Prosecution Insights
Last updated: April 19, 2026
Application No. 18/720,375

LODGING RESISTANCE IN ERAGROSTIS TEF

Non-Final OA §103§112
Filed
Jun 14, 2024
Examiner
TAMUKONG, YVETTE BIH
Art Unit
1662
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Donald Danforth Plant Science Center
OA Round
1 (Non-Final)
Grant Probability
Favorable
1-2
OA Rounds
3y 2m
To Grant

Examiner Intelligence

Grants only 0% of cases
0%
Career Allow Rate
0 granted / 0 resolved
-60.0% vs TC avg
Minimal +0% lift
Without
With
+0.0%
Interview Lift
resolved cases with interview
Typical timeline
3y 2m
Avg Prosecution
8 currently pending
Career history
8
Total Applications
across all art units

Statute-Specific Performance

§101
17.4%
-22.6% vs TC avg
§103
47.8%
+7.8% vs TC avg
§102
4.4%
-35.6% vs TC avg
§112
30.4%
-9.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 0 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Priority Statement This present application is a U.S. National Stage Application of International Application No. PCT/US2022/081856, filed December 16, 2022, which claims priority from U.S. Provisional Patent Application No. 63/290,486, filed 12/16/2021. Information Disclosure Statement Initialed and dated copy of Applicant’s information disclosure statement (IDS) filed on 6/14/2024 is attached to the instant Office action. The submission is in compliance with the provisions of 37 C.F.R. § 1.97. Accordingly, the information disclosure statement is being considered by the examiner. Status of the Claims Amendments dated 01/30/2025 are entered. Claims 2-5, 21-32, and 34 are cancelled. Claims 1, 6-20, 33, and 35 are pending. Claims 1, 6-20, 33, and 35 are examined herein. Claim Objections Claims 20 and 33 are objected to under 37 CFR 1.75(c) as being in improper form because a multiple dependent claim should refer to other claims in the alternative only and cannot depend from any other multiple dependent claim. See MPEP § 608.01(n). Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1, 6-20, 33, and 35 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. All dependent claims are included in these rejections unless they contain a limitation that overcomes the deficiencies of the parent claim from which they depend. Claim 1 recites “hormone activities selected from [recited nucleic acid modifications].” This unconventional terminology is different from the art-accepted terminology, and is confusing. Hormone activities are not equitable to nucleic acid modifications thus one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. For purposes of compact prosecution and examination, claims 1 is interpreted to recite the plant cell comprising two or more nucleic acid modifications selected from recited nucleic acid modifications. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claim 1, 6, 10, and 14 are rejected under 35 U.S.C. 103 as being unpatentable over Yamaguchi et al (Scientific Reports, Vol. 6, No. 28366 published 6/22/2016) in view of Cannarozzi et al (BMC Genomics, Vol. 15, No. 581 published 09/07/2014) and VanBuren et al (Nature Communications, Vol. 11, No. 884, 2020). Regarding claim 1, Yamaguchi teaches a genetically modified lodging resistant sorghum plant comprising two or more mutations (i.e., nucleic acid modifications): dw1 (i.e., a nucleic acid modification in a nucleic acid sequence encoding a DW1 protein) and dw3 (i.e., a nucleic acid modification in a nucleic acid sequence encoding a DW3 protein) (Abstract; Results, para 1-2). Yamaguchi teaches that nucleic acid modification in the nucleic acid sequence encoding an DW1 protein and nucleic acid modification in the nucleic acid sequence encoding an DW3 protein showed a synergistic phenotype for improved lodging resistance (i.e., two or more nucleic acid modifications result in synergistic reduction in the height of the plant) (Abstract; Discussion, fourth paragraph). Yamaguchi also teaches “mutations of semi-dwarf1 (sd1) in rice and Reduced height (Rht) in wheat, which encode a GA biosynthesis enzyme and a dominant suppressor protein of GA signal transduction, respectively, have been widely used to improve lodging resistance in these crops, resulting in the success of the “green revolution” and that GA-related mutations have been used for improving lodging resistance in rice, wheat, and barley, demonstrates the importance of decreasing the GA level, or sensitivity to GA, in reducing plant heights” (i.e., modifications result in a reduction in two or more hormone activities wherein lodging resistance negatively correlates with plant height) (Discussion, first paragraph). Yamaguchi does noes not explicitly teach a nucleic acid modification in the Eragrostis tef plant. However, Cannarozzi (entire document; title, abstract, for example) provides the partial genome of Eragrostis tef by using the sorghum genome as a scaffold, and teaches that “it is highly plausible that breeding targets previously identified in other cereal crops will also be valuable breeding targets in tef” (Abstract) and that homologs of rht1 and sd1 have been cloned and sequenced for 31 tef cultivars (page 2, col 1, para 3). VanBuren teaches the entirety of the tef genome and the transcriptome (entire paper). VanBuren teaches the nucleotides sequences of Dw1 and Dw3 homeologs with 100% (i.e., at least 75% or more) sequence identity with the sequences of SEQ ID NO 24, SEQ ID NO 26, SEQ ID NO 30, and SEQ ID NO 32 (data shown for SEQ ID NO 24). ALIGNMENT OF INSTANT APPLICATION SEQ ID NO 24 AND ERAGROSTIS TEF GENOME CHROMOSOME 4A FROM VANBUREN RESULT 1 CP137588s1 LOCUS CP137588s1 12010020 bp DNA linear PLN 04-APR-2024 COMMENT segment of length 12010020: from 1 to 12010020 DEFINITION Eragrostis tef cultivar Dabbi chromosome 4A. ACCESSION CP137588 CM044760 JAMPTX010000000 JAMPTX010000001-JAMPTX010000874 VERSION CP137588.1 DBLINK BioProject: PRJNA841677 BioSample: SAMN28611010 KEYWORDS . SOURCE Eragrostis tef ORGANISM Eragrostis tef Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; PACMAD clade; Chloridoideae; Eragrostideae; Eragrostidinae; Eragrostis. REFERENCE 1 (bases 1 to 32664196) AUTHORS VanBuren,R., Man Wai,C., Wang,X., Pardo,J., Yocca,A.E., Wang,H., Chaluvadi,S.R., Han,G., Bryant,D., Edger,P.P., Messing,J., Sorrells,M.E., Mockler,T.C., Bennetzen,J.L. and Michael,T.P. TITLE Exceptional subgenome stability and functional divergence in the allotetraploid Ethiopian cereal teff JOURNAL Nat Commun 11 (1), 884 (2020) PUBMED 32060277 Query Match 100.0%; Score 2501; Length 12010020; Best Local Similarity 100.0%; Matches 2501; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ATGGCTTCAGCTGGGAGCAGCAGTGGAGGTGCAGGTGGAGGCAGCAGCATCAGGGCGGCG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7976239 ATGGCTTCAGCTGGGAGCAGCAGTGGAGGTGCAGGTGGAGGCAGCAGCATCAGGGCGGCG 7976298 Qy 61 AATGGCGCAGCTGCCATCAGTGCGGCCGCGACGGCAGTAGGCTCAGCCGACGCCAGATTC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7976299 AATGGCGCAGCTGCCATCAGTGCGGCCGCGACGGCAGTAGGCTCAGCCGACGCCAGATTC 7976358 Qy 121 CACTCCCACCCACCACAGCAGGACAGGGTATATACACTACACGACTTCTTGTTCCATGGC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7976359 CACTCCCACCCACCACAGCAGGACAGGGTATATACACTACACGACTTCTTGTTCCATGGC 7976418 Qy 181 