DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claims Status
Claims 1-8 are canceled.
Claims 9-13 and 15 are amended.
Claims 9-26 are pending.
Election/Restrictions
Applicant's election with traverse of Group III (Claims 13-14 and 23-25) in the reply filed on 06/12/2026 is acknowledged. The traversal is on the ground(s) that unity of invention does exist between Groups I-VII because there is a technical relationship that involves the same technical feature. Upon further review, the Examiner has rejoined claims 9-16,18, 20-26 and the requirement for the inventive group is WITHDRAWN.
Applicant's election with traverse of Species Group 1: SEQ ID NO: 23 in the reply filed on 06/12/2026 is acknowledged. The traversal is on the ground(s) that there must be a patentable difference between the species and that no reasons or examples have been provided to support a conclusion that the species are patentably distinct (see pg. 3). This is not found persuasive because each of the polynucleotide sequences SEQ ID NO: 1, 21-23 and 26-41 are different and distinct polypeptides with unique nucleotide sequences requiring a search of each sequence using sequence databases.
The requirement for a species elections is still deemed proper and is therefore made FINAL.
Claim 17 and 19 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected species, there being no allowable generic or linking claim. Applicant timely traversed the restriction (election) requirement in the reply filed on06/12/2026.
Information Disclosure Statement
The information disclosure statements (IDS) submitted on 06/13/2024 and 01/08/2026 are acknowledged. The submission is in compliance with the provision of 37 CFR 1.97. Accordingly, the information disclosure statements have been considered.
Claim Objections
Claim 11 objected to because of the following informalities:
Claim 11 recites “A DNA expression cassette comprising “according to a promoter”. The claim either has a grammatical error or the applicant may have meant to delete “according to” in the claim during amendment. Appropriate correction is required.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 9, 10, 11,12, 13, 14, 15, 16, 18, 20-26 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a product of nature without significantly more. The claim(s) recite(s) an expression vector comprising a promoter comprising a nucleotide sequence selected from the group consisting of the following (d) to (f): d) a nucleotide sequence of any of SEQ ID NOs: 23, e) a nucleotide sequence having at least 90% identity with a nucleotide sequence of SEQ ID NO: 23, and a nucleotide sequence having deletion, substitution, addition or insertion of 1 to 20 nucleotides in a nucleotide sequence of SEQ ID NO: 23. This judicial exception is not integrated into a practical application because the additional elements do not contribute any meaningful limitation to the natural product. The claim(s) does/do not include additional elements that are sufficient to amount to significantly more than the judicial exception because claim 9 recites expression vector comprising a promoter comprising a nucleotide sequence selected from the group consisting of the following (d) to (f): d) a nucleotide sequence of any of SEQ ID NOs: 23, e) a nucleotide sequence having at least 90% identity with a nucleotide sequence of SEQ ID NO: 23, and a nucleotide sequence having deletion, substitution, addition or insertion of 1 to 20 nucleotides in a nucleotide sequence of SEQ ID NO: 23. The claims encompass a composition of a polynucleotide that is structurally identical to a natural occurring polynucleotide as evidenced by Nakagawa et al. (European Patent Publication EP1108790B1; published 09/02/2009) who disclose a C. glutamicum coding sequence fragment (SEQ ID NO: 7068), see alignment below:
SQ Sequence 349980 BP; 81250 A; 97718 C; 90621 G; 80391 T; 0 U; 0 Other;
Query Match 100.0%; Score 208; Length 349980;
Best Local Similarity 100.0%;
Matches 208; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GGCCATTTTGGAAAAAAATTTAATAATTTTTTTACGATGAATAAAATTACATTGCCCTTA 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 63317 GGCCATTTTGGAAAAAAATTTAATAATTTTTTTACGATGAATAAAATTACATTGCCCTTA 63258
Qy 61 AAGGTATCTAAATGACACTTATTAAACGGTGTTCAAAAATGGCCCAGTTTTTGACGATGG 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 63257 AAGGTATCTAAATGACACTTATTAAACGGTGTTCAAAAATGGCCCAGTTTTTGACGATGG 63198
Qy 121 GGTTGCGGGCAAGGGGCGTTATGAGCCACACTTGAGTCATCCCAGTCAGACAGCAAGAGT 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 63197 GGTTGCGGGCAAGGGGCGTTATGAGCCACACTTGAGTCATCCCAGTCAGACAGCAAGAGT 63138
Qy 181 CTGGCGAACAACAGAAAGAGAGATCACA 208
||||||||||||||||||||||||||||
Db 63137 CTGGCGAACAACAGAAAGAGAGATCACA 63110
