DETAILED ACTION
Disposition of Claims
Claims 1-19 and 23 are pending.
Examiner’s Note
All paragraph numbers (¶) throughout this office action, unless otherwise noted, are from the US PGPub of this application US20250034664A1, Published 01/30/2025.
Applicant is encouraged to utilize the new web-based Automated Interview Request (AIR) tool for submitting interview requests; more information can be found at https://www.uspto.gov/patent/laws-and-regulations/interview-practice.
Of note, there is not an attorney of record on file due to a lack of an official power of attorney of record. While a customer number has been provided on the ADS submitted 04/26/2024, this is not the equivalent of a power of attorney or an authorization to act in a representative capacity. In order to expedite prosecution in the instant application, it is suggested that a power of attorney be filed as per MPEP §402 or MPEP §1807, or an Authorization to Act in a Representative Capacity be filed as per MPEP §403 in order for the Office to freely and openly discuss the merits of the case with the applicant's representative(s). Please refer to https://www.uspto.gov/about-us/contact-us if you have questions regarding the proper filing of a power of attorney.
Optional Authorization to Initiate Electronic Communications
The Applicant’s representative may wish to consider supplying a written authorization in response to this Office action to correspond with the Examiner via electronic mail (e-mail). This authorization is optional on the part of the Applicant’s representative, but it should be noted that the Examiner may not initiate nor respond to communications via electronic mail unless and until Applicant’s representative authorizes such communications in writing within the official record of the patent application. A sample authorization is available at MPEP § 502.03, part II. If Applicant’s representative chooses to provide this authorization, please ensure to include a valid e-mail address along with said authorization.
Nucleotide and/or Amino Acid Sequence Disclosures
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiency – Nucleotide and/or amino acid sequences appearing in the drawings are not identified by sequence identifiers in accordance with 37 CFR 1.821(d). Sequence identifiers for nucleotide and/or amino acid sequences must appear either in the drawings or in the Brief Description of the Drawings. See e.g. Figs. 1, 3, 5G, and 6.
Required response – Applicant must provide:
Replacement and annotated drawings in accordance with 37 CFR 1.121(d) inserting the required sequence identifiers;
AND/OR
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers into the Brief Description of the Drawings, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter.
Drawings
The drawings are not of sufficient quality to permit examination. Accordingly, replacement drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to this Office action. The replacement sheet(s) should be labeled “Replacement Sheet” in the page header (as per 37 CFR 1.84(c)) so as not to obstruct any portion of the drawing figures. If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action.
Applicant is given a shortened statutory period of TWO (2) MONTHS to submit new drawings in compliance with 37 CFR 1.81. Extensions of time may be obtained under the provisions of 37 CFR 1.136(a) but in no case can any extension carry the date for reply to this letter beyond the maximum period of SIX MONTHS set by statute (35 U.S.C. 133). Failure to timely submit replacement drawing sheets will result in ABANDONMENT of the application.
The drawings are objected to because certain figures (See e.g. Fig. 3) are not of sufficient quality to permit examination. For instance, in Figure 3, you can see that these are supposed to be secondary structures formed by viral RNA sequences, and some of the nucleotides are clear, but not all are clear, especially in Figs. 3B-3D, Fig. 5G, and Fig. 6. Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Specification
Applicant is reminded of the proper language and format for an abstract of the disclosure.
The abstract should be in narrative form and generally limited to a single paragraph on a separate sheet within the range of 50 to 150 words in length. The abstract should describe the disclosure sufficiently to assist readers in deciding whether there is a need for consulting the full patent text for details.
The language should be clear and concise and should not repeat information given in the title. It should avoid using phrases which can be implied, such as, “The disclosure concerns,” “The disclosure defined by this invention,” “The disclosure describes,” etc. In addition, the form and legal phraseology often used in patent claims, such as “means” and “said,” should be avoided.
The abstract of the disclosure is objected to because of the use of legal phraseology (see “e.g.” which stands for “exempli gratia”. It is suggested that “e.g.” be replaced with “for example”.) A corrected abstract of the disclosure is required and must be presented on a separate sheet, apart from any other text. See MPEP § 608.01(b).
Claim Rejections - 35 USC § 112(b); Second Paragraph
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 1 and dependent claims 2-19 and 23 thereof are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
The meaning of every term used in a claim should be apparent from the prior art or from the specification and drawings at the time the application is filed. Claim language may not be “ambiguous, vague, incoherent, opaque, or otherwise unclear in describing and defining the claimed invention.” In re Packard, 751 F.3d 1307, 1311, 110 USPQ2d 1785, 1787 (Fed. Cir. 2014). See MPEP §2173.05( a). Alternative and functional language is not indefinite merely because that form of language is used; however, such language must make the boundaries of the same subject matter clear. In the instant claims, which depend directly or indirectly upon claim 1, the claimed invention is first drawn to a “composition comprising an extracellular portion, or a molecule that specifically binds the extracellular portion, of a viral nucleic acid present on a plasma membrane of a host cell infected with a virus.” It is unclear whether the phrase “of a viral nucleic acid present on a plasma membrane” modifies only “the extracellular portion” or also modifies “a molecule.” Under the latter reading, the molecule itself could be understood as being “of a viral nucleic acid,” although the specification appears to contemplate a separate binding molecule, such as an antibody, an aptamer, an oligonucleotide, or a peptide. Applicant appears to intend two alternatives: a composition comprising an extracellular portion of a viral nucleic acid, or a composition comprising a molecule that specifically binds an extracellular portion of a viral nucleic acid. The claim does not set out those alternatives in a grammatically correct separate form. It is also unclear whether “present on a plasma membrane” modifies the entire viral nucleic acid or only the extracellular portion. Those interpretations are materially different because a viral nucleic acid may be associated with a membrane without having a portion exposed on the extracellular side of that membrane.
The rejection is not merely based on the presence of alternative language. The problem is that the grammar does not clearly identify the elements of each alternative or the relationship among the viral nucleic acid, the extracellular portion, the plasma membrane, and the binding molecule.
Since a skilled artisan would not be reasonably apprised as to the metes and bounds of the claimed invention, instant Claim 1 is rejected on the grounds of being indefinite. Claims 2-19 and 23 are also rejected since they depend from claim 1, but do not remedy these deficiencies of claim 1.
Claim 1 and dependent claims 2-19 and 23 thereof are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
The term “specifically binds” in claim 1 is a relative term which renders the claim indefinite. The term “specifically binds” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. While a definition is provided at ¶[0034], neither this definition nor the claims identify a required binding affinity, dissociation constant, selectivity ratio, competition result, or permissible level of binding cross-reactivity. They also do not identify the comparison against which specificity is determined. It is unclear whether a molecule must distinguish the viral nucleic acid from all host nucleic acids, from unrelated viral sequences, from other TAR variants, or merely from one selected control
The uncertainty is significant here because the specification contemplates materially different modes of interaction. An antibody may recognize a nucleic acid structure, an aptamer or oligonucleotide may hybridize to a sequence, a peptide may bind a folded RNA structure, and a molecule may recognize a glycan attached to the viral nucleic acid (¶[0072][0076-0088]). The specification does not state whether binding to a shared double-stranded RNA structure or glycan common to host and viral nucleic acids constitutes specific binding to the claimed “extracellular portion”.
The specification describes known procedures for preparing and screening antibodies, aptamers, oligonucleotides, and peptides, but a screening procedure it not itself a boundary for the claim. No assay, threshold, or standard is identified for deciding whether a tested molecule falls within or outside the claimed genus. It is therefore unclear whether weak binding, partial sequence complementarity, binding under only selected assay conditions, or substantial cross-reactivity would satisfy the limitation.
Since a skilled artisan would not be reasonably apprised as to the metes and bounds of the claimed invention, instant Claim 1 is rejected on the grounds of being indefinite. Claims 2-19 and 23 are also rejected since they depend from claim 1, but do not remedy these deficiencies of claim 1.
Claim 1 and dependent claims 2-19 and 23 thereof are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
The term “extracellular portion” in claim 1 is a relative term which renders the claim indefinite. The term “extracellular portion” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. In light of the differences in interpretations of claim 1 noted supra in the 35 USC 112b rejection, it is unclear what is intended as an “extracellular portion”, as it could be a nucleotide sequence segment that physically projects from the outer face of the plasma membrane; a portion of a nucleic acid that is accessible to a reagent applied outside an intact cell; or a nucleic acid, or portion thereof, that is merely associated with material recovered in a plasma-membrane fraction. These are very different structural and topological conditions. A nucleic acid may be enclosed within a budding virion, present on the cytoplasmic side of a membrane, contained within a membrane-associated complex, or recovered with an isolated membrane fraction without being exposed to the extracellular environment.
The specification does not provide an express definition or an objective test that resolves the scope of “extracellular portion”. The specification refers to viral nucleic acid as being “on the membrane”, “present on the plasma membrane”, “on the cell surface”, and present in an isolated plasma membrane fraction (¶[0053][0157-0161][0168-0191]). The specification does not clearly state that these expressions have the same meaning or explain which experimental result is sufficient to establish the claimed extracellular orientation.
Since a skilled artisan would not be reasonably apprised as to the metes and bounds of the claimed invention, instant Claim 1 is rejected on the grounds of being indefinite. Claims 2-19 and 23 are also rejected since they depend from claim 1, but do not remedy these deficiencies of claim 1.