GCATGCAATTGCTCATGCTTTAGCTGCAGCTTTTACCCTTCTTGCTTTAGATGTGTGGAT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7976419 GCATGCAATTGCTCATGCTTTAGCTGCAGCTTTTACCCTTCTTGCTTTAGATGTGTGGAT 7976478 Qy 241 GAGTACCAGCAATTTCTAGTAGGCCTTGACGACCTAGATTGTCACAGGCTTTGCGTACTT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7976479 GAGTACCAGCAATTTCTAGTAGGCCTTGACGACCTAGATTGTCACAGGCTTTGCGTACTT 7976538 Qy 301 AGTACGAATGGTACTGCCCAGTGGTGGTTGCAGCTTGCAACCCCGGCATCTTTACCCCCA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7976539 AGTACGAATGGTACTGCCCAGTGGTGGTTGCAGCTTGCAACCCCGGCATCTTTACCCCCA 7976598 Qy 361 ATAATTAGGCTTCAGTACTGTCTGCTTGTTTGCTTCTAGTACTGAATAGTTTGTTCAGCT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7976599 ATAATTAGGCTTCAGTACTGTCTGCTTGTTTGCTTCTAGTACTGAATAGTTTGTTCAGCT 7976658 Qy 421 GAATTTTCCGTTTTGCTGTTGATATTTGATTATTACGCGATTTGCACTCCCTCTATGTTT 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7976659 GAATTTTCCGTTTTGCTGTTGATATTTGATTATTACGCGATTTGCACTCCCTCTATGTTT 7976718 Qy 481 TTCCCCCCGGATCCTAGATGACTGTACTCTTACCATAACACTCGTCCAGAGACCTATATG 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7976719 TTCCCCCCGGATCCTAGATGACTGTACTCTTACCATAACACTCGTCCAGAGACCTATATG 7976778 Qy 541 TTGTGTAACTGTTGATTTGACCTTGCATACACTTCCACACGTCGTGTCAGTTGATGTCAT 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7976779 TTGTGTAACTGTTGATTTGACCTTGCATACACTTCCACACGTCGTGTCAGTTGATGTCAT 7976838 Qy 601 GAGCAAACTAACTATGCTGGGTTGATTCCTTCTTGCATGATGGATCTTTTTCCAAATGAA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7976839 GAGCAAACTAACTATGCTGGGTTGATTCCTTCTTGCATGATGGATCTTTTTCCAAATGAA 7976898 Qy 661 TTTTCAGATTCCTGTAAAATGCTTGGTGGTGTAGCTATTAATGTCAACACATTTCTTATA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7976899 TTTTCAGATTCCTGTAAAATGCTTGGTGGTGTAGCTATTAATGTCAACACATTTCTTATA 7976958 Qy 721 TTCTTAAGTAAAATTGGTTTAGATTAATACTCCAAGGAAATTTCGTTGTTGAACAACTAG 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7976959 TTCTTAAGTAAAATTGGTTTAGATTAATACTCCAAGGAAATTTCGTTGTTGAACAACTAG 7977018 Qy 781 TCATACATTTTTTCCCCTACCAACAGCTATGTACTTGATACTAATATGTGCATCTCTGAT 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7977019 TCATACATTTTTTCCCCTACCAACAGCTATGTACTTGATACTAATATGTGCATCTCTGAT 7977078 Qy 841 CTAAACAGCGGAGTAGATGGGCTGGCTGCTTGTCGGGTCTTTCATGTTTCGGATCTCAGA 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7977079 CTAAACAGCGGAGTAGATGGGCTGGCTGCTTGTCGGGTCTTTCATGTTTCGGATCTCAGA 7977138 Qy 901 AGGGCGGGAAGAGGATTGTTCCTGCCGCACGTACTCCTGATGGGAATGGATCAAGTGCTC 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7977139 AGGGCGGGAAGAGGATTGTTCCTGCCGCACGTACTCCTGATGGGAATGGATCAAGTGCTC 7977198 Qy 961 GTGGAAATGGTCATCAGTCCGGTTCTAATTCAAACCAAAATGTGCCTTTAAATCTGTCTC 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7977199 GTGGAAATGGTCATCAGTCCGGTTCTAATTCAAACCAAAATGTGCCTTTAAATCTGTCTC 7977258 Qy 1021 TTCTGGCTCCACCATCCTCACCGGCATCCTTCTCAAATTCTGCACTTCCTTCAACTGTTC 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7977259 TTCTGGCTCCACCATCCTCACCGGCATCCTTCTCAAATTCTGCACTTCCTTCAACTGTTC 7977318 Qy 1081 AATCGCCTAATAACTTTCTGTCAATCTCAGCAAATTCTCCTGGTGGTCCAACATCTAATA 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7977319 AATCGCCTAATAACTTTCTGTCAATCTCAGCAAATTCTCCTGGTGGTCCAACATCTAATA 7977378 Qy 1141 TGTTTGCTGTTGGGCCATATGCTAATGAACCTCAGCTTGTCTCGCCTCCTGTCTTCTCAA 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7977379 TGTTTGCTGTTGGGCCATATGCTAATGAACCTCAGCTTGTCTCGCCTCCTGTCTTCTCAA 7977438 Qy 1201 CTTACACAACTGAGCCTTCCACAGCACCATTGACCCCTCCACCTGAACTAGCTCATGCAA 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7977439 CTTACACAACTGAGCCTTCCACAGCACCATTGACCCCTCCACCTGAACTAGCTCATGCAA 7977498 Qy 1261 CCACTCCCTCATCTCCAGATGTTCCATACGCTCGGTTTCTTTCTTCTTTTATGGATATCA 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7977499 CCACTCCCTCATCTCCAGATGTTCCATACGCTCGGTTTCTTTCTTCTTTTATGGATATCA 7977558 Qy 1321 AAACTGCTAGTAAGGAGCATAACATGGCTTTCTTATCAACAACATATTCTGGTGGTTCAG 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7977559 AAACTGCTAGTAAGGAGCATAACATGGCTTTCTTATCAACAACATATTCTGGTGGTTCAG 7977618 Qy 1381 GACTCCAGGCATCATACCCTCTTTACCCTGAGAGCCCTTGTAGCAGCCTCATATCACCTG 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7977619 GACTCCAGGCATCATACCCTCTTTACCCTGAGAGCCCTTGTAGCAGCCTCATATCACCTG 7977678 Qy 1441 CTTCTGCTACTCCGAGGACTGGTCTTTCCTCACCAATACCTGAACAAGAGGTCCCTACTG 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7977679 CTTCTGCTACTCCGAGGACTGGTCTTTCCTCACCAATACCTGAACAAGAGGTCCCTACTG 7977738 Qy 1501 CCCATTGGAAGACTTCTAGGTCTGCCTGTGACACACCATATTCCAGGGCTTCACCCATCC 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7977739 CCCATTGGAAGACTTCTAGGTCTGCCTGTGACACACCATATTCCAGGGCTTCACCCATCC 7977798 Qy 1561 CTGAGCAAGAAGCCACTGCGCAGTGGAAGACTTCTAGATCGGCATGTGATACGCCTTATG 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7977799 CTGAGCAAGAAGCCACTGCGCAGTGGAAGACTTCTAGATCGGCATGTGATACGCCTTATG 7977858 Qy 1621 CCAGGGCTTCACCATCAAACATCTTTGGGCTGGACTCATCTGCTTCTAGAAACTATTTGT 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7977859 CCAGGGCTTCACCATCAAACATCTTTGGGCTGGACTCATCTGCTTCTAGAAACTATTTGT 7977918 Qy 1681 TAGATGGCAACTTCTTCCGGCCAGCTGCTTCTGCTCAATTCTACCTGGACCAGGCTCAGC 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7977919 TAGATGGCAACTTCTTCCGGCCAGCTGCTTCTGCTCAATTCTACCTGGACCAGGCTCAGC 7977978 Qy 1741 AGACATATCCATATAATGGTGGGAGGCGTAGTGTCTCACGGGACAAGCAAGATGCAGATG 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7977979 AGACATATCCATATAATGGTGGGAGGCGTAGTGTCTCACGGGACAAGCAAGATGCAGATG 7978038 Qy 1801 AAGTTGAAGCTTACAGAGCTTCGTTTGGCTTTAGTGCAGATGAAATCATGCAAACTCAAT 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7978039 AAGTTGAAGCTTACAGAGCTTCGTTTGGCTTTAGTGCAGATGAAATCATGCAAACTCAAT 7978098 Qy 1861 CTTATGTGGAGATACCAGATGCACTTGATGAATCATTCAGTATATCGCCATTTGGAAATA 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7978099 CTTATGTGGAGATACCAGATGCACTTGATGAATCATTCAGTATATCGCCATTTGGAAATA 7978158 Qy 1921 ATGCTCCTGCTACTGAGGTGTCCCCATTTAATGATCCACCCAACGAGGTTCAGAAGGCTG 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7978159 ATGCTCCTGCTACTGAGGTGTCCCCATTTAATGATCCACCCAACGAGGTTCAGAAGGCTG 7978218 Qy 1981 AGAAGTCAAGTCCAAAGAAAACGGCAGATCAGATTTCCAATGGCTCTCCACATAGAGTGC 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7978219 AGAAGTCAAGTCCAAAGAAAACGGCAGATCAGATTTCCAATGGCTCTCCACATAGAGTGC 7978278 Qy 2041 TGCACATTGACATATTCAAGGGTAAATGTCCATACTTTTTGCACCAACCATTCAGTTGTA 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7978279 TGCACATTGACATATTCAAGGGTAAATGTCCATACTTTTTGCACCAACCATTCAGTTGTA 7978338 Qy 2101 ATCTAGGCATAGTAGAATTACTCTTGTTTATCCTTGCTATCTACTGCACCTAACAAAGCT 2160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7978339 ATCTAGGCATAGTAGAATTACTCTTGTTTATCCTTGCTATCTACTGCACCTAACAAAGCT 7978398 Qy 2161 TTGGTAACTTTCAATGCTAATAACCTGAACTCTGGGCCATTTGTCATCAGCACTTATTGG 2220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7978399 TTGGTAACTTTCAATGCTAATAACCTGAACTCTGGGCCATTTGTCATCAGCACTTATTGG 7978458 Qy 2221 TATTGTGTTTCTATTTATGTAAATGCTTATTATGCTTATGTGCTCGCATTTCAGGAACAA 2280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7978459 TATTGTGTTTCTATTTATGTAAATGCTTATTATGCTTATGTGCTCGCATTTCAGGAACAA 7978518 Qy 2281 AAGGAGGACATCCGTCTGAGTACGAGGGTATTGTGAAAGATGGCCATCCTTTCAGAAAGA 2340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7978519 AAGGAGGACATCCGTCTGAGTACGAGGGTATTGTGAAAGATGGCCATCCTTTCAGAAAGA 7978578 Qy 2341 CAAGGGACGAAATATCTCTAAAACCCATAGAAGTAAGGAAGAAATCTCCACCTGGGCATT 2400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7978579 