Because there is no difference in characteristics (structural, functional, or otherwise) between the claimed and naturally occurring composition, the claimed composition does not have markedly different characteristics and thus is a product of nature exception. Accordingly, the product is directed to an exception (Step 2A: Yes). Because the claims do not include any additional features that could add significantly more to the exception (Step 2B: NO), the claims do not qualify as eligible subject matter and are rejected.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 10-12,15, 22, 24, and 26 rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
With regards to claims 10, 12, and 24 the claims recite “ a gene encoding a material of interest or an enzyme involved in synthesis of the material”. It is unclear what a material of interest is since a gene produces an RNA that encompasses a mRNA which is translated into a protein that could be an enzyme or a protein of different or undefined function. However, “a material of interest” can be interpreted by someone of ordinary skill in the art of molecular biology to have many different interpretations and varies. One of ordinary skill in the art may interpret the phrase “a material of interest” to also encompass other undefined and unlimited structures with unlimited and undefined biochemical activity. The recitation of “an enzyme involved in the synthesis of the material” is also vague and confusing as one of ordinary skill in the art can interpret an enzyme to synthesize products other than other proteins or enzymes such as small molecules which cannot be encoded by a gene. While functional limitations may be properly introduced into claims, the boundaries imposed by the functional limit must be clearly defined to be definite under 35 U.S.C. 112(b). “Although the claims are examined in the light of the specification, the specification cannot be read into the claims, i.e., the limitation of the specification cannot be read into the claims (see MPEP 211 R-5)”. Clarification and correction is required.
With regards to claim 11, the claim recites “a DNA expression cassette comprising according to a promoter comprising…”. It is unclear what the term “according to” is referring to thus the claim is rendered indefinite.
With regards to claims 15, 22, and 26, the claims recite producing a “material of interest” and collecting “the material of interest from the culture”. It is unclear what a material of interest is because one of ordinary skill in the art of molecular biology can interpret a material of interest in different ways. Culturing of corynebacterium can produce a variety of “materials of interest” such as cells, nucleic acids, proteins, peptides, small molecule compounds, etc. It is therefore unclear and indefinite what the material of interest being produced and collected is. While functional limitations may be properly introduced into claims, the boundaries imposed by the functional limit must be clearly defined to be definite under 35 U.S.C. 112(b). “Although the claims are examined in the light of the specification, the specification cannot be read into the claims, i.e., the limitation of the specification cannot be read into the claims (see MPEP 211 R-5)”. Clarification and correction are required.
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 9-16, 18, and 20-26 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claims 9-16, 18, and 20-26 are directed to encompass a genus of unlimited/undefined structures, i.e., an expression vector comprising a promoter comprising a nucleotide sequence selected from the group consisting of the following (d) to (f): d) a nucleotide sequence of any of SEQ ID NOs: 1, 21-23 and 26-41, e) a nucleotide sequence having at least 90% identity with a nucleotide sequence of any of SEQ ID NOs: 1, 21-23 and 26-41, and f) a nucleotide sequence having deletion, substitution, addition or insertion of 1 to 20 nucleotides in a nucleotide sequence of any of SEQ ID NO. 1, 21 to 23, and 26 6 to 41 (as in claims 9-10); a corynebacterium comprising the expression vector according to claim 9 (as in claims 13-14); a DNA expression cassette comprising a promoter comprising a nucleotide sequence selected from the group consisting of the following (d) to (f): (d) a nucleotide sequence of any of SEQ ID NOs: 1, 21-23, and 26-41, e) a nucleotide sequence having at least 90% identity with a nucleotide sequence of any of SEQ ID NOs: 1,21-23, and 26-41; and f) a nucleotide sequence having deletion, substitution, addition or insertions of 1-20 nucleotides in a nucleotide sequence of any of SEQ ID NOs: 1, 21-23, and 26-41 (as in claims 11-12, 18-19) ; a Corynebacterium comprising the DNA expression cassette of claim 11 (as in claims 20-21 and 23) ; a method for producing a material of interest (as in claim 15, 22, 26).