Claim 9 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 9 recites the sequence may be a “variant sequence thereof” without providing an ascertainable boundary as to what is, and what is not, a “variant sequence”. The specification provides several definitions of a “variant”. At ¶[0064], it states that the variant may comprise at least about 60% to at least about 99.5% sequence identity to the sequences of SEQ ID NOs: 1-22. At ¶[0066], the variant sequence differs from the sequence as set forth in any one of SEQ ID NOs: 1-22 by 50, 45, 40, 35, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1 nucleotide residue(s). At ¶[0067], variants are more generally referred to as substitutions, insertions, deletions, additions, fusions, or glycosylations, while ¶[0068] states that one or more residues may be glycosylated.
These descriptions as to what is, and what is not, a “variant” are not coextensive. For example, a sequence may meet a stated percentage-identity threshold without meeting a stated residue-difference limitation. Conversely, a sequence may comprise one described modification without satisfying a particular percentage identity. Claim 9 does not state whether satisfying any one of the disclosed alternatives is sufficient, whether more than one condition must be met, or which standard controls when the disclosed descriptions produce different results.
Claim 9 also does not state whether the variant must retain a defined property of the reference sequence. It is unclear whether the variant must retain TAR secondary structure, viral function, glycosylation, extracellular presentation, or recognition by the same binding molecule. The incorporated limitations of claim 1 do not resolve which sequence changes remain within the term “variant’ or where the outer boundary of that term lies.
For at least these reasons, claim 9 is rejected on the grounds of being indefinite.
Claim 13 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
The term “macrovesicle” in claim 13 is a relative term which renders the claim indefinite. The term “macrovesicle” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. The specification repeatedly lists an “exosome, liposome, macrovesicle, or nanoparticle”, but does not explain what distinguishes a “macrovesicle” from the other listed structures (¶[0009][0102][0105-0106][0116][0205]). The specification separately refers to an extracellular vesicle in ¶[0103] and to colloidal dispersions, nanocapsules, nanoparticles, microspheres, beads, micelles, and liposomes in ¶[0104]). It does not state whether a macrovesicle is a type of extracellular vesicle, a synthetic lipid vesicle, a vesicle defined by a particular diameter, or a different structure.
It is also unclear whether “macrovesicle” was intended to refer to a “microvesicle”. The specification provides no size range, method of formation, biological source, membrane composition, or other criterion that would permit one skilled in the art to distinguish a claimed macrovesicle from an exosome, liposome, extracellular vesicle, or nanoparticle.
Additionally, claim 13 is further indefinite because it recites that the “composition is an exosome, liposome, macrovesicle, or nanoparticle” without clearly stating the relationship between the structure and which component of claim 1 forms said composition. Claim 1 permits the composition to comprise either the extracellular portion of the viral nucleic acid or a molecule that specifically binds to that portion. Claim 13 does not state whether the nucleic acid or binding molecule is encapsulated within the recited structure, embedded into its membrane, attached to its exterior surface, coating the structure, or merely present in a formulation containing the structure, as each arrangement defines a different composition. The statement that the composition “is” the recited structure does not resolve whether the claim requires surface presentation, encapsulation, membrane incorporation, or simple inclusion. The specification appears to contemplate a narrower arrangement in which the exosome, liposome, macrovesicle, or nanoparticle “is coated with” the binding molecule (¶[0102][0116]). Claim 13 does not include the coating limitation and does not expressly select the binding molecule of claim 1. It therefore also encompasses the alternative in which the composition comprises the extracellular viral nucleic acid portion itself without explaining how that portion relates to the recited vesicle or nanoparticle.
Since a skilled artisan would not be reasonably apprised as to the metes and bounds of the claimed invention, instant Claim 13 is rejected on the grounds of being indefinite.
Claim Interpretation
The claims in this application are given their broadest reasonable interpretation using the plain meaning of the claim language in light of the specification as it would be understood by one of ordinary skill in the art.
Claim 1 is drawn to a composition comprising an extracellular portion, or a molecule that specifically binds the extracellular portion, of a viral nucleic acid present on a plasma membrane of a host cell infected with a virus.
Further limitations on the composition of claim 1 are wherein the viral nucleic acid is expressed in a latent life cycle of the virus (claim 2); wherein the viral nucleic acid comprises a noncoding RNA (claim 3); wherein the viral nucleic acid is glycosylated (claim 4); wherein the virus is a retrovirus (claim 5); wherein the virus is a human immunodeficiency virus (HIV)(claim 6); wherein the virus is a HIV-1 (claim 7); wherein the viral nucleic acid comprises a trans-activation response element (TAR)(claim 8); wherein the viral nucleic acid comprises the nucleotide sequence as set forth in any one of SEQ ID NOs: 1-22; or a variant sequence thereof (claim 9); further comprising a pharmaceutically acceptable carrier and/or adjuvant (claim 10); wherein the molecule comprises an antibody or aptamer (claim 11); wherein the molecule comprises a diagnostic or therapeutic moiety (claim 12); wherein the composition is an exosome, liposome, macrovesicle, or nanoparticle (claim 13); and wherein the composition further comprises one or more elements of a gene editing system (claim 14).
Claim 15 is drawn to a method for treating or preventing infection by a virus, the method comprising
administering a therapeutically or prophylactically effective amount of the composition of claim 1 to a subject, thereby treating or preventing the infection by the virus in the subject.
Further limitations on the method of claim 15 are wherein the composition is administered to the subject during a latent life cycle of the virus (claim 16); wherein the subject has tested positive for HIV infection but has no symptoms associated with HIV (claim 17); and wherein the subject has acquired immunodeficiency syndrome (AIDS)(claim 18).
Claim 19 is drawn to a method for identifying a subject infected with a virus, the method comprising:
detecting the presence of an extracellular portion of a viral nucleic acid present on a plasma membrane of a host cell infected with a virus using the composition of claim 1, thereby identifying the subject infected with the virus.
Claim 23 is drawn to a method for separating or killing virally infected cells ex vivo, the method comprising:
contacting cells obtained from a subject with the composition of claim 1, wherein the virally infected cells bind to the molecule.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1-10, 13, 14, and 19 are rejected under 35 U.S.C. 101 because the claimed invention is directed to naturally HIV-infected cells and systems without significantly more. Claims 1-10 are directed to compositions of matter, and claim 19 is directed to a process. Accordingly, the claims fall within a statutory category of invention under Step 1 of the subject-matter-eligibility analysis.
This judicial exception is not integrated into a practical application, and the claims do not include additional elements that are sufficient to amount to significantly more than the judicial exception because of the reasons set forth in the claim analysis herein:
Claims 1-9
Under Step 2A, Prong One, claim 1 recites a product of nature. Claim 1 encompasses a composition comprising an extracellular portion of a viral nucleic acid that is present on the plasma membrane of a virus-infected host cell. The claim does not require that this viral nucleic acid be altered, engineered, conjugated, chemically modified, or otherwise changed from the viral nucleic acid that occurs naturally in the infected cell. The specification confirms that the extracellular viral nucleic acid may be obtained by isolating the naturally occurring viral nucleic acid or its extracellular portion (¶[0121]). The specification also reports that HIV-1 TAR RNA is naturally present in the plasma membrane of infected cells and that a substantial proportion of that TAR RNA is naturally glycosylated (¶[0182-0184]). The closest naturally occurring counterpart is therefore the same extracellular portion of the viral nucleic acid as it exists on the plasma membrane of the infected host cell.
The claimed viral nucleic acid has the same nucleotide structure, glycosylation state, cellular location, and biological properties as its naturally occurring counterpart. The claim does not recite any characteristic caused by human intervention that is markedly different from the structure, function, or other properties of the viral nucleic acid in its natural state. Merely isolating or placing the naturally occurring nucleic acid in a composition does not provide a markedly different characteristic. See Association for Molecular Pathology v. Myriad Genetics, Inc., 569 U.S. 576, 590-595 (2013); University of Utah Research Foundation v. Ambry Genetics Corp., 774 F.3d 755, 760-761 (Fed. Cir. 2014); and MPEP § 2106.04(c).
Claim 1 alternatively encompasses a molecule that specifically binds the extracellular portion. That alternative does not cure the claim eligibility issues because the broadest reasonable interpretation of claim 1 still encompasses the naturally occurring viral nucleic acid composition. A claim that encompasses both eligible and ineligible nature-based products recites a product-of-nature exception and must be further evaluated under Step 2A, Prong Two, and Step 2B. MPEP § 2106.04(b)-(c).
Mele et. al. (Mele AR, et. al. Traffic. 2018 Apr 30:10.1111/tra.12578. Epub ahead of print.) teaches that HIV-1 Tat is a naturally produced viral protein that binds the HIV-1 TAR RNA element as parts of its ordinary role in viral transcription. Mele further teaches that Tat naturally accumulates at the plasma membrane through binding to phosphatidylinositol-4,5-bisphosphate and is then secreted through the plasma membrane. Mele also discusses TAR-containing exosomes as a potential mechanism for tethering and transporting Tat. Mele therefore confirms that Tat-TAR binding at Tat plasma membrane trafficking are naturally-occurring HIV-1 biological properties. The claim contains no limitation requiring that a recited binding molecule possess a structure or binding function markedly different from naturally occurring Tat. Moreover, the first alternative of claim 1 independently encompasses the naturally occurring viral nucleic acid itself.