CAAGGGACGAAATATCTCTAAAACCCATAGAAGTAAGGAAGAAATCTCCACCTGGGCATT 7978638 Qy 2401 CATGCTCAGATGCTGAAATTGAGTACAGAAGGGCAAGGAGTCTGAGGGAAGCCAATGGTG 2460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7978639 CATGCTCAGATGCTGAAATTGAGTACAGAAGGGCAAGGAGTCTGAGGGAAGCCAATGGTG 7978698 Qy 2461 TCCCCTCGTGGCGCAGCACGTTGTCAAGACAGCTGCAGTGA 2501 ||||||||||||||||||||||||||||||||||||||||| Db 7978699 TCCCCTCGTGGCGCAGCACGTTGTCAAGACAGCTGCAGTGA 7978739 The above detailed alignments are generated from the NCBI database. In addition, the Eragrostis tef genome deposited by VanBuren to CoGe (Comparative Genomics) platform in 2018 also teaches the same sequence with 100% (i.e., at least 75% or more) sequence identity to instant SEQ ID NO:26 on chromosome 4B ( see below Table). It is the same with sequences of instant SEQ ID NO:24, instant SEQ ID NO:30, and instant SEQ ID NO:32 and the respective chromosomes (data not shown). PNG media_image1.png 254 1031 media_image1.png Greyscale Therefore, it would have been obvious to one of ordinary skill in the art, before the effective filing date of the claimed invention to combine and modify the teachings of Yamaguchi, Cannarozzi and VanBuren because Yamaguchi teaches that modifications of Dw1 and Dw3 in sorghum lead to the synergistic phenotype of shorter stature. Cannarozzi uses the sorghum genome to align the tef genome and found that around half of the tef genome was contained in the scaffolds that aligned following the requirement that at least three syntenic genes be identified between the two plants (page 3, col 1, para 2). Cannarozzi also teaches that genes previously identified in other cereal crops, including rice and sorghum, will also likely be valuable breeding targets in tef. VanBuren teaches a complete tef genome with chromosomes sorted in sub genomes A and B where the subgenomes are highly syntenic (Abstract; discussion, first paragraph). One would have been motivated to make this combination and modification for the benefit of lodging resistant and higher yield tef. Claim 6 depends from claim 1, with the further limitation that the nucleic acid modification ofSD1 is a nucleic acid modification a nucleic acid sequence encoding an SD1A protein and a nucleic acid modification in a nucleic acid sequence encoding an SD1B protein. Claims 10 and 14 depend from claim 1 with further limitations that both homeologs of DW1 and DW3 in tef be modified, respectively. Claim 10 adds the further limitation that the nucleic acid modification of DW1 is a nucleic acid modification in a nucleic acid sequence encoding an DW1A protein and a nucleic acid modification in a nucleic acid sequence encoding an DW1B protein while claim 14 adds that limitation that the nucleic acid modification of DW3 is a nucleic acid modification in a nucleic acid sequence encoding an DW3A protein and a nucleic acid modification in a nucleic acid sequence encoding an DW3B. Regarding claim 6, Yamaguchi teaches that nucleic acid modification in the nucleic acid sequence encoding an SD1 protein that results in a reduction in GA biosynthesis has been widely used to improve lodging resistance in cereal crops, resulting in the success of the “green revolution” (Discussion, first paragraph). Yamaguchi does not explicitly teach a nucleic acid modification in a nucleic acid sequence encoding an SD1A protein and a nucleic acid modification in a nucleic acid sequence encoding an SD1 B protein. However, Cannarozzi and VanBuren teach that “Tef is an allotetraploid,” a hybrid of two different species and possesses four sets of chromosomes (Cannarozzi, page 8, col 1, para 3; VanBuren, Abstract) and provide the sorted the A and B genomes of Eragrostis tef (Cannarozzi, Abstract; VanBuren, Introduction, last sentence). Therefore, it would have been obvious to one of ordinary skill in the art, before the effective filing date of the claimed invention to modify both copies of SD1, SD1A and SD1B, and both copies of DW1 and DW3 because Cannarozzi and VanBuren teach that tef is a allotetraploid, that two copies of homologous genes should be expected (Cannarozzi, page 8, col 2, para 3; VanBuren, page 8, col 2, para 2) and VanBuren teaches that gene redundancy in tef has stymied efforts to produce semi-dwarf, lodging resistant tef via a mutagenesis approach(VanBuren, page 8, col 2, para 2) . One would have been motivated to modify both copies of SD1 in order to achieve a greater reduction in GA biosynthesis. Regarding claims 10 and 14, it would have been obvious to one of ordinary skill in the art, before the effective filing date of the claimed invention to combine and modify teachings from Yamaguchi, Cannarozzi and VanBuren to cause a nucleic acid modification in both copies of DW1, DW1A and DW1B, and in both copies of DW3 in the tetraploid tef, DW3A and DW3B because Yamaguchi teaches the modification of DW1 and DW3 while Cannarozzi and VanBuren teach the expectation of two homeologs due to the 1:2 synteny between sorghum and allotetraploid tef (Cannarozzi, Figure 3). One would be motivated to do so in order to achieve a DW1 and DW3 synergistic phenotype for improved lodging resistance in in the tetraploid tef as was observed in Yamaguchi’s Sorghum. Claims 7- 9 are rejected under 35 U.S.C. 103 as being unpatentable over Yamaguchi, Cannarozzi, and VanBuren as applied to claim 6 above, and further in view of Jost et al (Journal of Experimental Botany, Vol. 66, No. 3 pp. 933–944,2015, cited in the IDS filed on 6/14/2024). Regarding claim 7, Yamaguchi and Cannarozzi do not explicitly teach the SD1A protein comprises an amino acid sequence comprising at least about 75% or more sequence identity with an amino acid sequence of SEQ ID NO 17; and the SD1B protein comprises an amino acid sequence comprising at least about 75% or more with an amino acid sequence of SEQ ID NO 19, or a combination thereof. VanBuren teaches that an amino acid sequence comprising at least about 75% or more sequence identity with an amino acid sequence of SEQ ID NO 19 ( see annotation below showing 81.25% sequence identity with Accession CP137587.1). PNG media_image2.png 119 1211 media_image2.png Greyscale VanBuren does not explicitly teach that an amino acid sequence comprising at least about 75% or more sequence identity with an amino acid sequence of SEQ ID NO 17 ( see annotation below showing 66.07% sequence identity with Accession CP137586.1). PNG media_image3.png 116 1208 media_image3.png Greyscale However, Jost et al, teaches the use of primers derived from other species to amplify and sequence full CDS of genes in tef (page 935, col 2, para 4;Mutation discovery through the candidate gene approach section, page 938, col 2 para 1). Jost also teaches searching the protein sequence of a gene of interest against the tef genome published by Cannarozzi ( Jost page 938, col 2 para 2). Additionally, Cannarozzi teaches amino acid sequence prediction (page 15, col 2, para 3 , “prediction of coding regions of the transcriptomes”; page 14, col 1, para 2, “Genotyping by Sequencing (GBS) and RNA Seq in harnessing the rich natural variation present in the tef germplasm”). Claim 8 is dependent from claim 6 with the further limitation that tef SD1 homeologs, SD1A and SD1B, are encoded by