In University of California V. Eli Lilly & Co., 43 USPQ2d 1938, the Court of Appeals for the Federal Circuit has held that "A written description of an invention involving a chemical genus, like a description of a chemical species, 'requires a precise definition, such as by structure, formula, [or] chemical name,' of the claimed subject matter sufficient to distinguish it from other materials". As indicated in MPEP § 2163, the written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show that Applicant was in possession of the claimed genus. In addition, MPEP § 2163 states that a representative number of species means that the species which are adequately described are representative of the entire genus. Thus, when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus.
In the instant case, there is no structure associated with function with regard to the members of the genus of polynucleotides having promoter activity i.e., an expression vector comprising a promoter comprising a nucleotide sequence selected from the group consisting of the following (d) to (f): d) a nucleotide sequence of any of SEQ ID NOs: 1, 21-23 and 26-41, e) a nucleotide sequence having at least 90% identity with a nucleotide sequence of any of SEQ ID NOs: 1, 21-23 and 26-41, and f) a nucleotide sequence having deletion, substitution, addition or insertion of 1 to 20 nucleotides in a nucleotide sequence of any of SEQ ID NO. 1, 21 to 23, and 26 6 to 41 (as in claims 9-10); a corynebacterium comprising the expression vector according to claim 9 (as in claims 13-14); a DNA expression cassette comprising a promoter comprising a nucleotide sequence selected from the group consisting of the following (d) to (f): (d) a nucleotide sequence of any of SEQ ID NOs: 1, 21-23, and 26-41, e) a nucleotide sequence having at least 90% identity with a nucleotide sequence of any of SEQ ID NOs: 1,21-23, and 26-41; and f) a nucleotide sequence having deletion, substitution, addition or insertions of 1-20 nucleotides in a nucleotide sequence of any of SEQ ID NOs: 1, 21-23, and 26-41 (as in claims 11-12, 18-19) ; a Corynebacterium comprising the DNA expression cassette of claim 11 (as in claims 20-21 and 23) ; a method for producing a material of interest (as in claim 15, 22, 26).
No information beyond characterization of an expression vector comprising a promoter comprising full-length and intact SEQ ID NO: 1, 21-23, 26-41 has been provided by the applicants which would indicate that they had possession of the claimed genus of an expression vector comprising a promoter comprising a nucleotide sequence selected from the group consisting of the following (d) to (f): d) a nucleotide sequence of any of SEQ ID NOs: 1, 21-23 and 26-41, e) a nucleotide sequence having at least 90% identity with a nucleotide sequence of any of SEQ ID NOs: 1, 21-23 and 26-41, and f) a nucleotide sequence having deletion, substitution, addition or insertion of 1 to 20 nucleotides in a nucleotide sequence of any of SEQ ID NO. 1, 21 to 23, and 26 6 to 41 (as in claims 9-10); a corynebacterium comprising the expression vector according to claim 9 (as in claims 13-14); a DNA expression cassette comprising a promoter comprising a nucleotide sequence selected from the group consisting of the following (d) to (f): (d) a nucleotide sequence of any of SEQ ID NOs: 1, 21-23, and 26-41, e) a nucleotide sequence having at least 90% identity with a nucleotide sequence of any of SEQ ID NOs: 1,21-23, and 26-41; and f) a nucleotide sequence having deletion, substitution, addition or insertions of 1-20 nucleotides in a nucleotide sequence of any of SEQ ID NOs: 1, 21-23, and 26-41 (as in claims 11-12, 18-19) ; a Corynebacterium comprising the DNA expression cassette of claim 11 (as in claims 20-21 and 23) ; a method for producing a material of interest (as in claim 15, 22, 26).