Claims 2-9 do not remove the product-of-nature exception. Claim 2 limits the viral nucleic acid by its natural expression during viral latency. Claim 3 identifies the nucleic acid as a naturally occurring noncoding RNA, and claim 4 identifies naturally occurring glycosylation. Claims 5-7 identify the natural viral source. Claim 8 identifies TAR, while claim 9 encompasses the naturally occurring sequences of SEQ ID NOS: 1-22 and variants thereof. These limitations identify the source, sequence, expression state, or natural properties of the viral nucleic acid, but do not require any markedly different characteristic produced through human intervention. Although claim 9 may encompass engineered variants, its broadest reasonable interpretation also encompasses the recited naturally occurring sequences and naturally occurring viral variants.
Under Step 2A, Prong Two, claims 1-9 do not recite an additional element that integrates the product of nature into a practical application. The recitation that the viral nucleic acid is present on the plasma membrane merely identifies the natural environment and location of the claimed product. The generic recitation of a “composition” does not impose a meaningful limit on the product of nature or apply the viral nucleic acid in a particular treatment, diagnostic procedure, manufacture, or other technological process.
Under Step 2B, claims 1-9 do not recite significantly more than the product of nature. The claims contain no additional element beyond the naturally occurring viral nucleic acid and limitations describing its natural source, location, sequence, or properties. Considered individually and as a combination, the limitations amount to a claim to the naturally occurring extracellular viral nucleic acid itself.
Claim 10
Claim 10 additionally recites a pharmaceutically acceptable carrier and/or adjuvant. This limitation does not remove the product-of-nature exception because “and/or” permits the composition to contain a carrier without an adjuvant, allowing claim 10 to encompass the naturally occurring viral nucleic acid merely dispersed in a standard carrier such as sterile water, saline, or a buffered solution. The specification states that pharmaceutical carriers are known to those skilled in the art and identifies sterile water, saline, physiological buffers, conventional aqueous solutions, suspensions, emulsions, and other standard formulation components (¶[0073-0075]). The claim does not require a particular carrier, an immunologically effective amount of an adjuvant, an altered delivery property, enhanced immunogenicity, or any structural or functional change in the viral nucleic acid resulting from the formulation.Under Step 2A, Prong Two, the generic carrier or optional adjuvant merely provides an environment for the product of nature and does not meaningfully apply the natural viral nucleic acid in a particular manner. Under Step 2B, the standard carrier and optional adjuvant are well-understood, routine, and conventional formulation components, as expressly acknowledged by the specification. The natural viral nucleic acid retains its natural structure and function when merely placed in such a carrier. The limitations, separately and in combination, do not amount to significantly more than the product of nature.
Claim 13
Claim 13 additionally recites that the composition is an exosome, liposome, macrovesicle, or nanoparticle. This limitation does not remove the product-of-nature exception because the claim expressly encompasses an exosome and does not require that the exosome be engineered, synthetically produced, coated with a non-natural molecule, or otherwise altered from a naturally occurring exosome. HIV-1-infected cells naturally release exosomes containing HIV-1 TAR RNA, and the prior art of Mele also describes the natural association of Tat with TAR with exosomal trafficking. The claim does not require the claimed exosome or its viral components to possess a structural, functional, or other characteristic markedly different from that naturally occurring counterpart. Under Step 2A, Prong Two, merely placing the product-of-nature subject matter in the form of a naturally-occurring exosome does not integrate the exception into a practical application. Under Step 2B, claim 13 recites no additional element that amounts to significantly more than the naturally-occurring composition.
Claim 14
Claim 14 additionally recites one or more elements of a “gene editing system”. This limitation does not require a complete or operative editing system, delivery of the element to a target cell, editing of viral or host nucleic acid, or any structural or functional change in the claimed natural viral nucleic acid or binding molecule. The specification identifies known CRISPR-Cas, ZFN, TALEN, and homing-meganuclease systems, but claim 14 merely requires one or more unspecified elements. Under broadest reasonable interpretation, retroviral elements which insert genetic information into a host cell, such as through the use of reverse transcriptase and viral integrase, may be interpreted as “gene editing” elements. Therefore, the additional element may either be a natural part of the HIV-1 virus or because no gene editing application is affirmatively required by the claim. The generic addition of one or more known gene editing components also does not amount to significantly more than the exception, whether considered separately or in combination with the remaining limitations.
Claim 19
Under Step 2A, Prong One, claim 19 recites a natural phenomenon and a naturally occurring correlation. Claim 19 detects the presence of an extracellular portion of a viral nucleic acid on the plasma membrane of an infected host cell and, from that detected presence, identifies the subject as being infected with the virus. The relationship between the presence of the viral nucleic acid on the infected cell membrane and the subject’s viral infection exists as a result of natural viral and cellular processes. The relationship exists independently of the act of observing it. Mele further confirms that Tat binding to TAR and Tat trafficking through the infected cell plasma membrane are naturally occurring features of HIV biology rather than conditions created by the claimed detection method.
The claimed detection and identification therefore recite the natural correlation between the presence of the cell-surface viral nucleic acid and viral infection. See Mayo Collaborative Services v. Prometheus Laboratories, Inc., 566 U.S. 66, 77-79 (2012); Ariosa Diagnostics, Inc. v. Sequenom, Inc., 788 F.3d 1371, 1376-1378 (Fed. Cir. 2015); and Cleveland Clinic Foundation v. True Health Diagnostics LLC, 859 F.3d 1352, 1360-1362 (Fed. Cir. 2017). The MPEP similarly identifies naturally occurring relationships between a biological marker and a disease state as judicial exceptions. MPEP § 2106.04(b).
Under Step 2A, Prong Two, claim 19 additionally recites detecting the viral nucleic acid using the composition of claim 1 and identifying the subject as infected; however, these limitations do not integrate the natural correlation into a practical application. The claim does not require a particular assay format, structurally defined detection reagent, measurement procedure, treatment step, or other action taken in response to the identification. The detecting step merely observes the natural phenomenon, and the identifying step merely states the conclusion drawn from that observation.
Under Step 2B, the additional detection activity does not provide an inventive concept. The specification states that the molecular-biology, immunology, nucleic-acid analysis, and laboratory methods used in the application are generally conventional and well known in the art (¶[0025]). The disclosed detection examples use ordinary antibody staining and flow cytometry, including the commercially available J2 anti-dsRNA antibody, a labeled secondary antibody, and a standard flow cytometer (¶[0173-0184]). The specification also states that the J2 antibody is often used to identify cells infected with RNA viruses (¶[0184]). The specification’s express description of these activities as conventional and commonly used provides factual support for finding the generically recited detecting activity well-understood, routine, and conventional. See MPEP §2106.05(d) and §2106.07(a). Considered individually and as a combination, detecting the natural marker and identifying the infection do no more than instruct the practitioner to observe and report the natural relationship, meaning that claim 19 does not recite significantly more than the judicial exception.
For at least these reasons, claims 1-10, 13-14, and 19 are directed to judicial exceptions without integrating the exceptions into practical applications or reciting additional elements that amount to significantly more, and the claims are therefore ineligible under 35 U.S.C. §101.
Claim Rejections - 35 USC § 112(a); First Paragraph
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-19 and 23 are rejected under 35 U.S.C. 112(a) because the specification, while being enabling for detecting HIV-1 TAR RNA and selected HIV-1 transcripts in isolated plasma-membrane fractions from the particular infected or transfected cell systems described in the examples, does not reasonably provide enablement for the full scope of the claimed compositions and methods. In particular, the specification does not enable an extracellular portion of a viral nucleic acid present on an infected-cell plasma membrane, or a molecule that specifically binds that extracellular portion, across the broad classes of viruses, viral nucleic acids, host cells, binding molecules, compositions, and uses encompassed by the claims. The specification does not enable one skilled in the art to make and use the invention commensurate in scope with the claims.
The legal considerations that govern enablement determinations pertaining to undue experimentation were set forth in In re Wands, 858 F.2d 731, 737, 8 USPQ2d 1400, 1404 (Fed. Cir. 1988). The factors to be considered include the breadth of the claims, the nature of the invention, the state of the prior art, the level of skill in the art, the predictability of the art, the amount of direction provided in the specification, the existence of working examples, and the quantity of experimentation needed to make or use the claimed invention. The factors are considered together in determining whether the required experimentation would have been undue. See MPEP § 2164.01(a).
Nature of the invention and breadth of the claims. The claimed invention is directed to a composition comprising an extracellular portion of a viral nucleic acid present on the plasma membrane of a host cell infected with a virus, or a molecule that specifically binds that extracellular portion. Claim 1 is not limited to a particular viral family, genome type, sequence, host cell, infection state, mechanism of membrane association, or binding molecule. Claims 2-14 add selected viral, sequence, formulation, binding, delivery, and gene-editing limitations. Claims 15-19 and 23 apply the composition to treatment, prevention, diagnosis, binding, separation, or killing of infected cells. The recitation of “preventing infection by a virus" is interpreted to encompass the complete blockade of any individual cell within the subject from any viral infection.