nucleic acid sequences comprising at least 75% or more sequence identity with SEQ ID NO 18 and SEQ ID NO 20, respectively. Regarding claim 8, Yamaguchi and Cannarozzi do not explicitly teach that the SD1A protein is encoded by a nucleic acid sequence comprising at least about 75% or more, at least about 85% or more, at least about 95% or more, or 100% sequence identity with a nucleic acid sequence of SEQ ID NO 18; and the SD1 B protein is encoded by a nucleic acid sequence comprising at least about 75% or more, at least about 85% or more, at least about 95% or more, or 100% sequence identity with a nucleic acid sequence of SEQ ID NO 20. However, VanBuren teaches the complete tef genome, including subgenomes A and B, as well as RNA seq reads from the plant (Data available on NCBI and CoGe ). PNG media_image4.png 505 542 media_image4.png Greyscale Cannarozzi teaches using the CoGe (comparative genomics) platform to compare tef genomes to other genomes including rice (Abstract; Methods ). Cannarozzi also teaches aligning query sequences of known genes from other plants including rice to the tef genome sequences with the expectation of finding two homeologs (page 10 col 1, para 2). The SD1 gene In the rice genome is in chromosome 1, and CoGe SynMap shows that the rice chromosome 1 is syntenous with the tef chromosome 3 (See the annotation below). The rice SD1 gene used in the green revolution is generally known and has been available on NCBI under the accession number KP212897.1 since 2014. CoGeBlast of KP212897.1 against the tef genome provided by VanBuren matches at multiple locations spanning a 1640 nucleotide region of chromosome 3A and a 2020 nucleotide region of chromosome 3B (see attached below output alignments). ALIGNMENT OF RICE SD1 GENE WITH REGIONS OF ERAGROSTIS TEF GENOME CHROMOSOMES 3A AND 3B FROM VANBUREN BLASTN 2.2.28+ Reference: Stephen F. Altschul, Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402. Database: Eragrostis tef (tef) 878 sequences; 577,738,711 total letters Query= KP212897.1 Oryza sativa Indica Group cultivar IR64-Sub1 putative gibberellin-20 oxidase (Sd-1) gene, complete cds Length=2390 Score E Sequences producing significant alignments: (Bits) Value lcl|3A 460 4e-127 lcl|3B 437 4e-120 > lcl|3A Length=34643735 Score = 460 bits (239), Expect = 4e-127 Identities = 283/305 (93%), Gaps = 0/305 (0%) Strand=Plus/Plus Query 323 GCGAGGAGATGAAGGAGCTGTCGCTGACGATCATGGAACTCCTGGAGCTGAGCCTGGGCG 382 |||||||||||||||||||||| |||||||||||||| || ||||||||||||||||||| Sbjct 31096749 GCGAGGAGATGAAGGAGCTGTCCCTGACGATCATGGAGCTGCTGGAGCTGAGCCTGGGCG 31096808 Query 383 TGGAGCGAGGCTACTATAGGGAGTTCTTCGCGGACAGCAGCTCAATCATGCGGTGCAACT 442 ||||||| |||||||| | || ||||||| ||||||| | || |||||||||||||||| Sbjct 31096809 TGGAGCGCGGCTACTACCGCGACTTCTTCGAGGACAGCCGGTCCATCATGCGGTGCAACT 31096868 Query 443 ACTACCCGCCATGCCCGGAGCCGGAGCGGACGCTCGGCACGGGCCCGCACTGCGACCCCA 502 |||||||||| ||||||||||||||||| ||||| ||||||||||||||||||||||||| Sbjct 31096869 ACTACCCGCCGTGCCCGGAGCCGGAGCGCACGCTGGGCACGGGCCCGCACTGCGACCCCA 31096928 Query 503 CCGCCCTCACCATCCTCCTCCAGGACGACGTCGGCGGCCTCGAGGTCCTCGTCGACGGCG 562 |||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||| Sbjct 31096929 CCGCGCTCACCATCCTCCTCCAGGACGACGTCGGCGGACTCGAGGTCCTCGTCGACGGCG 31096988 Query 563 AATGGCGCCCCGTCAGCCCCGTCCCCGGCGCCATGGTCATCAACATCGGCGACACCTTCA 622 ||||||||||||| | ||||| |||||||||||||||||||||||||||||||| |||| Sbjct 31096989 AATGGCGCCCCGTACGACCCGTGCCCGGCGCCATGGTCATCAACATCGGCGACACGTTCA 31097048 Query 623 TGGTA 627 ||||| Sbjct 31097049 TGGTA 31097053 Score = 317 bits (165), Expect = 3e-84 Identities = 217/243 (89%), Gaps = 0/243 (0%) Strand=Plus/Plus Query 2068 GCAGGCGCTGTCGAACGGGAGGTATAAGAGCTGCCTGCACAGGGCGGTGGTGAACCAGCG 2127 ||||||||||||||||||| |||| ||||||||||||||| | ||||||||||||| ||| Sbjct 31097968 GCAGGCGCTGTCGAACGGGCGGTACAAGAGCTGCCTGCACCGCGCGGTGGTGAACCGGCG 31098027 Query 2128 GCGGGAGCGGCGGTCGCTGGCGTTCTTCCTGTGCCCGCGGGAGGACAGGGTGGTGCGGCC 2187 || |||||||||||||||||| ||||||||||||||||| |||||| | || ||||| || Sbjct 31098028 GCAGGAGCGGCGGTCGCTGGCCTTCTTCCTGTGCCCGCGCGAGGACCGCGTCGTGCGCCC 31098087 Query 2188 GCCGCCGAGCGCCGCCACGCCGCGGCACTACCCGGACTTCACCTGGGCCGACCTCATGCG 2247 |||||| ||||||| ||||||| | ||||||||||||||| ||||||||||||||||| Sbjct 31098088 CCCGCCGGCCGCCGCCGCGCCGCGCCGCTACCCGGACTTCACGTGGGCCGACCTCATGCG 31098147 Query 2248 CTTCACGCAGCGCCACTACCGCGCCGACACCCGCACGCTCGACGCCTTCACGCGCTGGCT 2307 |||||||||| ||||||||||||||||||| ||||| |||||||| ||||| |||||| Sbjct 31098148 CTTCACGCAGAGCCACTACCGCGCCGACACACGCACCCTCGACGCATTCACCAACTGGCT 31098207 Query 2308 CGC 2310 ||| Sbjct 31098208 CGC 31098210 Score = 179 bits (93), Expect = 1e-42 Identities = 152/179 (85%), Gaps = 3/179 (2%) Strand=Plus/Plus Query 145 CAAGATCCCGGAGCCATTCGTGTGGCCGAACGGCGACGCGAGGCCGGCGTCGGCGGCGGA 204 ||||||||| | ||| |||||||||||| | | |||| || | ||| |||||||||||| Sbjct 31096105 CAAGATCCCCGCGCCGTTCGTGTGGCCGCAGGACGACTCGCGCCCGACGTCGGCGGCGGC 31096164 Query 205 GCTGGACATGCCCGTGGTCGACGTGGGCGTGCTCCGC---GACGGCGACGCCGAGGGGCT 261 ||||||| | |||||||| |||||||||||||||||| | ||||||||||| ||||| Sbjct 31096165 GCTGGACGTCCCCGTGGTGGACGTGGGCGTGCTCCGCAATGGCGGCGACGCCGCCGGGCT 31096224 Query 262 GCGCCGCGCCGCGGCGCAGGTGGCCGCCGCGTGCGCCACGCACGGGTTCTTCCAGGTGT 320 ||| ||||| |||||||||||||| | |||||||| |||||||| ||||||||||||| Sbjct 31096225 GCGGCGCGCGGCGGCGCAGGTGGCGTCGGCGTGCGCGACGCACGGCTTCTTCCAGGTGT 31096283 Score = 58.4 bits (30), Expect = 4e-06 Identities = 72/93 (77%), Gaps = 0/93 (0%) Strand=Plus/Plus Query 438 CAACTACTACCCGCCATGCCCGGAGCCGGAGCGGACGCTCGGCACGGGCCCGCACTGCGA 497 |||||||||||||| |||||| ||||||| | |||||||| |||||||| ||| Sbjct 29046623 CAACTACTACCCGCGCTGCCCGCAGCCGGACCTCACGCTCGGACTCTCCCCGCACTCCGA 29046682 Query 498 CCCCACCGCCCTCACCATCCTCCTCCAGGACGA 530 ||| || ||||||| | ||||||| ||||| Sbjct 29046683 CCCGGGCGTCCTCACCGTGCTCCTCCCCGACGA 29046715 > lcl|3B Length=32575812 Score = 437 bits (227), Expect = 4e-120 Identities = 279/305 (91%), Gaps = 0/305 (0%) Strand=Plus/Plus Query 323 GCGAGGAGATGAAGGAGCTGTCGCTGACGATCATGGAACTCCTGGAGCTGAGCCTGGGCG 382 |||||||||||||||| ||||| |||||||||||||| || || |||||||||||||||| Sbjct 29293302 GCGAGGAGATGAAGGACCTGTCCCTGACGATCATGGAGCTGCTTGAGCTGAGCCTGGGCG 29293361 Query 383 TGGAGCGAGGCTACTATAGGGAGTTCTTCGCGGACAGCAGCTCAATCATGCGGTGCAACT 442 ||||||| |||||||| | || ||||||| ||||||| | || |||||||||||||||| Sbjct 29293362 TGGAGCGCGGCTACTACCGCGACTTCTTCGAGGACAGCCGGTCCATCATGCGGTGCAACT 29293421 Query 443 ACTACCCGCCATGCCCGGAGCCGGAGCGGACGCTCGGCACGGGCCCGCACTGCGACCCCA 502 |||||||||| ||||||||||||||||| ||||| ||||||||||||||||||||||||| Sbjct 29293422 ACTACCCGCCGTGCCCGGAGCCGGAGCGCACGCTGGGCACGGGCCCGCACTGCGACCCCA 29293481 Query 503 CCGCCCTCACCATCCTCCTCCAGGACGACGTCGGCGGCCTCGAGGTCCTCGTCGACGGCG 562 | || ||||||||||| |||||||||||||||||||| |||||||||||||||||||| | Sbjct 29293482 CGGCGCTCACCATCCTGCTCCAGGACGACGTCGGCGGACTCGAGGTCCTCGTCGACGGGG 29293541 Query 563 AATGGCGCCCCGTCAGCCCCGTCCCCGGCGCCATGGTCATCAACATCGGCGACACCTTCA 622 |||||||||||||| ||||||| ||||| |||||||||||||||||||||||||| |||| Sbjct 29293542 AATGGCGCCCCGTCCGCCCCGTGCCCGGAGCCATGGTCATCAACATCGGCGACACGTTCA 29293601 Query 623 TGGTA 627 ||||| Sbjct 29293602 TGGTA 29293606 Score = 304 bits (158), Expect = 3e-80 Identities = 214/242 (88%), Gaps = 0/242 (0%) Strand=Plus/Plus Query 2069 CAGGCGCTGTCGAACGGGAGGTATAAGAGCTGCCTGCACAGGGCGGTGGTGAACCAGCGG 