The genus of an expression vectors and or DNA expression cassettes comprising a promoter comprising a nucleotide sequence claimed in the invention is an extremely large structurally and functionally variable genus. While the argument can be made that the recited genus of expression vectors and or DNA expression cassettes are adequately described by the disclosure of an expression vector comprising a promoter comprising full-length and intact SEQ ID NO: 1, 21-23, 26-41, since one could use structural homology to isolate those polynucleotides recited in the claims, however, the art clearly teaches that a promoter has discrete spatial and temporal elements “cis-acting” elements that govern the activity of a promoter, as said “cis-acting” elements are specific binding regions that are recognized by specific transcription factors and other accessory proteins known as “trans-acting” factors (cell specific) and any mutation or structural change in the “cis-acting” element can affect/alter/reduce the promoter activity. Applicants are referred to the following teachings in the art: a) Satola et al. (J. Bacteriol. Vol. 174(5), pg. 1448-1453; published 1992), b) Eder et al. (J. Bacteriol, Vol. 18, pg. 2017-2025; published 1999), c) Fischer et al. (Curr. Genet. Vol. 28, pg. 80-86, published 1995), and d) Jeenes et al. (Biotechnol. Genetic Eng. Rev. Vol. 9, pg. 327-367; published 1991).
As stated above, no information beyond the characterization of expression vector comprising a promoter comprising full-length an intact SEQ ID NO: 1, 21-23, 26-41 has been provided by the applicants which would indicate that they had possession of the claimed genus of expression vectors and or DNA expression cassettes comprising a promoter comprising the claimed genus of polynucleotides. As the claimed genera of expression vectors and or DNA expression cassettes comprising a promoter comprising a polynucleotide sequence having widely variable structure and associated function and no additional information (species/variant/mutant) correlating structure with function has been provided. Furthermore, “Possession may not be shown by merely describing how to obtain possession of members of the claimed genus or how to identify their common structural features (See University of Rochester, 358 F.3d at 927, 69 USPQ2d at 1895).
Therefore, one skilled in the art of molecular biology cannot reasonably conclude that the applicant had possession of the claimed invention at the time the instant application was filed.
Claims 9-16, 18, and 20-26 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for an expression vector and or DNA expression cassette comprising a promoter comprising full-length and intact SEQ ID NO: 1, 21-23, 26-41 does not reasonably provide enablement for expression vector comprising a promoter comprising a nucleotide sequence selected from the group consisting of the following (d) to (f): d) a nucleotide sequence of any of SEQ ID NOs: 1, 21-23 and 26-41, e) a nucleotide sequence having at least 90% identity with a nucleotide sequence of any of SEQ ID NOs: 1, 21-23 and 26-41, and f) a nucleotide sequence having deletion, substitution, addition or insertion of 1 to 20 nucleotides in a nucleotide sequence of any of SEQ ID NO. 1, 21 to 23, and 26 6 to 41 (as in claims 9-10); a corynebacterium comprising the expression vector according to claim 9 (as in claims 13-14); a DNA expression cassette comprising a promoter comprising a nucleotide sequence selected from the group consisting of the following (d) to (f): (d) a nucleotide sequence of any of SEQ ID NOs: 1, 21-23, and 26-41, e) a nucleotide sequence having at least 90% identity with a nucleotide sequence of any of SEQ ID NOs: 1,21-23, and 26-41; and f) a nucleotide sequence having deletion, substitution, addition or insertions of 1-20 nucleotides in a nucleotide sequence of any of SEQ ID NOs: 1, 21-23, and 26-41 (as in claims 11-12, 18-19) ; a Corynebacterium comprising the DNA expression cassette of claim 11 (as in claims 20-21 and 23) ; a method for producing a material of interest (as in claim 15, 22, 26) . The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and or use the invention commensurate in scope with these claims.
Factors to be considered in determining whether undue experimentation is required, are summarized in In re Wands (858 F.2d 731, 8 USPQ 2nd 1400 (Fed. Cir. 1988)) as follows: (1) the quantity of experimentation necessary, (2) the amount of direction or guidance presented, (3) the presence or absence of working examples, (4) the nature of the invention, (5) the state of the prior art, (6) the relative skill of those in the art, (7) the predictability or unpredictability of the art, and (8) the breadth of the claim(s).