The specification defines a viral nucleic acid broadly as a viral genome or portion thereof, including a segment of a segmented genome, and expressly includes RNA and DNA forms and complementary molecules (¶[0036]). Claim 1 therefore encompasses nucleic acids from viruses having materially different genome structures and life cycles. It reaches, for example, RNA and DNA viruses that replicate in different cellular compartments, use different assembly pathways, and interact with host-cell membranes in different ways. The central claimed property is not merely the presence of viral nucleic acid somewhere in an infected cell. The claim requires an “extracellular portion” of viral nucleic acid present on the plasma membrane. Practicing the claim therefore requires a viral nucleic acid having a portion accessible at the exterior of the infected cell, rather than RNA or DNA located in the cytoplasm, on the inner face of the membrane, within a replication organelle, in a budding virion, in an extracellular vesicle, or merely recovered with an isolated membrane fraction.
The specification describes experiments involving HIV-1-infected or HIV-1-transfected myeloid and T-cell models. The cells included U1, J1.1, U937, CEM, Jurkat, PBMC-derived cells, and related HIV-1 systems. The experiments isolated crude plasma-membrane material, extracted RNA, and detected TAR and other HIV-1 transcripts by RT-qPCR (Examples 1-5; ¶[0149-0191]). The published methods state that the cell suspension was homogenized and that a centrifugation pellet was collected as “crude membranes”(¶[0157]). The specification does not directly establish that the detected TAR RNA had a portion exposed on the outside of an intact, living, nonpermeabilized cell. The membrane fraction experiments establish that TAR RNA was recovered from material assigned to a plasma membrane fraction. They do not establish the orientation of the RNA relative to the lipid bilayer. The specification also reports flow cytometry staining with the J2 anti-dsRNA antibody. The disclosed method states that the cells were “fixed with 70% alcohol” before staining (¶[0160][0173-0174]). That experiment does not establish that the detected RNA was accessible to the antibody from outside the cell before fixation. Nor does the generic J2 signal identify the detected double-stranded RNA as HIV-1 TAR.
The specification characterizes Figure 5G as a “diagram of potential glycosylated TAR” and states that the plasma-membrane fractions were examined for TAR by RT-qPCR (¶[0182]). The data may support the presence of TAR RNA in the isolated fraction, but a schematic model does not establish extracellular orientation on an intact cell. The specification later acknowledges that enrichment of viral transcripts in plasma membrane fractions “points to potential assembly of virions or simple incorporation of RNA in the plasma membrane”(¶[0189]). These possible explanations do not necessarily produce the extracellular target required by the claims.
The experimental showing is therefore narrow even before the unrestricted viral genus is considered. Claim 1 nevertheless encompasses any virus, any viral RNA or DNA having the recited location, and any molecule that specifically binds the extracellular portion. The dependent claims extend the same premise to latency-associated nucleic acids, noncoding RNA, glycosylated RNA, broad sequence variants, engineered particles, gene-editing systems, treatment, diagnosis, and ex vivo cell processing.
State of the prior art and predictability of the art. At the time of filing, Flynn et al. (Flynn RA, et. al. Cell. 2021 Jun 10;184(12):3109-3124.e22. Epub 2021 May 17.) had reported that conserved mammalian small noncoding RNAs may bear sialylated glycans and that analysis of living cells showed that many glycoRNAs were present on the cell surface. Flynn further reported that these glycoRNAs could interact with anti-dsRNA antibodies and Siglec receptors. The disclosed glycoRNAs were cellular RNAs, and Flynn did not provide a general rule showing that viral nucleic acids produced in infected cells would undergo the same processing and extracellular presentation.
Roloff et. al.(Roloff A, et. al. Bioconjug Chem. 2018 Jan 17;29(1):126-135. Epub 2017 Dec 29.) described synthetic RNA-polymer amphiphiles that self-assembled into micellar nanoparticles. The engineered configuration deliberately placed RNA in a dense and accessible micelle corona, and the authors described “high density display” of ligands on the micelle surface. Roloff shows that one skilled in the art could intentionally construct an artificial particle with outward-facing RNA. It does not teach that viral RNA naturally produced inside an infected host cell will cross, become anchored in, or remain exposed on the extracellular side of the host-cell plasma membrane.
Chen et. al.(Chen EC, et. al. Viruses. 2021 May 13;13(5):903.) visualized Rous sarcoma virus genomic-RNA heterodimers in the nucleus, cytoplasm, and “at the plasma membrane.” The work concerned retroviral RNA localization during genome dimerization, assembly, and packaging. Detection at the plasma membrane does not establish that the viral RNA was displayed on the outer face of the cell or accessible to an extracellular binding molecule.
Lundin et. al. (Lundin A, et. al. PLoS Pathog. 2014 May 29;10(5):e1004166.) described viral RNA synthesis associated with host-derived intracellular membranes and coronavirus replication structures. The reference illustrates that viral RNA may be strongly membrane-associated while remaining within an intracellular compartment and unavailable to a reagent outside the cell. The reference does not provide a predictive relationship between membrane association and extracellular presentation.
Mele et. al. (Mele AR, et. al. Traffic. 2018 Apr 30:10.1111/tra.12578. Epub ahead of print.) described HIV-1 Tat as a viral protein that binds the TAR RNA element and reported that Tat secretion involves binding to phosphatidylinositol-4,5-bisphosphate in the inner leaflet of the plasma membrane. Mele provides evidence that a viral RNA-binding protein can associate with a membrane-related secretion pathway. The reference does not establish that TAR RNA bound by Tat becomes externally exposed on the infected cell surface or provide a rule for predicting that result for other viral nucleic acids.
The prior art therefore disclosed several different conditions that should not be treated as equivalent. Host glycoRNA may be displayed on a living cell. Synthetic RNA may be intentionally displayed on an engineered micelle, while viral RNA may instead be located at an intracellular membrane or plasma membrane assembly site. The result depends on the identity of the RNA, the host-cell pathway, the viral replication strategy, associated proteins, and the physical orientation of the nucleic acid.
The art was not sufficiently predictable to support extrapolation from TAR RNA detected in selected HIV-1 membrane fractions to extracellular viral nucleic acid across any virus. The identified art does not establish that viruses generally expose RNA or DNA on the extracellular face of infected cells. It also does not provide a common sequence, structure, modification, or trafficking mechanism that would allow one skilled in the art to identify qualifying viral nucleic acids without testing each proposed embodiment. This breadth is comparable in relevant part to In re Wright, 999 F.2d 1557, 1561-62, 27 USPQ2d 1510, 1513 (Fed. Cir. 1993). There, the disclosure of a vaccine involving one RNA tumor virus did not enable claims extending broadly to RNA viruses where the viral genus was diverse and the result could not reliably be extrapolated. The presently claimed genus is broader still because claim 1 is not confined to retroviruses or even to RNA viruses.
Level of skill in the art. One skilled in the art would have been familiar with virology, cell culture, molecular biology, RNA isolation, RT-qPCR, membrane fractionation, flow cytometry, microscopy, immunoprecipitation, antibody production, aptamer selection, conjugation chemistry, and nucleic-acid delivery. The individual laboratory methods used in the application were generally available. The availability of those methods does not answer the question presented by the claims. One of skill in the art still would not know, without further investigation, which viral nucleic acids are transported to the infected-cell plasma membrane and presented with an extracellularly accessible portion. Known techniques would allow the artisan to search for such targets. They would not identify the targets in advance or make their existence predictable.
The same distinction applies to the binding-molecule alternative of claim 1. One skilled in the art could generate antibody or aptamer libraries and perform screening assays. The artisan would not know which candidates would recognize a viral nucleic-acid structure on an intact infected cell, avoid binding to host RNA or shared glycans, and function under the conditions required by the claims.
Working examples. The specification provides working experiments directed principally to HIV-1 TAR RNA and selected HIV-1 transcripts in infected or transfected myeloid and T-cell systems. The examples describe isolation of plasma-membrane fractions, RT-qPCR measurement of TAR, sialidase treatment, J2 or Siglec-related immunoprecipitation, and flow-cytometry staining of alcohol-fixed cells (¶[0161-0191]).
The examples do not provide a working embodiment involving a non-HIV virus. They do not demonstrate extracellular presentation of viral DNA, nor do they test viruses having materially different replication and assembly pathways. The reported experiments therefore do not represent the diversity encompassed by claim 1. The examples also do not directly demonstrate the required extracellular topology for HIV-1 TAR. The specification states that the crude membrane pellet was produced after cell homogenization and centrifugation (¶[0170]). RNA recovered from that material may be membrane-associated without being displayed on the exterior of an intact infected cell. The specification states that “[o]ne or all 4 of these RNAs may be on the membrane”(¶[0187]). It also proposes the presence of HIV-1 ASP RNA and HTLV-1 HBZ RNA on the cell surface (¶[0188]). These statements reflect unresolved possibilities rather than demonstrated working embodiments.
No example provides an antibody, aptamer, peptide, or oligonucleotide shown to bind a defined extracellular viral nucleic-acid target on a living infected cell. J2 recognizes double-stranded RNA generally, while Siglec-14 recognizes glycans. Neither reagent is shown to distinguish an extracellular HIV-1 TAR target from host-cell RNA, other viral RNA, or shared glycan structures. No working example demonstrates treatment or especially prevention of any viral infection using the claimed composition. No subject is diagnosed by detecting an extracellular viral nucleic-acid target. No infected cell is separated or killed through binding of such a target, and no diagnostic, therapeutic, nanoparticle, vesicle, or gene-editing cargo is delivered through the claimed interaction.