2128 ||||||||||| |||||| |||| ||||||||||||||| | ||||||||||||| |||| Sbjct 29294493 CAGGCGCTGTCCAACGGGCGGTACAAGAGCTGCCTGCACCGCGCGGTGGTGAACCGGCGG 29294552 Query 2129 CGGGAGCGGCGGTCGCTGGCGTTCTTCCTGTGCCCGCGGGAGGACAGGGTGGTGCGGCCG 2188 | |||||||||||||||||| ||||||||||||||||| |||||| | || ||||| ||| Sbjct 29294553 CAGGAGCGGCGGTCGCTGGCCTTCTTCCTGTGCCCGCGCGAGGACCGCGTCGTGCGCCCG 29294612 Query 2189 CCGCCGAGCGCCGCCACGCCGCGGCACTACCCGGACTTCACCTGGGCCGACCTCATGCGC 2248 ||| | | || |||| ||||||| | ||||||||||||||| ||||||||| |||||||| Sbjct 29294613 CCGACCACCGTCGCCGCGCCGCGCCGCTACCCGGACTTCACGTGGGCCGACTTCATGCGC 29294672 Query 2249 TTCACGCAGCGCCACTACCGCGCCGACACCCGCACGCTCGACGCCTTCACGCGCTGGCTC 2308 ||||||||| ||||||||||||||||||| ||||| |||||||||||||| ||||||| Sbjct 29294673 TTCACGCAGAGCCACTACCGCGCCGACACACGCACCCTCGACGCCTTCACCACCTGGCTC 29294732 Query 2309 GC 2310 || Sbjct 29294733 GC 29294734 Score = 166 bits (86), Expect = 1e-38 Identities = 149/178 (84%), Gaps = 3/178 (2%) Strand=Plus/Plus Query 145 CAAGATCCCGGAGCCATTCGTGTGGCCGAACGGCGACGCGAGGCCGGCGTCGGCGGCGGA 204 ||||||||| | ||| |||||||||||| | |||| || ||||| |||||||||||| Sbjct 29292714 CAAGATCCCCGCGCCGTTCGTGTGGCCGCCGGACGACTCGCGGCCGACGTCGGCGGCGGC 29292773 Query 205 GCTGGACATGCCCGTGGTCGACGTGGGCGTGCTCCGC---GACGGCGACGCCGAGGGGCT 261 ||||||| | |||||||| |||||||||||||| ||| | ||||||| ||| ||||| Sbjct 29292774 GCTGGACGTCCCCGTGGTGGACGTGGGCGTGCTGCGCAATGGCGGCGACCCCGCCGGGCT 29292833 Query 262 GCGCCGCGCCGCGGCGCAGGTGGCCGCCGCGTGCGCCACGCACGGGTTCTTCCAGGTG 319 ||| ||||| |||||||||||||| | |||||||| |||||||| |||||||||||| Sbjct 29292834 GCGGCGCGCGGCGGCGCAGGTGGCGTCGGCGTGCGCGACGCACGGCTTCTTCCAGGTG 29292891 These sequences from tef chromosomes 3A and 3B, share 100% sequence identity and 100% ID of SEQ ID NO 18 (i.e., SD1A) and SEQ ID NO 20 (i.e., SD1B), respectively (see annotation below). BLAST ALIGNMENT OF INSTANT APPLICATION SEQ ID NO 18 AND RICE SD1 ALIGNING REGION OF ERAGROSTIS TEF GENOME CHROMOSOME 3A FROM VANBUREN PNG media_image5.png 97 812 media_image5.png Greyscale BLAST ALIGNMENT OF INSTANT APPLICATION SEQ ID NO 20 AND RICE SD1 ALIGNING REGION OF ERAGROSTIS TEF GENOME CHROMOSOME 3B FROM VANBUREN PNG media_image6.png 95 807 media_image6.png Greyscale Claim 9 is dependent from claim 6 with the further limitation that nucleic acid modification in the nucleic acid sequence encoding an SD1A and SD1B protein comprise at least 75% or more sequence identity with SEQ ID NO 21 and SEQ ID NO 22, respectively. Regarding claim 9, Yamaguchi and Cannarozzi teach nucleic acid modification in the nucleic acid sequence encoding an SD1 protein. Yamaguchi specifically teaches a nucleic acid modification within a coding region that causes a premature stop codon. Yamaguchi and Cannarozzi do not explicitly teach sequences that comprise at least 75% or more sequence identity with SEQ ID NO 21 and with SEQ ID NO 22. VanBuren teaches sequences comprising at least 75% or more sequence identity with SEQ ID NO 21 and with SEQ ID NO 22 (see the below alignment of SEQ ID NO 21 with Accession CP137586.3 for instance). ALIGNMENT OF INSTANT APPLICATION SEQ ID NO 21 AND ERAGROSTIS TEF GENOME CHROMOSOME 3A FROM VANBUREN RESULT 1 CP137586s3 LOCUS CP137586s3 10643735 bp DNA linear PLN 04-APR-2024 COMMENT segment of length 10643735: from 24000001 to 34643735 DEFINITION Eragrostis tef cultivar Dabbi chromosome 3A. ACCESSION CP137586 CM044758 JAMPTX010000000 JAMPTX010000001-JAMPTX010000874 VERSION CP137586.1 DBLINK BioProject: PRJNA841677 BioSample: SAMN28611010 KEYWORDS . SOURCE Eragrostis tef ORGANISM Eragrostis tef Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; PACMAD clade; Chloridoideae; Eragrostideae; Eragrostidinae; Eragrostis. REFERENCE 1 (bases 1 to 34643735) AUTHORS VanBuren,R., Man Wai,C., Wang,X., Pardo,J., Yocca,A.E., Wang,H., Chaluvadi,S.R., Han,G., Bryant,D., Edger,P.P., Messing,J., Sorrells,M.E., Mockler,T.C., Bennetzen,J.L. and Michael,T.P. TITLE Exceptional subgenome stability and functional divergence in the allotetraploid Ethiopian cereal teff JOURNAL Nat Commun 11 (1), 884 (2020) PUBMED 32060277 Query Match 98.4%; Score 2324.6; Length 10643735; Best Local Similarity 99.5%; Matches 2353; Conservative 0; Mismatches 9; Indels 3; Gaps 2; Qy 1 ATGGCGTCCCCTGTGGCAGGCCCCACAGGGTTGCCTTTGTCGTTGCTTGCCCCTCTCCTC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7095875 ATGGCGTCCCCTGTGGCAGGCCCCACAGGGTTGCCTTTGTCGTTGCTTGCCCCTCTCCTC 7095934 Qy 61 TGTTACAAATACCCCACCGGTCCGGACAGGTCCCCTGCACACTCACCCCTCGCACATCTC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7095935 TGTTACAAATACCCCACCGGTCCGGACAGGTCCCCTGCACACTCACCCCTCGCACATCTC 7095994 Qy 121 ATGGTGTCCCAAGCACGGCAAGAGCCTCGCAACAGCGGCATCTCGAAGCTCGTCATGGAC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7095995 ATGGTGTCCCAAGCACGGCAAGAGCCTCGCAACAGCGGCATCTCGAAGCTCGTCATGGAC 7096054 Qy 181 GCCATCCCGGCCCCTCCTCTCCTGCTCCGCTCTCCAGCTCCCGGCATTGACAAGATCCCC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7096055 GCCATCCCGGCCCCTCCTCTCCTGCTCCGCTCTCCAGCTCCCGGCATTGACAAGATCCCC 7096114 Qy 241 CAAGATCCCCTGTGGCCGCAGGACGACTCGCGCCCGACGTCGGCGGCGGCGCTGGACGTC 300 | |||||||||||||||||||||||||||||||||||||||||||||||||| Db 7096115 GCGCCGTTCGTGTGGCCGCAGGACGACTCGCGCCCGACGTCGGCGGCGGCGCTGGACGTC 7096174 Qy 301 CCCGTGGTGGACGTGGGCGTGCTCCGCAATGGCGGCGACGCCGCCGGGCTGCGGCGCGCG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7096175 CCCGTGGTGGACGTGGGCGTGCTCCGCAATGGCGGCGACGCCGCCGGGCTGCGGCGCGCG 7096234 Qy 361 GCGGCGCAGGTGGCGTCGGCGTGCGCGACGCACGGCTTCTTCCAGGTGTGCGGGCACGGC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7096235 GCGGCGCAGGTGGCGTCGGCGTGCGCGACGCACGGCTTCTTCCAGGTGTGCGGGCACGGC 7096294 Qy 421 GTGGACGCGGCCCTGGCGCGCGCCGCGCTGGACGGCGCATCCGACTTCTTCCGGCTGCCG 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7096295 GTGGACGCGGCCCTGGCGCGCGCCGCGCTGGACGGCGCATCCGACTTCTTCCGGCTGCCG 7096354 Qy 481 CTGGCCGAGAAGCAGCGCGCCCGGCGCGTGCCAGGCACCGTGTCCGGGTACACGAGCGCG 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7096355 CTGGCCGAGAAGCAGCGCGCCCGGCGCGTGCCAGGCACCGTGTCCGGGTACACGAGCGCG 7096414 Qy 541 CACGCCGACCGGTTCGCGTGCAAGCTGCCCTGGAAGGAGACGCTGTCCTTCCGCTTCCAC 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7096415 CACGCCGACCGGTTCGCGTGCAAGCTGCCCTGGAAGGAGACGCTGTCCTTCCGCTTCCAC 7096474 Qy 601 GACGCCGGCGCCGCGTCGCCCGTGGTCGCCGACTACTTCACCAGCACCCTCGGCCCGGAC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7096475 GACGCCGGCGCCGCGTCGCCCGTGGTCGCCGACTACTTCACCAGCACCCTCGGCCCGGAC 7096534 Qy 661 TTCGA--CAATGGGGTACGTAACCAACCACGTTGACTGGTTTAATTAATTACTGCATATA 718 ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7096535 TTCGAGCCAATGGGGTACGTAACCAACCACGTTGACTGGTTTAATTAATTACTGCATATA 7096594 Qy 719 TAGTATCCATCATCTCCATGGATATATATATATATATATATATATATATATATATATATA 778 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7096595 TAGTATCCATCATCTCCATGGATATATATATATATATATATATATATATATATATATATA 7096654 Qy 779 TATATATATATATATATCTTGGCATTGCATCATTGGACACGTACACACGGACGGCTGAAA 838 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7096655 TATATATATATATATATCTTGGCATTGCATCATTGGACACGTACACACGGACGGCTGAAA 7096714 Qy 839 AAACTATATGGCAGGCGCGTGTACCAGAGGTACTGCGAGGAGATGAAGGAGCTGTCCCTG 898 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7096715 AAACTATATGGCAGGCGCGTGTACCAGAGGTACTGCGAGGAGATGAAGGAGCTGTCCCTG 7096774 Qy 899 ACGATCATGGAGCTGCTGGAGCTGAGCCTGGGCGTGGAGCGCGGCTACTACCGCGACTTC 