Claims 9-16, 18, and 20-26 are so broad as to encompass a genus of unlimited/undefined structures , i.e., an expression vector comprising a promoter comprising a nucleotide sequence selected from the group consisting of the following (d) to (f): d) a nucleotide sequence of any of SEQ ID NOs: 1, 21-23 and 26-41, e) a nucleotide sequence having at least 90% identity with a nucleotide sequence of any of SEQ ID NOs: 1, 21-23 and 26-41, and f) a nucleotide sequence having deletion, substitution, addition or insertion of 1 to 20 nucleotides in a nucleotide sequence of any of SEQ ID NO. 1, 21 to 23, and 26 6 to 41 (as in claims 9-10); a corynebacterium comprising the expression vector according to claim 9 (as in claims 13-14); a DNA expression cassette comprising a promoter comprising a nucleotide sequence selected from the group consisting of the following (d) to (f): (d) a nucleotide sequence of any of SEQ ID NOs: 1, 21-23, and 26-41, e) a nucleotide sequence having at least 90% identity with a nucleotide sequence of any of SEQ ID NOs: 1,21-23, and 26-41; and f) a nucleotide sequence having deletion, substitution, addition or insertions of 1-20 nucleotides in a nucleotide sequence of any of SEQ ID NOs: 1, 21-23, and 26-41 (as in claims 11-12, 18-19) ; a Corynebacterium comprising the DNA expression cassette of claim 11 (as in claims 20-21 and 23) ; a method for producing a material of interest (as in claim 15, 22, 26). The scope of the claims is not commensurate with the enablement provided by the disclosure in regard to the extremely large number of expression vectors and or DNA expression cassettes comprising a promoter comprising a nucleotide sequence of undefined structures having promoter activity broadly encompassed by the claims. Additionally, the claimed expression vectors and or DNA expression cassettes comprising a promoter comprising a nucleotide sequence selected from the group consisting of the following (d) to (f): d) a nucleotide sequence of any of SEQ ID NOs: 1, 21-23 and 26-41, e) a nucleotide sequence having at least 90% identity with a nucleotide sequence of any of SEQ ID NOs: 1, 21-23 and 26-41, and f) a nucleotide sequence having deletion, substitution, addition or insertion of 1 to 20 nucleotides in a nucleotide sequence of any of SEQ ID NO. 1, 21 to 23, and 26 6 to 41 (as in claims 9-10) also encompass polynucleotides which may lack defined function. One of ordinary skill in the art of molecular biology would not reasonably expect such expression vectors and or DNA expression cassettes to bus useful as an expression vector comprising a promoter comprising a nucleotide sequence selected from the group consisting of the following (d) to (f): d) a nucleotide sequence of any of SEQ ID NOs: 1, 21-23 and 26-41, e) a nucleotide sequence having at least 90% identity with a nucleotide sequence of any of SEQ ID NOs: 1, 21-23 and 26-41, and f) a nucleotide sequence having deletion, substitution, addition or insertion of 1 to 20 nucleotides in a nucleotide sequence of any of SEQ ID NO. 1, 21 to 23, and 26 6 to 41 (as in claims 9-10); a corynebacterium comprising the expression vector according to claim 9 (as in claims 13-14); a DNA expression cassette comprising a promoter comprising a nucleotide sequence selected from the group consisting of the following (d) to (f): (d) a nucleotide sequence of any of SEQ ID NOs: 1, 21-23, and 26-41, e) a nucleotide sequence having at least 90% identity with a nucleotide sequence of any of SEQ ID NOs: 1,21-23, and 26-41; and f) a nucleotide sequence having deletion, substitution, addition or insertions of 1-20 nucleotides in a nucleotide sequence of any of SEQ ID NOs: 1, 21-23, and 26-41 (as in claims 11-12, 18-19) ; a Corynebacterium comprising the DNA expression cassette of claim 11 (as in claims 20-21 and 23) ; a method for producing a material of interest (as in claim 15, 22, 26).