The working examples therefore provide, at most, a limited basis for investigating HIV-1 RNA associated with isolated membrane fractions. While the use of certain binding agents, such as antibodies, can prevent binding of virions to a cell surface and thus prevent infection, that was not demonstrated here, nor does it appear to be the intended mechanism of action of such binding molecules in the compositions or methods. Nucleic acids alone have not appeared to have been proved to prevent any viral infection in any context. They do not establish that the full claimed compositions and methods can be made and used without further extensive experimentation.
Amount of direction or guidance in the specification. The specification provides detailed guidance for culturing selected HIV-1 cell models, isolating membrane fractions, extracting RNA, and performing RT-qPCR. It also provides general descriptions of antibody production, aptamer selection, RNA-binding molecules, diagnostic labels, therapeutic agents, vesicles, nanoparticles, gene-editing systems, treatment, diagnosis, and cell separation (¶[0072-0144]). The specification does not provide a method that directly establishes extracellular orientation of a viral nucleic acid on a living, nonpermeabilized cell. It does not explain how to distinguish the claimed target from RNA located on the cytoplasmic side of the membrane, enclosed within a budding particle, associated with an extracellular vesicle, or carried into a crude membrane fraction during cell disruption.
The specification does not identify a common structural property that predicts extracellular presentation. It does not explain which viral RNAs or DNAs undergo the required trafficking, which host cells support that trafficking, or whether the property is retained during latency. The disclosure likewise does not explain how sequence identity to a TAR-containing sequence predicts membrane transport or extracellular orientation. The guidance concerning specific binders to said extracellular viral nucleic acid is also general. The specification instructs one skilled in the art to prepare or select antibodies, aptamers, oligonucleotides, or peptides and screen for binding (¶[0072][0076-0088]). It does not provide a structurally defined binding molecule shown to work, an extracellular TAR epitope, a binding-affinity threshold, or a selectivity standard that distinguishes a successful viral-target-specific binder from a molecule that binds host RNA or common glycan structures.
For the dependent claims, the disclosure primarily identifies possible components and desired results. It does not provide operative combinations showing how a specific binder, therapeutic moiety, particle, or gene-editing element should be arranged to recognize the claimed target and produce the recited result. The specification therefore provides a starting point for research, but not a general teaching that carries one skilled in the art through the full scope of the claims.
Claim 9
Claim 9 encompasses a viral nucleic acid comprising any one of SEQ ID NOS: 1-22 or a variant thereof. The specification describes variants broadly, including sequences having about 60% to about 99.5% identity and sequences having substitutions, insertions, deletions, additions, fusions, or glycosylation changes (¶[0064-0068]). The specification does not identify which nucleotide positions may be changed while retaining plasma-membrane association, glycosylation, extracellular presentation, or binding by the same molecule. It does not provide representative working variants across the stated range. It also does not identify a structural feature that distinguishes operative variants from sequences that will remain intracellular or will not bind a claimed molecule. One skilled in the art would therefore need to prepare or obtain candidate variants and test each candidate for expression, stability, glycosylation, membrane association, extracellular orientation, and target accessibility. Sequence identity alone does not provide the missing prediction.
Claims 10-14
Claim 10 adds a pharmaceutically acceptable carrier or adjuvant; however, this limitation does not provide the missing extracellular viral target or establish that a composition containing such a target can be formulated and used across the scope of claim 1. Claim 11 limits the binding molecule to an antibody or aptamer; again, the specification does not provide an antibody or aptamer demonstrated to bind a defined extracellular viral nucleic-acid portion on an intact infected cell. One skilled in the art would first need to validate the extracellular target and then generate and screen candidate antibodies or aptamers to determine whether any candidate had the required specificity and accessibility.
Claim 12 adds a diagnostic or therapeutic moiety, but the specification does not describe a working conjugate that binds an extracellular viral nucleic acid and performs a diagnostic or therapeutic function. Attaching a label, toxin, drug, or other moiety would require further testing to determine whether the conjugate retained binding, reached the target, and produced the intended result.
Claim 13 recites an exosome, liposome, macrovesicle, or nanoparticle. Roloff (supra) shows that one skilled in the art could engineer RNA-displaying micelles, and the general preparation of vesicles and nanoparticles was known. That knowledge does not identify a molecule capable of targeting extracellular viral nucleic acid on an infected cell. The skilled artisan would need to determine the orientation, density, stability, and functional accessibility of the targeting component for each proposed structure.
Claim 14 adds one or more elements of a gene-editing system. The specification identifies known classes of editing components but does not provide a working targeted system directed through an extracellular viral nucleic-acid binder. The artisan would need to design the binder, delivery structure, editing cargo, target sequence, and release or internalization mechanism, then determine whether the combination reaches an infected cell and performs editing.
These dependent claims add additional technical layers to an underlying target that has not been established across the scope of claim 1. They do not reduce the experimentation needed to identify and validate the target.
Claims 15-18
Claim 15 requires administering a therapeutically or prophylactically effective amount of the composition of claim 1 to treat or prevent viral infection. The claim encompasses treatment or prevention of infection by any virus. The specification provides no working therapeutic or prophylactic example. It does not show administration of a claimed composition, binding to an extracellular viral nucleic acid in vivo, reduction of infected cells, inhibition of viral replication, or prevention of infection of any cell by any virus. One skilled in the art would need to identify an appropriate target and binder, develop a formulation, determine dosage and route, evaluate distribution and target accessibility, and establish efficacy and safety. One would then further have to determine if said compositions merely inhibit the viral infection, completely prevent viral infection, or simply prevent disease or symptoms associated with viral infection through inhibition of viral entry and/or replication.
Claim 16 adds administration during viral latency. Latently-infected cells may differ from productively infected cells in viral transcription, antigen abundance, and target availability. The specification does not show that an extracellular viral nucleic-acid target persists at a therapeutically useful level during latency or that a claimed composition can reach and act upon such a target.
Claims 17 and 18 limit the subject to an asymptomatic HIV-positive subject or a subject having AIDS. These limitations narrow the patient population but do not supply the missing therapeutic composition or efficacy data. The experiments involving HIV-1 membrane fractions do not reasonably establish treatment across these clinical settings.
Claim 19
Claim 19 requires detecting an extracellular portion of viral nucleic acid on an infected-cell plasma membrane and identifying the subject as infected. The specification provides no working diagnostic method performed on a subject or clinical sample using a viral-nucleic-acid-specific extracellular binder. One skilled in the art would need to identify the qualifying target, produce a detection molecule, determine whether the target is sufficiently abundant and stable in a clinical specimen, and establish a signal that distinguishes infected from uninfected samples. Additional testing would be needed to determine sensitivity, specificity, background binding, assay thresholds, and performance across viral strains and stages of infection. The claim is not limited to HIV-1 or to the cell systems used in the examples. The required diagnostic program would therefore need to be repeated for materially different viruses and sample types.
Claim 23
Claim 23 requires contacting subject-derived cells with the claim 1 composition so that virally infected cells bind to the molecule in a method for separating or killing those cells ex vivo. No working example demonstrates binding of an intact infected cell by a molecule specific for an extracellular viral nucleic acid. No infected cells are separated or killed through the asserted interaction. To practice the claim, one skilled in the art would need to establish a target that remains exposed during ex vivo processing, develop a binder that distinguishes infected from uninfected cells, and determine conditions that permit useful binding without unacceptable background. For separation, the artisan would then need to establish capture or sorting efficiency. For killing, a functional cytotoxic component and conditions producing selective killing would have to be identified. These steps are not routine optimization of an operative disclosed method. They require discovery and validation of the target, discovery of the binding molecule, and development of the claimed functional process.
Quantity of experimentation necessary. To practice claim 1 across its full scope, one skilled in the art would need to select a virus and host-cell system, identify the viral nucleic acids produced during infection, and determine whether any candidate is associated with the plasma membrane. The artisan would then need to determine whether the candidate is exposed on the extracellular face of an intact cell and remains accessible at a useful abundance. Because the specification provides no predictive rule, this work would need to be repeated across viral families, genome types, strains, host cells, and stages of infection. For the binder alternative, one skilled in the art would then need to generate candidate antibodies, aptamers, peptides, oligonucleotides, or other molecules. Candidate molecules would have to be screened against the asserted target and counter-screened against host RNA, unrelated viral RNA, glycans, membrane proteins, dead cells, disrupted cells, virions, and extracellular vesicles. The remaining candidates would require testing on intact infected and uninfected cells to determine whether the claimed specific binding occurred.
The dependent claims require even further extensive development. Variant sequences must be prepared and tested; conjugates and particles must retain target binding, while therapeutic, diagnostic, editing, separation, or killing functions must be established under the conditions required by the particular claim. With the limitation of “prevention” in claim 15, one would have to show the two different compositions of claim 1, namely the extracellular viral nucleic acid or the binding agent that binds to the extracellular viral nucleic acid, would prevent viral infection, which appears to be counter-intuitive as a cell would have to be infected in order to externally present the viral nucleic acid in the first place.