958 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7096775 ACGATCATGGAGCTGCTGGAGCTGAGCCTGGGCGTGGAGCGCGGCTACTACCGCGACTTC 7096834 Qy 959 TTCGAGGACAAGCCGGTCCATCATGCGGTGCAACTACTACCCGCCGTGCCCGGAGCCGGA 1018 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Db 7096835 TTCGAGGAC-AGCCGGTCCATCATGCGGTGCAACTACTACCCGCCGTGCCCGGAGCCGGA 7096893 Qy 1019 GCGCACGCTGGGCACGGGCCCGCACTGCGACCCCACCGCGCTCACCATCCTCCTCCAGGA 1078 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7096894 GCGCACGCTGGGCACGGGCCCGCACTGCGACCCCACCGCGCTCACCATCCTCCTCCAGGA 7096953 Qy 1079 CGACGTCGGCGGACTCGAGGTCCTCGTCGACGGCGAATGGCGCCCCGTACGACCCGTGCC 1138 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7096954 CGACGTCGGCGGACTCGAGGTCCTCGTCGACGGCGAATGGCGCCCCGTACGACCCGTGCC 7097013 Qy 1139 CGGCGCCATGGTCATCAACATCGGCGACACGTTCATGGTATGGTATTGTATTACTCTGCT 1198 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7097014 CGGCGCCATGGTCATCAACATCGGCGACACGTTCATGGTATGGTATTGTATTACTCTGCT 7097073 Qy 1199 GCTCTTGGCTGCCTGCTTGCTTGTCCTGCCCCTGTTTCTCCTCCTAATGGAAGTGATTGG 1258 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7097074 GCTCTTGGCTGCCTGCTTGCTTGTCCTGCCCCTGTTTCTCCTCCTAATGGAAGTGATTGG 7097133 Qy 1259 ACAGTCGCAGATTACACACACTCACACGTAGCTGCCTAGGCGTGTCATGTTGCGCAATGT 1318 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7097134 ACAGTCGCAGATTACACACACTCACACGTAGCTGCCTAGGCGTGTCATGTTGCGCAATGT 7097193 Qy 1319 AGACATGCGTTCGAGTTGGTTCCATCTCGATCGGTGGGCTAGCTCGGTAGTACAGGTCTA 1378 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7097194 AGACATGCGTTCGAGTTGGTTCCATCTCGATCGGTGGGCTAGCTCGGTAGTACAGGTCTA 7097253 Qy 1379 TCAATCGGTGGTGGCGAACGGCGAGCCGCCTTGATGATTTCGCCAAAGAAAAAAAAGAAA 1438 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7097254 TCAATCGGTGGTGGCGAACGGCGAGCCGCCTTGATGATTTCGCCAAAGAAAAAAAAGAAA 7097313 Qy 1439 GAAAGAGAGAGGTTGCGATGCAGTAGGAGGACAAAGAGAGAGAGAGAGAGAGAGAGAGAG 1498 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7097314 GAAAGAGAGAGGTTGCGATGCAGTAGGAGGACAAAGAGAGAGAGAGAGAGAGAGAGAGAG 7097373 Qy 1499 AGAGAAGAGGTTGGCTTCCGCCGTTGGCGGCTTGCGAGTTGTAGAGGAGTGGGGGAGGCC 1558 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7097374 AGAGAAGAGGTTGGCTTCCGCCGTTGGCGGCTTGCGAGTTGTAGAGGAGTGGGGGAGGCC 7097433 Qy 1559 CGGAGGAGGAGGGGGAGGATACGATGCCGCGAGCGGTGGCGCTTTCGCCGGGTGGACCCA 1618 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7097434 CGGAGGAGGAGGGGGAGGATACGATGCCGCGAGCGGTGGCGCTTTCGCCGGGTGGACCCA 7097493 Qy 1619 AGCCCAGGTGCGCGCGCTCGTCGTCTTCCCTGTTTTGGGGCCGTCCGGGTCGGTGGGGCC 1678 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7097494 AGCCCAGGTGCGCGCGCTCGTCGTCTTCCCTGTTTTGGGGCCGTCCGGGTCGGTGGGGCC 7097553 Qy 1679 ATCTCATCTCATCCCGCGGCGTGACTGACTGTGCGCTGCACGGGCCGCCGCGCTGGATCA 1738 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7097554 ATCTCATCTCATCCCGCGGCGTGACTGACTGTGCGCTGCACGGGCCGCCGCGCTGGATCA 7097613 Qy 1739 TACATGGGCTTGGCGTTACCACTGGCAGCTTCTACTTGGCTGTCGCTCGTCGGCTTCTAG 1798 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7097614 TACATGGGCTTGGCGTTACCACTGGCAGCTTCTACTTGGCTGTCGCTCGTCGGCTTCTAG 7097673 Qy 1799 CCGTTTCCACGGCGTTTGTCGCGGTTTTCCGGTGCACGCGGCGCCCGCCTCCAGCTCGGC 1858 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7097674 CCGTTTCCACGGCGTTTGTCGCGGTTTTCCGGTGCACGCGGCGCCCGCCTCCAGCTCGGC 7097733 Qy 1859 CGTGCGGGTGGCACGACACCATCACCCCGTCACCCGACTCACCCGTGCGTGCGGCTTGGC 1918 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7097734 CGTGCGGGTGGCACGACACCATCACCCCGTCACCCGACTCACCCGTGCGTGCGGCTTGGC 7097793 Qy 1919 TCCGCCACGCGGGCCGAAAACAAAAGGGTTCCTGTGCCTTGACAGGTCGTCACGTGTTGT 1978 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7097794 TCCGCCACGCGGGCCGAAAACAAAAGGGTTCCTGTGCCTTGACAGGTCGTCACGTGTTGT 7097853 Qy 1979 GTTGTGCAAAAGAACTCCGGATTGAGCTAATTGTTGTTTCGCTCACTGTTGATTGCGCCG 2038 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7097854 GTTGTGCAAAAGAACTCCGGATTGAGCTAATTGTTGTTTCGCTCACTGTTGATTGCGCCG 7097913 Qy 2039 CCGATCGCCGGCAGCATCTCTGACTTCAGCAACTGACTCCTCTGCTGGTTGAACGCAGGC 2098 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7097914 CCGATCGCCGGCAGCATCTCTGACTTCAGCAACTGACTCCTCTGCTGGTTGAACGCAGGC 7097973 Qy 2099 GCTGTCGAACGGGCGGTACAAGAGCTGCCTGCACCGCGCGGTGGTGAACCGGCGGCAGGA 2158 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7097974 GCTGTCGAACGGGCGGTACAAGAGCTGCCTGCACCGCGCGGTGGTGAACCGGCGGCAGGA 7098033 Qy 2159 GCGGCGGTCGCTGGCCTTCTTCCTGTGCCCGCGCGAGGACCGCGTCGTGCGCCCCCCGCC 2218 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7098034 GCGGCGGTCGCTGGCCTTCTTCCTGTGCCCGCGCGAGGACCGCGTCGTGCGCCCCCCGCC 7098093 Qy 2219 GGCCGCCGCCGCGCCGCGCCGCTACCCGGACTTCACGTGGGCCGACCTCATGCGCTTCAC 2278 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7098094 GGCCGCCGCCGCGCCGCGCCGCTACCCGGACTTCACGTGGGCCGACCTCATGCGCTTCAC 7098153 Qy 2279 GCAGAGCCACTACCGCGCCGACACACGCACCCTCGACGCATTCACCAACTGGCTCGCCCG 2338 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7098154 GCAGAGCCACTACCGCGCCGACACACGCACCCTCGACGCATTCACCAACTGGCTCGCCCG 7098213 Qy 2339 CGGCCCGGCCCAGCAGCAGGCGTAG 2363 ||||||||||||||||||||||||| Db 7098214 CGGCCCGGCCCAGCAGCAGGCGTAG 7098238 Jost teaches a nucleic acid modification in a nucleic acid sequence encoding an α-Tubulin (TUA1) such that the genetically modified plant or "the mutant, named kegne, is the first semi-dwarf tef line and [able] overcome lodging, the major yield constraint in tef"(page 940, col 1, para 2). Therefore, it would have been obvious to one of ordinary skill in the art, before the effective filing date of the claimed invention to combine and modify the teachings from Yamaguchi, Cannarozzi, VanBuren, and Jost, specifically in the context of genes associated with plant architecture traits like SD1 because Cannarozzi and Yamaguchi point to SD1 as a well-known plant height related gene, Cannarozzi and Jost teach identification of known target genes from other plants to identify breeding targets in tef, VanBuren provides a complete sorted genome with subgenomes A and B, Jost teaches nucleic acid modification of a sequence encoding a plant height-regulating gene (TUA1), and Yamaguchi teaches nucleic acid modification of a sequence encoding a plant height-regulating gene that induces a premature stop codon (page 7, para 2). One would be motivated to do so in order to first identify if tef carried the SD1 gene and then confer the agriculturally beneficial semi-dwarf and lodging resistant phenotype associated with nucleic acid modifications in SD1 on to tef, “a high protein content” “low risk crop” that can serve as an “alternative food for people suffering from coeliac disease” due to the absence of gluten (Jost et al, Introduction, paragraph 1). Claims 11-13 are rejected under 35 U.S.C. 103 as being unpatentable over Yamaguchi, Cannarozzi, and VanBuren as applied to claim 10 above. Claim 11 is dependent from claim 10 with the further limitation that DW1A and DW1B proteins comprise amino acid sequences comprising at least 75% or more sequence identity with SEQ ID NO 23 and SEQ ID NO 25, respectively. Claim 12 is dependent from claim 11 with the further limitation that DW1A and DW1B proteins are encoded by nucleic acid sequences comprising at least 75% or more sequence identity with SEQ ID NO 24 and SEQ ID NO 26, respectively. Claim 13 is also dependent from claim 10 with the further limitation that nucleic acid modification in the nucleic acid sequences encoding an DW1A and DW1B proteins