Since the nucleic acid sequence of a promoter determines its structural and functional properties, predictability which changes can be tolerated in a promoter nucleic acid sequence and obtain the desired activity requires knowledge and guidance to which nucleic acid(s) in the promoter sequence, if any, are tolerant of modification and which are conserved (i.e., expectedly intolerant to modification) and detailed knowledge of the ways in which changes can be tolerated in a promoter nucleic acid sequence and obtain the desired activity requires knowledge and guidance with regard to which nucleic acid(s) in the promoter sequence, if any, are tolerant of modification and which are conserved (i.e. expectedly intolerant to modification), and detailed knowledge of the ways in which the encoded promoter’s structure relates to its function. Furthermore, the art teaches the following regarding complexity of the promoter structure/function relationship for promoter activity; a promoter has discrete spatial and temporal elements “cis-acting elements that govern the activity of a promoter, as said “cis-acting” elements are specific binding regions that are recognized by specific transcription factors and other proteins known as “trans-acting” factors (cell specific) and any mutation or structural change in “cis-acting elements” drastically affect the binding of said specific transcription factors and recruitment of other accessory proteins during gene transcription and consequently affects control of gene expression. See relevant cited art: a) Satola et al. (J. Bacteriol. Vol. 174(5), pg. 1448-1453; published 1992), b) Eder et al. (J. Bacteriol, Vol. 18, pg. 2017-2025; published 1999), c) Fischer et al. (Curr. Genet. Vol. 28, pg. 80-86, published 1995), and d) Jeenes et al. (Biotechnol. Genetic Eng. Rev. Vol. 9, pg. 327-367; published 1991). However, the instant application does not provide guidance regarding the various “cis-acting” elements that are required for optimal promoter activity or any guidance regarding regions of the polynucleotides that can be modified and yet retain optimal promoter activity. In this case, the disclosure is limited to expression vector comprising a promoter comprising full-length and intact SEQ ID NO: 1, 21-23, 26-41. It would require undue experimentation of the skilled artisan in molecular biology to make and use the claimed expression vectors and or DNA expression cassettes. The specification provides no guidance on making of variants and mutants or with regard to other uses as claimed in the instant claims. Additionally, the claimed expression vectors and or DNA expression cassettes comprising a promoter comprising a nucleotide sequence selected from the group consisting of the following (d) to (f): d) a nucleotide sequence of any of SEQ ID NOs: 1, 21-23 and 26-41, e) a nucleotide sequence having at least 90% identity with a nucleotide sequence of any of SEQ ID NOs: 1, 21-23 and 26-41, and f) a nucleotide sequence having deletion, substitution, addition or insertion of 1 to 20 nucleotides in a nucleotide sequence of any of SEQ ID NO. 1, 21 to 23, and 26 6 to 41 (as in claims 9-10) also encompass promoters comprising polynucleotides which may lack defined function. One of ordinary skill in the art of molecular biology would not reasonably expect such expression vectors and or DNA expression cassettes to be useful as an expression vector comprising a promoter comprising a nucleotide sequence selected from the group consisting of the following (d) to (f): d) a nucleotide sequence of any of SEQ ID NOs: 1, 21-23 and 26-41, e) a nucleotide sequence having at least 90% identity with a nucleotide sequence of any of SEQ ID NOs: 1, 21-23 and 26-41, and f) a nucleotide sequence having deletion, substitution, addition or insertion of 1 to 20 nucleotides in a nucleotide sequence of any of SEQ ID NO. 1, 21 to 23, and 26 6 to 41 (as in claims 9-10); a corynebacterium comprising the expression vector according to claim 9 (as in claims 13-14); a DNA expression cassette comprising a promoter comprising a nucleotide sequence selected from the group consisting of the following (d) to (f): (d) a nucleotide sequence of any of SEQ ID NOs: 1, 21-23, and 26-41, e) a nucleotide sequence having at least 90% identity with a nucleotide sequence of any of SEQ ID NOs: 1,21-23, and 26-41; and f) a nucleotide sequence having deletion, substitution, addition or insertions of 1-20 nucleotides in a nucleotide sequence of any of SEQ ID NOs: 1, 21-23, and 26-41 (as in claims 11-12, 18-19) ; a Corynebacterium comprising the DNA expression cassette of claim 11 (as in claims 20-21 and 23) ; a method for producing a material of interest (as in claim 15, 22, 26).