Such experimentation would not merely involve applying known methods to embodiments reasonably expected to work. The individual methods may have been known, but the artisan would be using those methods to discover which targets exist, which binders function, and which combinations produce the claimed result. The specification does not materially narrow that search or identify a general quality running through the full claimed class. The relevant inquiry is not whether one skilled in the art could perform membrane fractionation, RT-qPCR, antibody screening, SELEX, particle preparation, or functional testing. The relevant inquiry is whether the specification teaches one skilled in the art how to make and use the full claimed invention without unreasonable experimentation. Here, the specification requires the artisan to engage in a broad and iterative research program to identify operative members of the claimed classes.
Amgen. The Supreme Court has explained that a specification need not describe with particularity every embodiment within a claimed class. The disclosure must nevertheless enable one skilled in the art to make and use the full scope of the class, allowing only a reasonable amount of experimentation in view of the nature of the invention and the underlying art. Amgen Inc. v. Sanofi, 598 U.S. 594, 610-13 (2023). The Supreme Court further explained that a small number of examples may be sufficient where the specification discloses a general quality running through the class that reliably permits the full class to be practiced.
The instant specification describes HIV-1 TAR and selected HIV-1 transcripts detected in isolated plasma-membrane fractions from a limited number of cell systems. The claims extend to extracellular viral RNA or DNA from any virus, broad sequence variants, any molecule that specifically binds such a target, and multiple therapeutic, diagnostic, delivery, editing, separation, and killing applications. The specification does not disclose a general quality that identifies which viral nucleic acids will be displayed on the extracellular face of infected cells, nor does it provide a general method that reliably produces or identifies a suitable target or binder across the claimed class. Instead, it instructs one skilled in the art to search for additional targets and then screen for molecules and combinations that perform the claimed functions.
Conclusion. After considering the breadth of the claims, the nature of the invention, the limited and indirect experimental showing, the state and unpredictability of the art, the amount of guidance provided, the absence of representative working embodiments, and the quantity of experimentation required, the specification does not enable one skilled in the art to make and use the full scope of claims 1-19 and 23 without undue experimentation. The disclosed HIV-1 membrane-fraction experiments do not reasonably enable extracellular viral nucleic acid across any virus; they also do not enable the broad genus of molecules that specifically bind such targets or the claimed pharmaceutical, antibody, aptamer, conjugate, particle, gene-editing, treatment, prevention, diagnostic, separation, and killing embodiments. For at least these reasons, claims 1-19 and 23 are rejected under 35 U.S.C. 112(a) for lack of enablement.
Claims 1-19 and 23 are rejected under 35 U.S.C. 112(a), or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention.
The written description requirement is separate and distinct from the enablement requirement. To satisfy the written description requirement, the specification must reasonably convey to one skilled in the relevant art that the inventor had possession of the claimed invention as of the filing date. Possession may be shown by a description of the complete structure of the claimed invention, a representative number of species falling within the scope of a claimed genus, or relevant identifying characteristics sufficient to show that the inventor had possession of the claimed subject matter.
Claims 1-19 and 23 recite composition comprising an extracellular portion of a viral nucleic acid present on the plasma membrane of an infected host cell, or a molecule that specifically binds that extracellular portion. The claims further encompass pharmaceutical formulations, antibodies or aptamers, diagnostic or therapeutic conjugates, vesicles or nanoparticles, gene-editing components, methods of treatment or prevention from any viral infection, diagnostic methods, and ex vivo methods involving the binding, separation, or killing of infected cells. The specification describes experiments involving HIV-1 TAR RNA and other hIV-1 transcripts in selected HIV-1-infected or transfected myeloid and T-cell systems. The experiments include isolation of plasma membrane fractions, detection of viral transcripts by RT-qPCR, immunoprecipitation of RNA from membrane preparations using J2 or Siglec-14, and J2 staining of alcohol-fixed cells (¶[0149-0191]; Examples 1-5). The specification reports enrichment of TAR and other HIV-1 transcripts in isolated plasma-membrane fractions. The specification also provides a schematic model in which TAR may be glycosylated and presented at the cell surface (¶[0182-0184]).
However, the scope of claims 1-19 and 23 is not limited to the HIV-1 constructs, transcripts, cell types, or experimental conditions described in the specification. Claim 1 broadly encompasses an extracellular portion of any viral nucleic acid present on the plasma membrane of a host cell infected with any virus. The claim encompasses viral RNA and viral DNA, coding and noncoding sequences, segmented and non-segmented genomes, latent and active infections, and host cells infected by viruses having materially different replication and assembly pathways. The specification does not describe a sufficient number of viral species representative of that scope. The working disclosure is directed to HIV-1, which is a retrovirus having an RNA genome, a reverse-transcription life cycle, and a particular relationship with the host-cell plasma membrane during viral assembly and budding. No working example describes a DNA virus, a negative-strand RNA virus, a double-stranded RNA virus, a segmented virus, or a non-retroviral positive-strand RNA virus having an extracellular portion of viral nucleic acid on an infected-cell plasma membrane.
The specification lists broad groups of viruses, but a list of virus names or taxonomic categories does not establish possession of the claimed extracellular presentation for those viruses. The specification does not identify an extracellularly presented viral nucleic acid from the listed non-HIV virus groups or provide experimental results showing that those virus groups share the claimed property (¶[0049-0052]).
The specification also does not describe structural features common to the claimed genus that would allow one skilled in the art to recognize which viral nucleic acids are present on the extracellular face of an infected-cell plasma membrane. No common sequence motif, secondary structure, glycosylation site, membrane anchor, trafficking signal, viral-protein interaction, or host-cell transport pathway is identified as characteristic of the claimed viral nucleic acids. Instead, one skilled in the art would be required to select additional viruses and viral nucleic acids not described in the specification and determine whether those additional embodiments satisfy the recited extracellular-location limitation.
The issue is not resolved by the detection of viral RNA in an isolated plasma membrane fraction. Viral RNA may be recovered with a plasma membrane fraction because it is located on the cytoplasmic side of the membrane, associated with a viral assembly complex, enclosed within a budding virion, contained in a vesicle, or nonspecifically incorporated into the collected fraction. The specification itself states that enrichment of viral transcripts in plasma-membrane fractions may point to “potential assembly of virions or simple incorporation of RNA in the plasma membrane”(¶[0189]).
The specification therefore does not describe an identifying characteristic that separates viral nucleic acids having the claimed extracellular orientation from viral nucleic acids that are merely associated with membrane material. The disclosure of HIV-1 RNA in membrane fractions does not reasonably convey possession of an extracellular viral-nucleic-acid genus extending across any virus and any infected host cell.
As claim 1 is drawn to two distinct inventions, those two separate groups, and how the dependent claims fail to provide written descriptive support for either, will be elaborated upon separately herein.
Claim 1 - Functionally defined viral nucleic acids
With respect to the viral nucleic acids of claim 1, the claimed viral nucleic acids are defined, at least in part, by the recited function or property of having an extracellular portion present on the plasma membrane of an infected host cell. However, the specification does not establish a correlation between a disclosed viral nucleic-acid structure and that recited cellular location sufficient to identify additional viral nucleic acids falling within the scope of claim 1. The specification describes selected HIV-1 TAR-containing transcripts and other HIV-1 transcripts detected in plasma-membrane fractions. It does not identify structural features common to viral nucleic acids from different virus families that would allow one skilled in the art to recognize which additional members possess the required extracellular presentation. The disclosure of the desired location, without a sufficient description of the nucleic-acid genus having that location, does not demonstrate possession of the full scope of claim 1. The uncertainty remains even within the HIV-1 disclosure. The specification states that “[o]ne or all 4 of these RNAs may be on the membrane”(¶[0187]). The specification also proposes that HIV-1 ASP RNA and HTLV-1 HBZ RNA may be present on the cell surface, but does not report experimental confirmation of the claimed extracellular presentation for those proposed transcripts (¶[0188]). These statements identify possibilities for further investigation; they do not describe which viral transcripts have the claimed extracellular orientation or provide a common identifying feature by which the full claimed genus may be recognized.
Claim 1- Molecules that specifically bind the extracellular portion
Claim 1 alternatively encompasses any molecule that specifically binds the extracellular portion of the viral nucleic acid. This genus is defined primarily by the desired binding result rather than by disclosed structure. The specification describes conventional approaches for preparing antibodies, selecting aptamers, designing oligonucleotides, and identifying RNA-binding peptides (¶[0072][0076-0088]). These passages describe ways in which candidate molecules might be generated and screened.
The specification does not disclose any sequences or complete structures of any antibody, aptamer, oligonucleotide, or peptide shown to “specifically bind” any extracellular viral nucleic acid on any intact, infected cell. No antibody heavy chain or light chain sequence is provided, no complementarity-determining region is identified, and no aptamer sequence is reported as having been selected against the claimed extracellular target. The specification also does not identify a common structural characteristic shared by molecules having the claimed binding function. The J2 antibody does not provide a representative species of the full claimed genus. J2 recognizes double-stranded RNA structures and is not described as specifically recognizing a defined extracellular HIV-1 TAR sequence. The disclosed Siglec-14 reagent recognizes glycans and is not shown to specifically bind a viral-nucleic-acid sequence or a structure unique to an infected cell. The specification again describes a research plan for obtaining possible binders rather than representative members of the claimed binder genus. The ability to prepare libraries and screen for a desired result does not reasonably convey possession of every antibody, aptamer, peptide, oligonucleotide, or other molecule capable of satisfying the broad functional limitation.