comprise at least 75% or more sequence identity with SEQ ID NO 27 and SEQ ID NO 28, respectively. Regarding claim 11, Yamaguchi teaches that DW1 has a function in regulating plant height in rice and sorghum and other gramineous plants while Cannarozzi teaches that breeding targets from other plants can inform breeding targets in tef and that two copies of the target should be expected. Yamaguchi and Cannarozzi do not explicitly teach sequences that comprise at least 75% or more sequence identity with SEQ ID NO 23 and SEQ ID NO 25. VanBuren teaches an amino acid sequence comprising at least about 75% or more sequence identity with an amino acid sequence of SEQ ID NO 23 ( see annotation below showing 90.89% sequence identity with Accession CP137588.1). PNG media_image7.png 120 1212 media_image7.png Greyscale VanBuren also teaches an amino acid sequence comprising at least about 75% or more sequence identity with an amino acid sequence of SEQ ID NO 25 ( see annotation below showing 90.89% sequence identity with Accession CP137589.1). PNG media_image8.png 119 1218 media_image8.png Greyscale Regarding claim 12 Yamaguchi and Cannarozzi do not explicitly teach sequences that comprise at least 75% or more sequence identity with SEQ ID NO 24 and SEQ ID NO 26. VanBuren teaches a nucleic acid sequence comprising at least about 75% or more sequence identity with the sequence of SEQ ID NO 24 (See the alignment provided above when discussing Claim 1). VanBuren also teaches a nucleic acid sequence comprising at least about 75% or more sequence identity with the sequence of SEQ ID NO 26 (Data not shown). Regarding claim 13 Yamaguchi teaches nucleic acid modification within in the Dw1 coding region in sorghum. Yamaguchi and Cannarozzi do not explicitly teach sequences that comprise at least 75% or more sequence identity with SEQ ID NO 27 and SEQ ID NO 28. VanBuren teaches a nucleic acid sequence comprising at least about 75% or more sequence identity with the sequence of SEQ ID NO 27 and at least about 75% or more sequence identity with the sequence of SEQ ID NO 28 (see the below alignment of SEQ ID NO 27 with Accession CP137588.1 for instance). ALIGNMENT OF INSTANT APPLICATION SEQ ID NO 27 AND ERAGROSTIS TEF GENOME CHROMOSOME 4A FROM VANBUREN RESULT 1 CP137588s1 LOCUS CP137588s1 12010020 bp DNA linear PLN 04-APR-2024 COMMENT segment of length 12010020: from 1 to 12010020 DEFINITION Eragrostis tef cultivar Dabbi chromosome 4A. ACCESSION CP137588 CM044760 JAMPTX010000000 JAMPTX010000001-JAMPTX010000874 VERSION CP137588.1 DBLINK BioProject: PRJNA841677 BioSample: SAMN28611010 KEYWORDS . SOURCE Eragrostis tef ORGANISM Eragrostis tef Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; PACMAD clade; Chloridoideae; Eragrostideae; Eragrostidinae; Eragrostis. REFERENCE 1 (bases 1 to 32664196) AUTHORS VanBuren,R., Man Wai,C., Wang,X., Pardo,J., Yocca,A.E., Wang,H., Chaluvadi,S.R., Han,G., Bryant,D., Edger,P.P., Messing,J., Sorrells,M.E., Mockler,T.C., Bennetzen,J.L. and Michael,T.P. TITLE Exceptional subgenome stability and functional divergence in the allotetraploid Ethiopian cereal teff JOURNAL Nat Commun 11 (1), 884 (2020) PUBMED 32060277 Query Match 99.5%; Score 2490; Length 12010020; Best Local Similarity 99.9%; Matches 2501; Conservative 0; Mismatches 0; Indels 1; Gaps 1; Qy 1 ATGGCTTCAGCTGGGAGCAGCAGTGGAGGTGCAGGTGGAGGCAGCAGCATCAGGGCGGCG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7976239 ATGGCTTCAGCTGGGAGCAGCAGTGGAGGTGCAGGTGGAGGCAGCAGCATCAGGGCGGCG 7976298 Qy 61 AATGGCGCAGCTGCCATCAGTGCGGCCGCGACGGCAGTAGGCTCAGCCGACGCCAGATTC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7976299 AATGGCGCAGCTGCCATCAGTGCGGCCGCGACGGCAGTAGGCTCAGCCGACGCCAGATTC 7976358 Qy 121 CACTCCCACCCACCACAGCAGGACAGGGTATATACACTACACGACTTCTTGTTCCATGGC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7976359 CACTCCCACCCACCACAGCAGGACAGGGTATATACACTACACGACTTCTTGTTCCATGGC 7976418 Qy 181 GCATGCAATTGCTCATGCTTTAGCTGCAGCTTTTACCCTTCTTGCTTTAGATGTGTGGAT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7976419 GCATGCAATTGCTCATGCTTTAGCTGCAGCTTTTACCCTTCTTGCTTTAGATGTGTGGAT 7976478 Qy 241 GAGTACCAGCAATTTCTAGTAGGCCTTGACGACCTAGATTGTCACAGGCTTTGCGTACTT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7976479 GAGTACCAGCAATTTCTAGTAGGCCTTGACGACCTAGATTGTCACAGGCTTTGCGTACTT 7976538 Qy 301 AGTACGAATGGTACTGCCCAGTGGTGGTTGCAGCTTGCAACCCCGGCATCTTTACCCCCA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7976539 AGTACGAATGGTACTGCCCAGTGGTGGTTGCAGCTTGCAACCCCGGCATCTTTACCCCCA 7976598 Qy 361 ATAATTAGGCTTCAGTACTGTCTGCTTGTTTGCTTCTAGTACTGAATAGTTTGTTCAGCT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7976599 ATAATTAGGCTTCAGTACTGTCTGCTTGTTTGCTTCTAGTACTGAATAGTTTGTTCAGCT 7976658 Qy 421 GAATTTTCCGTTTTGCTGTTGATATTTGATTATTACGCGATTTGCACTCCCTCTATGTTT 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7976659 GAATTTTCCGTTTTGCTGTTGATATTTGATTATTACGCGATTTGCACTCCCTCTATGTTT 7976718 Qy 481 TTCCCCCCGGATCCTAGATGACTGTACTCTTACCATAACACTCGTCCAGAGACCTATATG 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7976719 TTCCCCCCGGATCCTAGATGACTGTACTCTTACCATAACACTCGTCCAGAGACCTATATG 7976778 Qy 541 TTGTGTAACTGTTGATTTGACCTTGCATACACTTCCACACGTCGTGTCAGTTGATGTCAT 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7976779 TTGTGTAACTGTTGATTTGACCTTGCATACACTTCCACACGTCGTGTCAGTTGATGTCAT 7976838 Qy 601 GAGCAAACTAACTATGCTGGGTTGATTCCTTCTTGCATGATGGATCTTTTTCCAAATGAA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7976839 GAGCAAACTAACTATGCTGGGTTGATTCCTTCTTGCATGATGGATCTTTTTCCAAATGAA 7976898 Qy 661 TTTTCAGATTCCTGTAAAATGCTTGGTGGTGTAGCTATTAATGTCAACACATTTCTTATA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7976899 TTTTCAGATTCCTGTAAAATGCTTGGTGGTGTAGCTATTAATGTCAACACATTTCTTATA 7976958 Qy 721 TTCTTAAGTAAAATTGGTTTAGATTAATACTCCAAGGAAATTTCGTTGTTGAACAACTAG 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7976959 TTCTTAAGTAAAATTGGTTTAGATTAATACTCCAAGGAAATTTCGTTGTTGAACAACTAG 7977018 Qy 781 TCATACATTTTTTCCCCTACCAACAGCTATGTACTTGATACTAATATGTGCATCTCTGAT 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7977019 TCATACATTTTTTCCCCTACCAACAGCTATGTACTTGATACTAATATGTGCATCTCTGAT 7977078 Qy 841 CTAAACAGCGGAGTAGATGGGCTGGCTGCTTGTCGGGTCTTTCATGTTTCGGATCTCAGA 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7977079 CTAAACAGCGGAGTAGATGGGCTGGCTGCTTGTCGGGTCTTTCATGTTTCGGATCTCAGA 7977138 Qy 901 AGGGCGGGAAGAGGATTGTTCCTGCCGCACGTACTCCTGATGGGAATGGATCAAGTGCTC 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7977139 AGGGCGGGAAGAGGATTGTTCCTGCCGCACGTACTCCTGATGGGAATGGATCAAGTGCTC 7977198 Qy 961 GTGGAAATGGTCATCAGTCCGGTTCTAATTCAAACCAAAATGTGCCTTTAAATCTGTCTC 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7977199 GTGGAAATGGTCATCAGTCCGGTTCTAATTCAAACCAAAATGTGCCTTTAAATCTGTCTC 7977258 Qy 1021 TTCTGGCTCCACCATCCTCACCGGCATCCTTCTCAAATTCTGCACTTCCTTCAACTGTTC 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7977259 TTCTGGCTCCACCATCCTCACCGGCATCCTTCTCAAATTCTGCACTTCCTTCAACTGTTC 7977318 Qy 1081 AATCGCCTAATAACTTTCTGTCAATCTCAGCAAATTCTCCTGGTGGTCCAACATCTAATA 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7977319 AATCGCCTAATAACTTTCTGTCAATCTCAGCAAATTCTCCTGGTGGTCCAACATCTAATA 7977378 Qy 1141 TGTTTGCTGTTGGGCCATATGCTAATGAACCTCAGCTTGTCTCGCCTCCTGTCTTCTCAA 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7977379 TGTTTGCTGTTGGGCCATATGCTAATGAACCTCAGCTTGTCTCGCCTCCTGTCTTCTCAA 