In view of the great breadth of the claims, amount of experimentation required to make and use the claimed expression vectors, DNA expression cassettes, and Corynebacterium cells, the lack of guidance, working examples, and unpredictability of the art in predicting function, the claimed invention would require undue experimentation. As such, the specification fails to teach on of ordinary skill how to use the full scope of the expression vectors and or DNA expression cassettes comprising a promoter comprising a nucleotide sequence as encompassed by the claims.
The specification does not support the broad scope of the claims which encompass a genus of unlimited/undefined structures, i.e., an expression vector comprising a promoter comprising a nucleotide sequence selected from the group consisting of the following (d) to (f): d) a nucleotide sequence of any of SEQ ID NOs: 1, 21-23 and 26-41, e) a nucleotide sequence having at least 90% identity with a nucleotide sequence of any of SEQ ID NOs: 1, 21-23 and 26-41, and f) a nucleotide sequence having deletion, substitution, addition or insertion of 1 to 20 nucleotides in a nucleotide sequence of any of SEQ ID NO. 1, 21 to 23, and 26 6 to 41 (as in claims 9-10); a corynebacterium comprising the expression vector according to claim 9 (as in claims 13-14); a DNA expression cassette comprising a promoter comprising a nucleotide sequence selected from the group consisting of the following (d) to (f): (d) a nucleotide sequence of any of SEQ ID NOs: 1, 21-23, and 26-41, e) a nucleotide sequence having at least 90% identity with a nucleotide sequence of any of SEQ ID NOs: 1,21-23, and 26-41; and f) a nucleotide sequence having deletion, substitution, addition or insertions of 1-20 nucleotides in a nucleotide sequence of any of SEQ ID NOs: 1, 21-23, and 26-41 (as in claims 11-12, 18-19) ; a Corynebacterium comprising the DNA expression cassette of claim 11 (as in claims 20-21 and 23) ; a method for producing a material of interest (as in claim 15, 22, 26) with an expectation of obtaining the desired biological function, i.e., promoter activity.
Thus, the applicants have not provided sufficient guidance to enable one of ordinary skill in the art to make and use the claimed invention in a manner reasonably correlated with the scope of the claim broadly including expression vectors and DNA expression cassettes comprising promoters comprising a nucleotide sequence with an enormous number of modifications. The scope of the claim must bear reasonable correlation with the scope of enablement (In re Fisher, 166 USPQ 19 24 (CCPA 1975)). Without sufficient guidance, determination of expression vectors, DNA expression cassettes, and Corynebacterium cells comprising a promoter comprising a nucleotide sequence having the desired biological function is unpredictable and the experimentation is left to those skilled in the art of molecular biology is unnecessarily and improperly, extensive and undue. See In re Wands 858 F.2d 731, 8 USPQ2nd 1400 (FED Cir. 1998).
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 9-16, 18, 20-26 are rejected under 35 U.S.C. 103 as being unpatentable over Eikmanns et al. (Gene, Vol. 102: pg. 93-98; published 1991), hereinafter referred to as Eikmanns, in view of Nakagawa et al. (European Patent Publication EP1108790B1; published 09/02/2009), hereinafter referred to as Nakagawa.
With regards to claims 9-14 and 16, 18, 20-21 and 23-25, Eikmanns teaches a family of vectors including an expression vector pEKEx1 and promoter probe vectors (pEKpllacZ; pEKplCm) (see Abstract, pg. 93). Eikmanns teaches that the promoter probe vectors pEKpllacZ and pEKplCm were constructed to carry the promoterless lacZ or cat reporter genes (gene encoding material of interest) downstream from useful cloning sties for assaying transcriptional activity of cloned fragments (see Abstract, pg. 93). Eikmanns further teaches that all the shuttle vectors are based on the replication origins of the corynebacterial pBL1 and are able to replicate in Corynebactreium glutamicum (see pg. 93). Eikmanns teaches that in pEKpllacZ unique restriction sites are located in front of the lacZ reporter gene which allow for cloning of chromosomal C. glutamicum DNA for identification of promoter-active sequences (DNA expression cassette) (see pg. 96). Eikmanns further teaches that to increase our knowledge of gene expression and regulation in C. glutamicum, there is interest in isolating promoters for investigation of structures which determine the efficiency of transcription initiation. For this reason, it is necessary to have promoter probe vectors (see pg. 95).