Dependent Claims
The dependent claims do not cure either of the major deficiencies noted in claim 1. Claim 2 limits the viral nucleic acid to one expressed during a latent portion of the viral life cycle, but the specification does not identify representative extracellular nucleic acids from materially different latent viruses or a characteristic common to latency-associated nucleic acids having the claimed location. Claim 3 limits the viral nucleic acid to noncoding RNA; while the specification states that viruses may produce noncoding RNAs, it does not show that production of a noncoding RNA correlates with extracellular presentation on an infected cell. The claimed scope continues to encompass noncoding RNAs from viruses that are not described or tested in the application. Claim 4 requires that the viral nucleic acid be glycosylated. The specification identifies possible glycans and predicted glycosylation sites in selected HIV-1 sequences (¶[0044-0048][0069-0071]). The specification does not describe a representative number of glycosylated extracellular viral nucleic acids or establish that a predicted glycosylation site identifies a viral RNA that is displayed on the extracellular face of an infected cell. Claim 5 limits the virus to a retrovirus, but the disclosed HIV-1 embodiments are not representative of every retrovirus recited or contemplated by the specification. The specification lists multiple retroviral genera but does not identify an extracellular viral nucleic-acid species from each materially different group (¶[0050-0052]). Claim 6 limits the virus to HIV, which includes HIV-1 and HIV-2. The working disclosure is directed to HIV-1 and does not describe an extracellular HIV-2 nucleic-acid species or a common feature showing that the reported HIV-1 results extend to HIV-2. Claim 7 limits the virus to HIV-1, but still encompasses any extracellular portion of any HIV-1 viral nucleic acid and any molecule that “specifically binds” that portion. The specification detects several HIV-1 transcripts in plasma-membrane fractions, but does not identify which nucleotide portion of each transcript is extracellularly exposed or disclose a target-specific molecule for the claimed extracellular portion.
Claim 8 limits the viral nucleic acid to one comprising a TAR element. The specification describes HIV-1 TAR-containing RNAs and reports TAR RNA in isolated plasma-membrane fractions. This disclosure is narrower than the unrestricted viral genus, but claim 8 still encompasses any extracellular portion of a TAR-containing nucleic acid and any molecule that specifically binds that portion. The specification does not identify the particular TAR nucleotide segment exposed to the extracellular environment. It does not distinguish an extracellularly exposed TAR portion from TAR RNA located within or adjacent to an isolated membrane fraction. No TAR-specific antibody, aptamer, peptide, or other molecule shown to bind TAR on the exterior of an intact infected cell is described. Claim 9 encompasses SEQ ID NOS: 1-22 and variant sequences thereof. The specification describes variants having from about 60% to about 99.5% identity, sequences differing by one or more nucleotide residues, and sequences containing substitutions, insertions, deletions, additions, fusions, or glycosylation changes (¶[0064-0068]).
The specification does not identify which nucleotide positions may be altered while retaining extracellular presentation, glycosylation, membrane association, or binding by the same molecule. It does not describe representative variants across the stated identity range or identify structural features sufficient to distinguish variants having the claimed extracellular location from sequences that do not. Sequence identity to one of SEQ ID NOS: 1-22 is not shown to correlate with the cellular trafficking and membrane orientation required by claim 1.
Accordingly, the disclosure does not demonstrate possession of the broader claimed group of sequences and variants.
The specification describes known carriers, adjuvants, antibodies, aptamers, diagnostic agents, therapeutic agents, vesicles, nanoparticles, and gene-editing systems (¶[0073-0116]). However, claims 10-14 are not limited to a disclosed complete composition containing a demonstrated extracellular viral-nucleic-acid target and an operative target-specific molecule. Claim 10 adds a pharmaceutically acceptable carrier or adjuvant. This limitation does not narrow the viral-nucleic-acid or binder genus to species adequately described in the specification. Claim 11 limits the molecule to an antibody or aptamer. The specification does not describe a representative number of antibodies or aptamers that bind the claimed extracellular viral target, and it also does not identify structural features common to antibodies or aptamers having that binding function.
Claim 12 adds a diagnostic or therapeutic moiety, with the specification listing labels, toxins, radioisotopes, drugs, and other possible agents, but fails to describe a completed conjugate shown to bind an extracellular viral nucleic acid on an infected cell. The disclosed lists of possible binding molecules and possible moieties do not reasonably convey possession of every functional combination produced by selecting one component from each group. Claim 13 recites an exosome, liposome, macrovesicle, or nanoparticle, and the specification describes possible coating or loading of such structures with a molecule that binds extracellular viral nucleic acid (¶[0102-0106][0116]). No representative vesicle or nanoparticle comprising a described target-specific molecule was prepared or shown to recognize an infected cell. Claim 14 adds one or more elements of a gene editing system, with the specification referring generally to CRISPR-Cas, zinc-finger nuclease, TALE, and homing-meganuclease systems as exemplary members of this genus (¶[0106-0114]). The specification does not describe a complete construct having a particular extracellular viral nucleic acid binder, a selected delivery structure, and a defined editing cargo arranged to perform the claimed targeting and editing.
The claims encompass combinations that differ in the viral target, binding component, carrier or particle, attached moiety, and editing component. The specification does not describe representative compositions across those variable combinations or identify characteristics sufficient to show possession of the broader group.
The specification states that the disclosed compositions may be used to treat or prevent viral infection, including infection during latency and infection with HIV (¶[0117-0129]). However, claims 15-18 broadly encompass treatment or prevention using any composition incorporated from claim 1. No working example administers a claimed composition to a subject or reports treatment or prevention of viral infection or symptoms or disease resulting from viral infection. The specification does not describe a particular extracellular viral nucleic acid target that was reached in vivo, a binder shown to recognize that target after administration, or a therapeutic composition shown to alter infection.
Claim 15 encompasses treatment or prevention of infection with any virus. The disclosure of HIV-1 membrane-fraction experiments does not reasonably convey possession of therapeutic or prophylactic methods across that scope. Claim 16 limits administration to a latent portion of the viral life cycle, while claims 17 and 18 identify an asymptomatic HIV-positive subject or a subject having AIDS. These subject and infection-stage limitations do not supply the missing description of a composition shown to bind the asserted extracellular target and produce the recited treatment result.
Claim 19 recites detecting an extracellular portion of viral nucleic acid on an infected-cell plasma membrane and identifying the subject as infected. The specification describes possible labels, imaging agents, immunoassays, and sample types (¶[0130-0137]). The specification does not describe a completed diagnostic method using a viral nucleic acid-specific molecule to detect the claimed extracellular target in a subject or clinical sample. No particular detection molecule, assay threshold, or diagnostic result is provided. The general statement that an asserted target may be detected does not reasonably convey possession of diagnostic methods extending across any virus encompassed by claim 1.
Claim 23 recites an ex vivo method in which subject-derived cells are contacted with the composition of claim 1 and infected cells bind to the molecule for separation or killing. The specification describes possible use of FACS, solid-phase binding, filtration, and extracorporeal processing (¶[0138-0144]). No working example binds an intact infected cell using a molecule specific for extracellular viral nucleic acid, and no infected cell is separated or killed through that interaction. The specification does not describe the structure of a qualifying binding molecule or a complete composition shown to perform the claimed ex vivo process. The recited method is therefore based on a desired use of the broadly claimed composition rather than a method shown to have been possessed.
Conclusion
The specification does not describe a sufficient number of viral species representative of the scope of claims 1-19 and 23. It also does not identify structural or other characteristics common to viral nucleic acids that are exposed on the extracellular face of infected cell plasma membranes. Instead, one skilled in the art would be required to select additional viruses, viral sequences, host cells, binding molecules, and functional combinations not described in the specification and determine whether those embodiments satisfy the claims. The specification further does not describe representative antibodies, aptamers, particles, conjugates, gene-editing compositions, treatment methods, diagnostic methods, or ex vivo cell-processing methods falling within the claimed scope. The disclosure of desired functions and possible component classes does not demonstrate possession of the full claimed genera.
Accordingly, the disclosure does not reasonably convey to one skilled in the art that the inventors had possession of the full scope of the subject matter recited in claims 1-19 and 23 at the time the application was filed. Dependent claims 2-19 and 23 do not cure the deficiency because they continue to incorporate the unsupported viral-nucleic-acid and binding-molecule genera of claim 1. Their additional limitations narrow selected aspects of the compositions or methods but do not provide adequate written-description support for the broader subject matter incorporated from claim 1.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 1-3 and 5-9 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Wada et. al. (US20140206560A1; Pub. 07/24/2014; hereafter “Wada”.)
The Prior Art
Wada teaches SEQ ID NO: 62, which is a 27-nucleotide artificial RNA described as a synthetic oligonucleotide based on the HIV-1 TAR sequence; SEQ ID NO: 62 is 100% identical to instant SEQ ID NO: 2 (¶[0073]).
