Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
1.Applicant’s election without traverse of Group I (claims 1-2) in the reply filed on September 06, 2026 is acknowledged.
Status of the Application
2. Claims 1-2 are considered for examination. Clam 3 is withdrawn from further consideration as being drawn to nonelected group.
Priority
3. This application filed on April 04, 2024 is a 371 of PCT/IB2022/060421 filed on October 28, 2022 which claims foreign priority to CONC2021/0014590 filed on October 28, 2021.
Objection to the Specification
4. The disclosure is objected to because of the following informalities:
The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code (page 8, line 21-22). Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01.
Appropriate correction is required.
Nucleotide and/or Amino Acid Sequence Disclosures
5. This application contains disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821.
(i) Nucleotide and/or amino acid sequences appearing in the specification (page 9, table 2) are not identified by sequence identifiers in accordance with 37 CFR 1.821(d).
(ii) Nucleotide and/or amino acid sequences appearing in the drawings (Fig. 1) are not identified by sequence identifiers in accordance with 37 CFR 1.821(d). Sequence identifiers for nucleotide and/or amino acid sequences must appear either in the drawings or in the Brief Description of the Drawings. Appropriate correction is required.
Claim Rejections - 35 USC § 102
6. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claim 1 is rejected under 35 U.S.C. 102(a)(1) as being anticipated by Barranco-Medina et al. (US 2018/0127735).
Barranco-Medina et al. teach a messenger RNA nucleic acid molecule comprising sequences selected from the group consisting of SEQ ID NO:1-3 (para 0077, SEQ ID NO. 6 comprising the sequences of the claimed SEQ ID NO: 1-3, see the following sequence alignment of SEQ ID NO: 1-3 showing 100% homology with the sequence in SEQ ID NO:6 of the published application).
For SEQ ID NO: 1
Publication No. US20180127735A1
APPLICANT: Saint Louis University; APPLICANT: Barranco-Medina, Sergio; APPLICANT: Pozzi, Nicola; APPLICANT: Di Cera, Enrico
TITLE OF INVENTION: THROMBIN-THROMBOMODULIN FUSION PROTEINS AS PROTEIN C ACTIVATORS
CURRENT FILING DATE: 2017-10-30; PRIOR APPLICATION NUMBER: US 62/153,742; PRIOR FILING DATE: 2015-04-28; PRIOR APPLICATION NUMBER: PCT/US2016/029768; PRIOR FILING DATE: 2016-04-28; NUMBER OF SEQ ID NOS: 23
SEQ ID NO 6; LENGTH: 360; TYPE: DNA; ORGANISM: Artificial Sequence
Query Match 100.0%; Score 18; Length 360; Best Local Similarity 100.0%; Matches 18; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 AGCTGTGAGTGCCCTGAA 18
||||||||||||||||||
Db 181 AGCTGTGAGTGCCCTGAA 198
For SEQ ID NO: 2
Query Match 100.0%; Score 18; Length 360; Best Local Similarity 100.0%;
Matches 18; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GTCACAGTCGGTGCCAAT 18
||||||||||||||||||
Db 354 GTCACAGTCGGTGCCAAT 337
For SEQ ID NO: 3
Query Match 100.0%; Score 24; Length 360; Best Local Similarity 100.0%;
Matches 24; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 TCCTGGACGACGGTTTCATCTGCA 24
||||||||||||||||||||||||
Db 206 TCCTGGACGACGGTTTCATCTGCA 229
For all the above the claim 1 is anticipated.
Claim Rejections - 35 USC § 103
7. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 1-2 are rejected under 35 U.S.C. 103 as being unpatentable over Barranco-Medina et al. (US 2018/0127735) in view of Lowe et al. (Nucleic acids Research, Vol. 18(7), p. 1757-1760, (1990)).
Barranco-Medina et al. teach a mRNA sequence comprising the sequences of SEQ ID Nos: 1-3 as discussed above in section 6A. Barranco-Medina et al. also teach a kit for detecting target thrombomodulin (para 0071-0074).
However, Barranco-Medina et al. did not teach said sequences as primers and probe.
Lowe et al. teach a method for designing primers and evaluating their performance wherein Lowe et al. disclose a computer program for rapid selection of oligonucleotide primers/probes from a known sequence for polymerase chain reaction, Lowe et al. teach that all primers/probes designed for over 10 gene products were experimentally tested and the results showed that all the amplification products specified by the primers are of the predicted size and also hybridize with the appropriate cDNA or internal oligonucleotide probe (see page 1759-1760, col. 2, paragraph 1, table 1).
