions comprising the genetic construct (para [0071]).
872 does not teach a survivin promoter.
Lin et al teaches using Diptheria toxin A with the survivin promoter as an anti-cancer therapy.
Regarding claim 1, Lin et al teaches, “To achieve safer cancer therapy, we replaced the CMV promoter with the Survivin promoter, a specific promoter that is dramatically activated in cancer tissues and cells, but not in normal tissues and cells, and that will impose greater therapeutic potential because a significant expression difference occurred between these 2 groups.”, (abstract).
Therefore, it would have been obvious to one of skill in the art before the effective filing date of the claimed invention to substitute the PTRE3G promoter of 872 with the survivin promoter of Lin et al to yield the predictable results of a survivin promoter driving expression of a genetic construct containing a hokD polynucleotide and a ldrB polynucleotide. The structure and function of both promoters was well-known in the art before the effective filing date. One of skill would have been motivated to do so because Lin et al teaches that a Survivin promoter is a safe and targeted promoter for cancer therapy. One of skill in the art could have looked to the teachings of Lin et al, i.e., a Dipetheria toxin A driven by the survivin promoter for anti-cancer therapy, and looked to the teachings of 872, i.e., two bacterial toxin genes in the same genetic construct being used in combination with cancer cell lines, and arrived at the claimed invention with a high likelihood of success.
Accordingly, claim(s) 1-2 and 5-6 are rejected as being unpatentable over 872 in view of Lin et al.
Claim 13 is rejected under 35 U.S.C. 103 as being unpatentable over 872 (supra) in view of Lin et al (supra) as applied to claims 1-2 and 5-6 above, and in view of Martin (supra).
872 teaches that the compositions of the invention can be used together with drugs for combination therapies (para [0058]).
872 and Lin et al do not explicitly teach cancer antibodies in combination with the genetic construct.
Martin teaches, “Targeted suicide gene therapy represents a novel cancer treatment strategy where systemic administration of a non-toxic drug results in the production of toxic metabolites at sites expressing the suicide enzyme. Since approval for gene therapy in a clinical setting is often hindered by gene delivery methods, suicide enzyme targeting represents a mechanism to bridge the cancer cell killing potential of suicide gene therapy with regulatory approval. Two novel payload delivery molecules include small molecules and affibodies, and these targeting molecules can be adapted to target suicide enzymes to cancer sites.”, (p. 43-44, under conclusions para 1).
“Novel suicide gene therapy modalities will allow for therapeutically relevant levels of toxic metabolites to be produced at tumor sites, and the ablation of cancer cells.”, (p. 44 para 2).
Martin teaches Pertuzumab, Ado-trastuzumab-emtansine, and Lapatinib as potential affibodies to use with suicide gene therapy (p. 35 para 3, p.36, para 1-2, and figure 1.7).
Therefore, it would have been obvious to one of skill in the art before the effective filing date of the claimed invention to combine the teachings of 872 and Lin et al, i.e., a medical composition comprising a survivin promoter driving hokD and lrdB in a genetic construct with Martin, i.e., the combination of suicide gene therapies and affibodies (e.g., Pertuzumab, Ado-trastuzumab-emtansine, or Lapatinib) to yield the predictable results of medical composition comprising a survivin promoter driving hokD and lrdB in a genetic construct further comprising Pertuzumab, Ado-trastuzumab-emtansine, or Lapatinib. One would be motivated to do so because 872 teaches combination therapies, and Martin teaches that (a) suicide enzyme targeting represents a mechanism to bridge the cancer cell killing potential of suicide gene therapy with regulatory approval, and (b) will allow for therapeutically relevant levels of toxic metabolites to be produced at tumor sites, and the ablation of cancer cells. One of skill could have looked to the teachings of Martin and 872 and Lin et al and arrived at the claimed invention with a high likelihood of success.
Accordingly claim 13 is unpatentable over 872 in view of Lin et al in further view of Martin.
Claim 14 is rejected under 35 U.S.C. 103 as being unpatentable over 872 (supra) in view of Lin et al (supra) as applied to claims 1-2 and 5-6 above, and further in view of Dong et al (supra).
872 teaches that the compositions of the invention can be used together with drugs for combination therapies (para [0058]).