Query Match 100.0%; Score 27; Length 27;
Best Local Similarity 77.8%;
Matches 21; Conservative 6; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CCAGATCTGAGCCTGGGAGCTCTCTGG 27
|||||:|:|||||:||||||:|:|:||
Db 1 CCAGAUCUGAGCCUGGGAGCUCUCUGG 27
As at least one reasonable interpretation of claim 1 is that claim 1 encompasses a composition comprising an isolated or synthetic nucleic acid sequence corresponding to the recited extracellular viral nucleic acid (see ¶[0121] of instant specification). Claim 1 does not require that the claimed composition itself remain physically positioned on the plasma membrane of an infected cell. As Wada teaches compositions which may comprise SEQ ID NO: 62, such as a buffer (¶[0130-0174]), Wada therefore teaches the limitations of instant claims 1, 3, and 5-9. Furthermore, absent evidence to the contrary, TARs are expressed at low-levels in latently-infected cells, and the teachings of Wada inherently anticipate the limitations of instant claim 2. The instant specification teaches HIV TAR is non-coding RNA positioned in the 5′-LTR of all viral transcripts and features a conserved hairpin structure indispensable for transactivation and viral replication (instant ¶[0161]; instant claims 3).
For at least these reasons, Wada anticipates the limitations of instant claims 1-3 and 5-9.
Claims 1-3, 5-6, 8-10, and 12-14 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Dickinson et. al. (WO2020142676A1; Pub. 07/09/2020; hereafter “Dickinson”.)
The Prior Art
Dickinson teaches an RNA-regulatory system comprising an RNA targeting molecule having an HIV TAR hairpin scaffold and an RNA hairpin-binding domain that specifically binds the TAR hairpin (¶[0031][0196-0198]; reference claims 1 and 18). Dickinson teaches the use of the engineered TBP6.7 hairpin-binding protein, which “was previously engineered to bind the HIV TAR hairpin”, together with a guide RNA comprising the TAR hairpin structure (¶[0198]). The TAR hairpin of SEQ ID NO:1 of Dickinson is 100% identical to instant SEQ ID NO: 2.
Query Match 100.0%; Score 27; Length 31;
Best Local Similarity 77.8%;
Matches 21; Conservative 6; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CCAGATCTGAGCCTGGGAGCTCTCTGG 27
|||||:|:|||||:||||||:|:|:||
Db 3 CCAGAUCUGAGCCUGGGAGCUCUCUGG 29
Dickinson therefore teaches a composition comprising a molecule that specifically binds the same HIV-1 TAR sequence encompassed by instant claims 1, 5-6, and 8-9. The identification in the instant application of that TAR sequence as an extracellular portion present on an infected cell plasma membrane does not structurally distinguish the claimed binding molecule because Dickinson expressly teaches that the molecule binds the identical TAR hairpin. Furthermore, absent evidence to the contrary, TARs are expressed at low-levels in latently-infected cells, and the teachings of Dickinson inherently anticipate the limitations of instant claim 2. Additionally, the instant specification teaches HIV TAR is non-coding RNA positioned in the 5′-LTR of all viral transcripts and features a conserved hairpin structure indispensable for transactivation and viral replication (instant ¶[0161]; instant claim 3).
Dickinson teaches that their CRISPR/Cas-inspired RNA targeting system (CIRTS) is a superior gene editing system to CRISPR/Cas systems as it targets the RNA, not DNA, and does not require the large proteins necessary for such a system (¶[0006-0007]; instant claim 14.) Dickinson teaches delivery vehicles comprising its TAR-hairpin RNA-regulatory system, wherein the delivery vehicle may comprise a liposome or an exosome (¶[0135-0138]; instant claim 13), wherein controlled-release microcapsules are biocompatible and adaptable to standard pharmaceutical delivery models (¶[0148]; instant claim 10). Dickinson teaches that nucleic acids and proteins can be conjugated to detectable markers or tags (¶[0118-0120][0154-0155][0175][0214]; instant claim 12).
For at least these reasons, Dickinson anticipates the limitations of instant claims 1-3, 5-6, 8-10, and 12-14.
Claims 1-3, 5-10, 12-13, and 15-18 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Anderson et. al. (US20120076763A1; Pub. 03/29/2012; hereafter “Anderson”.)
The Prior Art
Anderson teaches recombinant lentiviral vectors containing an HIV TAR decoy sequence (entire document; see abstract.) Anderson teaches that the TAR decoy mimics the viral transcriptional responsive element and binds the HIV Tat protein, thereby sequestering Tat from its role in proviral HIV transcription (¶[0168]). Anderson also reports construction and expression of a combination lentiviral vector containing a TAR decoy driven by a U6 promoter (¶[0010][0017][0124]; Example 8). Anderson expressly identifies SEQ ID NO:1 as an additional HIV TAR sequence for use in the disclosed invention, wherein SEQ ID NO: 1 of Anderson is 100% identical to instant SEQ ID NO: 2 (instant claims 8-9).
Query Match 100.0%; Score 27; Length 48;
Best Local Similarity 100.0%;
Matches 27; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CCAGATCTGAGCCTGGGAGCTCTCTGG 27
|||||||||||||||||||||||||||
Db 18 CCAGATCTGAGCCTGGGAGCTCTCTGG 44
Anderson identifies SEQ ID NO:1 as an additional TAR decoy sequence in a recombinant composition, and Anderson teaches the components may be within pharmaceutically acceptable compositions with pharmaceutically-acceptable carriers (¶[0039][0091-0092][0134]; instant claims 1, 5-6, 10). The instant specification teaches HIV TAR is non-coding RNA positioned in the 5′-LTR of all viral transcripts and features a conserved hairpin structure indispensable for transactivation and viral replication (instant ¶[0161]; instant claim 3). Furthermore, absent evidence to the contrary, TARs are expressed at low-levels in latently-infected cells, and the teachings of Anderson inherently anticipate the limitations of instant claim 2. Anderson teaches that TAR sequences are known in HIV-1 (¶[0112]; instant claim 7). Anderson teaches detectable labels can be attached to any of the described polynucleotides, polypeptides, antibodies, or compositions (¶[0055-0056]; instant claim 12). Anderson teaches the vector particle, which counts as a nanoparticle, can be further encapsulated within lipofection reagents, which qualify as liposomes (¶[0127-0128][0147][0177]; instant claim 13). Anderson teaches the vectors and particles are useful to inhibit, ex vivo and in vivo, the replication of HIV in a cell system, such as a cell culture, or in a subject in need thereof by administering an effective amount of the vector, the particle or the cell conjugated to the particle, and the method not only inhibits HIV replication, but also prevents replication in a subject infected with the virus (¶[0009]; reference claim 23; instant claim 15). Anderson teaches this subject in need thereof can be suffering from an active or latent infection (¶[0097]; instant claim 16), such as a patient that has not yet developed characteristic disease pathology (¶[0097]; instant claim 17), or a patient with AIDS (¶[0137-0139]; instant claim 18).
Anderson therefore expressly or inherently teaches every aspect of instant claims 1-3, 5-10, 12-13, and 15-18, and anticipates the invention encompassed by said claims.
Claims 1-3, 5-8, and 11-13 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Toulme et. al. (US20160274095A1; Pub. 09/22/2016; hereafter “Toulme”).
The Prior Art
Toulme teaches a composition comprising DII21, a DNA aptamer selected against binding the TAR RNA hairpin of HIV-1 (¶[0136-0138][0198-0200]). Toulme therefore teaches a composition comprising a molecule that specifically binds an HIV-1 TAR sequence encompassed by instant claims 1, 5-8, and 11. The identification in the instant application of that TAR sequence as an extracellular portion present on an infected cell plasma membrane does not structurally distinguish the claimed binding molecule because Toulme expressly teaches that the molecule binds the identical TAR hairpin. Furthermore, absent evidence to the contrary, TARs are expressed at low-levels in latently-infected cells, and the teachings of Toulme inherently anticipate the limitations of instant claim 2. Additionally, the instant specification teaches HIV TAR is non-coding RNA positioned in the 5′-LTR of all viral transcripts and features a conserved hairpin structure indispensable for transactivation and viral replication, thus inherently teaching the limitations of instant claim 3 (instant ¶[0161]). Toulme teaches the substrate or support for the aptamer may be beads, microparticles, and nanoparticles (¶[0080]; instant claim 13). Toulme teaches that the aptamer may be immobilized using biotin and/or streptavidin or other detectable labels, such as fluorescent or luminescent labels (¶[0076][0081]; instant claim 12).
Toulme therefore expressly or inherently teaches every aspect of instant claims 1-3, 5-8, and 11-13, and anticipates the invention encompassed by said claims.
Conclusion
No claims are allowed.
The prior art made of record and not relied upon is considered pertinent to applicant's disclosure and is listed below.
Pasternak AO, et. al. Retrovirology. 2013 Apr 15;10:41. Teaches that viral RNA migrates to the interior, cytosolic portion of the infected cell plasma membrane. Not utilized as rejection would be redundant to those set forth supra.
Borniego ML, et. al. J Exp Bot. 2023 Apr 9;74(7):2389-2404. Post-filing art that teaches the extracellular presentation of plant RNA on plant cell surface. Not utilized as rejection would be redundant to those set forth supra.
Li Z, et. al. Mol Cell. 2025 Dec 18;85(24):4633-4650.e11. Post-filing art that teaches the extracellular presentation of cellular RNA on cell surface. Not utilized as rejection would be redundant to those set forth supra.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to RACHEL B GILL whose telephone number is (571)272-3129. The examiner can normally be reached on M to F 8:00 AM to 5:00 PM Eastern.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, MICHAEL ALLEN can be reached on 571-270-3497. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/RACHEL B GILL/
Primary Examiner, Art Unit 1671
Prosecution Insights