It would be prima facie obvious to an ordinary person skilled in the art before the effective filing date of the invention to modify the nucleotide sequence comprising the sequences of SEQ ID Nos: 1-3 as taught by Barranco-Medina et al. et al. with designing a primer/probe from a known sequence as taught by Lowe et al. to develop primer and probe sequences. The ordinary person skilled in the art would have motivated to combine the known nucleic acid sequence as taught by Barranco-Medina et al. with a computer program to generate primer/probe sequence from a known sequence as taught by Lowe et al. and have a reasonable expectation of success that it would result in specific primer and probe sequences because it would be obvious to modify a known sequence as taught by Barranco-Medina et al. with generating primers/probes as Lowe et al. to improve the specificity of primers/probe for amplifying a target sequence. The claimed primers/probe are functional equivalents of the polynucleotide sequence taught by Barranco-Medina et al. in view of Lowe et al. because Lowe et al. explicitly taught that the primers/probe generated from a known sequence using a computer program would specifically amplify the target sequence and all primers designed for over 10 gene products from known sequences were experimentally tested and the results showed that all the amplification products
specified by the primers are of the predicted size also hybridizes with the appropriate cDNA or internal oligonucleotide probe (see page 1760, col. 2, paragraph 1) and such a modification of the known sequences is considered obvious over the prior art. As noted in In re Aller, 105 USPQ 233 at 235, more particularly, where the general conditions of a claim such as oligomer length and sequence, are disclosed in the prior art (Barranco-Medina et al. and Lowe et al.), it is not inventive to discover the optimum or workable ranges by routine experimentation. Routine optimization is not considered inventive and no evidence has been presented that the selection of hybridization conditions performed was other than routine, that the products resulting from the optimization have any unexpected properties, or that the results should be considered unexpected in any way as compared to the closest prior art and such a modification of the sequence is considered obvious over the cited prior art.
Claim Rejections - 35 USC § 101
8. 35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1 and 2 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a judicial exception without significantly more. The claims 1 and 2 recite a nucleic acid sequence and a nucleic acid sequence comprising primers and probes which represent a product, a statutory category. Claims 1 and 2 recite a judicial exception (law of nature) without significantly more because said nucleic acid sequences are considered as a law of nature products, said products exist in nature. This judicial exception is not integrated into a practical application because the judicial exception is not markedly different from law of nature (US 4,912,207; US 2018/0127735; US 2015/0337377). The claim(s) do not include additional elements that are sufficient to amount to significantly more than the judicial exception because the additional elements recited in the claims (kit) do not add significantly more to the claimed product. The additional elements are not themselves natural laws, but neither are they sufficient to transform the nature of the claims because they consist of well-understood, routine, conventional activity already engaged in by the scientific community. The additional elements consist of well-understood, routine, conventional activity already engaged in by the scientific community (US 4,912,207; US 2018/0127735; US 2015/0337377). The additional elements, when viewed as a whole, add nothing significant beyond the sum of their parts taken separately. The Court has made clear that to transform an unpatentable law of nature into a patent-eligible application of such a law, one must do more than simply state the law of nature while adding the words "apply it." Essentially, appending conventional steps specified at a high level of generality, to laws of nature, natural phenomena, and abstract ideas cannot make those laws, phenomena, and ideas patent-eligible. The Court’s decision rested upon an examination of the particular claims in light of the Court's precedents, specifically Bilski, Flook and Diehr. The Court repeated the long- standing exceptions (laws of nature, natural phenomena, and abstract ideas) to categories of patent eligibility defined in 35 U.S.C. § 101. In conducting the analysis, the Court addressed the "machine-or-transformation" test explained in Bilski with a reminder that the test is an "important and useful clue" to patentability but that it does not trump the "law of nature" exclusion. A claim that recites a law of nature or natural correlation, with additional elements/steps that involve well-understood, routine, conventional activity previously engaged in by researchers in the field is not patent-eligible, regardless of whether the steps result in a transformation. On the other hand, reaching back to Neilson, the Court pointed to an eligible process that included not only a law of nature (hot air promotes ignition) but also several unconventional steps involving a blast furnace) that confined the claims to a particular useful application of the principle. For these reasons, the claims are rejected under section 101 as being directed to non-statutory subject matter.
Conclusion
No claims are allowable.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to SURYAPRABHA CHUNDURU whose telephone number is (571)272-0783. The examiner can normally be reached 8.00am-4.30pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Gary Benzion can be reached at 571-272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
Suryaprabha Chunduru
Primary Examiner
Art Unit 1681
/SURYAPRABHA CHUNDURU/Primary Examiner, Art Unit 1681