872 and Lin et al do not teach explicitly teach cisplatin in combination with the genetic construct.
Dong et al teaches a clinical trial using a suicide gene therapy and cisplatin or cisplatin alone (table 1).
Regarding claim 14, Dong et al teaches, “. . . for those patients with advanced malignant pleural or peritoneal effusion, whose systemic condition is poor, rAd-p53 gene therapy combined with cisplatin can enhance their immune function and is offers the promise of a new and effective therapy.”, (p. 5, col 2, para 3).
Therefore, it would have been obvious to one of skill in the art before the effect filing date of the claimed invention to combine the teachings of 872 and Lin et al, i.e., a medical composition comprising a survivin promoter driving hokD and lrdB in a genetic construct with Dong et al, i.e., the use of cisplatin with a suicide gene therapy, to yield the predictable results of a medical composition comprising a genetic construct of a survivin promoter driving hokD and lrdB, and further comprising cisplatin. One would be motivated to do so because Dong et al teaches that the combination of the gene therapy with cisplatin can enhance the immune function of patients with advanced malignant pleural or peritoneal effusion. One of skill could have looked to the teachings of Dong et al and 872 in view of Lin et al and arrived at the claimed invention with a high likelihood of success.
Accordingly, claim 14 is unpatentable over 872 in view of Lin et al in further view of Dong et al.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claim(s) 1-2, 5, 6, and 8-12 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 19 of copending Application No. 17/611, 460 in view of Lin et al (supra).
Claim 19 of 460 recites, “A method for treating breast cancer, colon cancer, or cervical cancer, the method comprising intratumoral administration to a subject in need thereof of an effective amount of a composition comprising DNA comprising the nucleotide sequence of SEQ ID NO: 1 and/or SEQ ID NO: 2, or an RNA encoded from the nucleotide sequence of SEQ ID NO: 1 and/or SEQ ID NO: 2, wherein the DNA is operably linked to a promoter that directs transcription in a mammalian cell.”
PNG
media_image1.png
328
676
media_image1.png
Greyscale
SEQ ID NO: 1 of 460 is a hokD gene (instant specification has SEQ ID NO: 1 as a hokD gene at the bottom of page 3), and SEQ ID NO:2 of 460 is ldRB (instant specification has SEQ ID NO: 2 as a ldrB gene at the top of page 4) see alignments below.
PNG
media_image2.png
260
636
media_image2.png
Greyscale
Claim 19 does not require that the promoter is a survivin promoter.
Lin et al teaches using Diptheria toxin A with the survivin promoter as an anti-cancer therapy.
Lin et al teaches, “To achieve safer cancer therapy, we replaced the CMV promoter with the Survivin promoter, a specific promoter that is dramatically activated in cancer tissues and cells, but not in normal tissues and cells, and that will impose greater therapeutic potential because a significant expression difference occurred between these 2 groups.”, (abstract).
Therefore, it would have been obvious to one of skill in the art before the effective filing date of the claimed invention to substitute the general promoter of claim 19 of 460 with the survivin promoter of Lin et al to yield the predictable results of a survivin promoter driving expression of a genetic construct containing a hokD polynucleotide and a ldrB polynucleotide. The survivn promoter was well-known in the art before the effective filing date. One of skill would have been motivated to do so because Lin et al teaches that a Survivin promoter is a safe and targeted promoter for cancer therapy. One of skill in the art could have looked to the teachings of Lin et al, i.e., a Dipetheria toxin A driven by the survivin promoter for anti-cancer therapy, and looked to the requirements of claim 19 of 460, i.e., a promoter that directions transcription in a mammalian cell of one and/or two bacterial toxin genes in the same genetic construct being used in combination with cancer cell lines, and arrived at the claimed invention with a high likelihood of success.
This is a provisional nonstatutory double patenting rejection.
Accordingly, claim(s) 1-2, 5, 6, and 8-12 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over copending Application No. 17/611, 460 in view of Lin et al (supra).
Conclusion
No claims allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to LEXUS M TATGE whose telephone number is (571)272-0061. The examiner can normally be reached Monday-Friday: 8:30am to 5:30pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/L.M.T./ Examiner, Art Unit 1637
/Jennifer Dunston/ Supervisory Patent Examiner, Art Unit 1637