With regards to claims 15, 22, and 26, Eikmanns further teaches that C. glutamicum cells harboring PeKpllacZ or pEKplFCM were cultured on LB plates to produce colonies of cells (see pg. 96). With respect to claims 15, 22 and 26, the examiner is interpreting a material of interest as a cell using broadest reasonable interpretation (see 112b rejection above).
Eikmanns does not specifically teach that the expression vector or probe vector comprises a promoter comprising a nucleotide sequence selected from the group consisting of the following (d) to (f): (d) a nucleotide sequence of any of SEQ ID NOs: 1, 21-23, and 26-41; (e) a nucleotide sequence having at least 90% sequence identity with a nucleotide sequence of any of SEQ ID NO. 1, 21-23 and 26-41; and (f) a nucleotide sequence having deletion, substitution, addition or insertion of 1-20 nucleotides in a nucleotide sequence of any of SEQ ID NOs; 1, 21-23, and 26-41.
However, Nakagawa teaches a C. glutamicum coding sequence fragment (SEQ ID NO: 7068) that comprises a nucleotide sequence having 100% sequence identity with a nucleotide sequence of SEQ ID NO: 23).
Query Match 100.0%; Score 208; Length 349980;
Best Local Similarity 100.0%;
Matches 208; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GGCCATTTTGGAAAAAAATTTAATAATTTTTTTACGATGAATAAAATTACATTGCCCTTA 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 63317 GGCCATTTTGGAAAAAAATTTAATAATTTTTTTACGATGAATAAAATTACATTGCCCTTA 63258
Qy 61 AAGGTATCTAAATGACACTTATTAAACGGTGTTCAAAAATGGCCCAGTTTTTGACGATGG 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 63257 AAGGTATCTAAATGACACTTATTAAACGGTGTTCAAAAATGGCCCAGTTTTTGACGATGG 63198
Qy 121 GGTTGCGGGCAAGGGGCGTTATGAGCCACACTTGAGTCATCCCAGTCAGACAGCAAGAGT 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 63197 GGTTGCGGGCAAGGGGCGTTATGAGCCACACTTGAGTCATCCCAGTCAGACAGCAAGAGT 63138
Qy 181 CTGGCGAACAACAGAAAGAGAGATCACA 208
||||||||||||||||||||||||||||
Db 63137 CTGGCGAACAACAGAAAGAGAGATCACA 63110
It would have been obvious to one of ordinary skill in the art of protein engineering to take the C. glutamicum sequence taught by Nakagawa and inserting it into the probe vectors taught by Eikmanns. One of ordinary skill in the art would be motivated to do so in order to use the test probe vectors taught by Eikmanns to test the promoter activity of the C. glutamicum polynucleotide fragment to search for new promoters. One of ordinary skill in the art of protein engineering would have expectations of success in doing so from the combined teachings of Eikmanns and Nakagawa who provide all the teachings needed to do so.
Therefore, claims 9-16, 18-26 are rejected under 35 U.S.C. 103 as being unpatentable over Eikmanns et al. (Gene, Vol. 102: pg. 93-98; published 1991), hereinafter referred to as Eikmanns, in view of Nakagawa et al. (European Patent Publication EP1108790B1; published 09/02/2009), hereinafter referred to as Nakagawa.
The prior art made of record and not relied upon is considered pertinent to applicant’s disclosure:
Wei et al. “Identification and application of a novel strong constitutive promoter in Corynebacterium glutamicum” Annals of Microbiology, Vol. 68, pg. 375-382; published 2018.
Lee et al. “Development and Characterization of Expression Vectors for Corynebacterium glutamicum” Vol. 24, pg. 70-79; published 2014.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to GEORGE T LOUNTOS whose telephone number is (571)272-0502. The examiner can normally be reached Monday-Friday 8:00 am - 5:00 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Robert Mondesi can be reached at 408-918-7584. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/GEORGE THEMISTOCLIS LOUNTOS/Examiner, Art Unit 1652
/ROBERT B MONDESI/Supervisory Patent Examiner, Art Unit 1652
Prosecution Insights