7977438 Qy 1201 CTTACACAACTGAGCCTTCCACAGCACCATTGACCCCTCCACCTGAACTAGCTCATGCAA 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7977439 CTTACACAACTGAGCCTTCCACAGCACCATTGACCCCTCCACCTGAACTAGCTCATGCAA 7977498 Qy 1261 CCACTCCCTCATCTCCAGATGTTCCATACGCTCGGTTTCTTTCTTCTTTTATGGATATCA 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7977499 CCACTCCCTCATCTCCAGATGTTCCATACGCTCGGTTTCTTTCTTCTTTTATGGATATCA 7977558 Qy 1321 AAACTGCTAGTAAGGAGCATAACATGGCTTTCTTATCAACAACATATTCTGGTGGTTCAG 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7977559 AAACTGCTAGTAAGGAGCATAACATGGCTTTCTTATCAACAACATATTCTGGTGGTTCAG 7977618 Qy 1381 GACTCCAGGCATCATACCCTCTTTACCCTGAGAGCCCTTGTAGCAGCCTCATATCACCTG 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7977619 GACTCCAGGCATCATACCCTCTTTACCCTGAGAGCCCTTGTAGCAGCCTCATATCACCTG 7977678 Qy 1441 CTTCTGCTACTCCGAGGACTGGTCTTTCCTCACCAATACCTGAACAAGAGGTCCCTACTG 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7977679 CTTCTGCTACTCCGAGGACTGGTCTTTCCTCACCAATACCTGAACAAGAGGTCCCTACTG 7977738 Qy 1501 CCCATTGGAAGACTTCTAGGTCTGCCTGTGAACACACCATATTCCAGGGCTTCACCCATC 1560 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Db 7977739 CCCATTGGAAGACTTCTAGGTCTGCCTGTG-ACACACCATATTCCAGGGCTTCACCCATC 7977797 Qy 1561 CCTGAGCAAGAAGCCACTGCGCAGTGGAAGACTTCTAGATCGGCATGTGATACGCCTTAT 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7977798 CCTGAGCAAGAAGCCACTGCGCAGTGGAAGACTTCTAGATCGGCATGTGATACGCCTTAT 7977857 Qy 1621 GCCAGGGCTTCACCATCAAACATCTTTGGGCTGGACTCATCTGCTTCTAGAAACTATTTG 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7977858 GCCAGGGCTTCACCATCAAACATCTTTGGGCTGGACTCATCTGCTTCTAGAAACTATTTG 7977917 Qy 1681 TTAGATGGCAACTTCTTCCGGCCAGCTGCTTCTGCTCAATTCTACCTGGACCAGGCTCAG 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7977918 TTAGATGGCAACTTCTTCCGGCCAGCTGCTTCTGCTCAATTCTACCTGGACCAGGCTCAG 7977977 Qy 1741 CAGACATATCCATATAATGGTGGGAGGCGTAGTGTCTCACGGGACAAGCAAGATGCAGAT 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7977978 CAGACATATCCATATAATGGTGGGAGGCGTAGTGTCTCACGGGACAAGCAAGATGCAGAT 7978037 Qy 1801 GAAGTTGAAGCTTACAGAGCTTCGTTTGGCTTTAGTGCAGATGAAATCATGCAAACTCAA 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7978038 GAAGTTGAAGCTTACAGAGCTTCGTTTGGCTTTAGTGCAGATGAAATCATGCAAACTCAA 7978097 Qy 1861 TCTTATGTGGAGATACCAGATGCACTTGATGAATCATTCAGTATATCGCCATTTGGAAAT 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7978098 TCTTATGTGGAGATACCAGATGCACTTGATGAATCATTCAGTATATCGCCATTTGGAAAT 7978157 Qy 1921 AATGCTCCTGCTACTGAGGTGTCCCCATTTAATGATCCACCCAACGAGGTTCAGAAGGCT 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7978158 AATGCTCCTGCTACTGAGGTGTCCCCATTTAATGATCCACCCAACGAGGTTCAGAAGGCT 7978217 Qy 1981 GAGAAGTCAAGTCCAAAGAAAACGGCAGATCAGATTTCCAATGGCTCTCCACATAGAGTG 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7978218 GAGAAGTCAAGTCCAAAGAAAACGGCAGATCAGATTTCCAATGGCTCTCCACATAGAGTG 7978277 Qy 2041 CTGCACATTGACATATTCAAGGGTAAATGTCCATACTTTTTGCACCAACCATTCAGTTGT 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7978278 CTGCACATTGACATATTCAAGGGTAAATGTCCATACTTTTTGCACCAACCATTCAGTTGT 7978337 Qy 2101 AATCTAGGCATAGTAGAATTACTCTTGTTTATCCTTGCTATCTACTGCACCTAACAAAGC 2160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7978338 AATCTAGGCATAGTAGAATTACTCTTGTTTATCCTTGCTATCTACTGCACCTAACAAAGC 7978397 Qy 2161 TTTGGTAACTTTCAATGCTAATAACCTGAACTCTGGGCCATTTGTCATCAGCACTTATTG 2220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7978398 TTTGGTAACTTTCAATGCTAATAACCTGAACTCTGGGCCATTTGTCATCAGCACTTATTG 7978457 Qy 2221 GTATTGTGTTTCTATTTATGTAAATGCTTATTATGCTTATGTGCTCGCATTTCAGGAACA 2280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7978458 GTATTGTGTTTCTATTTATGTAAATGCTTATTATGCTTATGTGCTCGCATTTCAGGAACA 7978517 Qy 2281 AAAGGAGGACATCCGTCTGAGTACGAGGGTATTGTGAAAGATGGCCATCCTTTCAGAAAG 2340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7978518 AAAGGAGGACATCCGTCTGAGTACGAGGGTATTGTGAAAGATGGCCATCCTTTCAGAAAG 7978577 Qy 2341 ACAAGGGACGAAATATCTCTAAAACCCATAGAAGTAAGGAAGAAATCTCCACCTGGGCAT 2400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7978578 ACAAGGGACGAAATATCTCTAAAACCCATAGAAGTAAGGAAGAAATCTCCACCTGGGCAT 7978637 Qy 2401 TCATGCTCAGATGCTGAAATTGAGTACAGAAGGGCAAGGAGTCTGAGGGAAGCCAATGGT 2460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7978638 TCATGCTCAGATGCTGAAATTGAGTACAGAAGGGCAAGGAGTCTGAGGGAAGCCAATGGT 7978697 Qy 2461 GTCCCCTCGTGGCGCAGCACGTTGTCAAGACAGCTGCAGTGA 2502 |||||||||||||||||||||||||||||||||||||||||| Db 7978698 GTCCCCTCGTGGCGCAGCACGTTGTCAAGACAGCTGCAGTGA 7978739 VanBuren also teaches of a mutagenesis approach in efforts toward producing semidwarf, lodging-resistant tef (page 8, col 2 , para 2). Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine and modify these references, thus arriving at the applicants invention because VanBuren provides a complete sorted tef genome with subgenomes A and B, comments on “efforts to produce semidwarf, lodging-resistant [tef] using a mutagenesis approach” and teaches that future efforts “must take gene redundancy into account” (page 8, col 2 , para 2), Cannarozzi and VanBuren teach methods of determining the sequences of target genes in tef using knowledge from other plants (Cannarozzi, page 10, col 1, para 2; VanBuren page 9, col 2, para 3), and Yamaguchi teaches that dw1 is a causal gene for the semi-dwarfism of grain sorghum due to a nucleic acid modification in the coding region (page 7, para 3-4). The motivation to do this would be to resolve issues related to lodging by identifying the DW1 protein sequence in tef and conferring the agriculturally beneficial semi-dwarf and lodging-tolerant phenotype associated with nucleic acid modifications in DW1 on to tef in order to see rapid gains in yield improvement for the orphan crop so as to fully wield its desirable nutritional profile. low input demand, and adaptability (VanBuren, page 2, col 1, para 2). Claims 15-17 are rejected under 35 U.S.C. 103 as being unpatentable over Yamaguchi, Cannarozzi, and VanBuren as applied to claim 14 above. Claim 15 is dependent from claim 14 with the further limitation that DW3A and DW3B proteins comprise amino acid sequences comprising at least 75% or more sequence identity with SEQ ID NO 29 and SEQ ID NO 31, respectively. Claim 16 is dependent from claim 15 with the further limitation that DW3A and DW3B proteins are encoded by nucleic acid sequences comprising at least 75% or more sequence identity with SEQ ID NO 30 and SEQ ID NO 32, respectively. Claim 17 is dependent from claim 14 with the further limitation that nucleic acid modification in the nucleic acid sequences encoding an DW3A and DW3B proteins comprise at least 75% or more sequence identity with SEQ ID NO 33 and SEQ ID NO 34, respectively. Yamaguchi teaches that the dwarfing gene Dw3 has been cloned and is syntenic to the brachytic2 gene in maize Yamaguchi and Cannarozzi do not explicitly teach sequences that comprise at least 75% or more sequence identity with SEQ ID NO 29, SEQ ID NO 30 , SEQ ID NO 31, SEQ ID NO 32, SEQ ID NO 33, or SEQ ID NO 34. Regarding claim 15, VanBuren teaches amino acid sequences comprising 93.85% sequence identity (i.e., at least about 75% or more sequence identity) with an amino acid sequence of SEQ ID NO 29 ( see annotation below showing percent identity with Accession CP137596.1) PNG media_image9.png 175 1212 media_image9.png Greyscale and comprising 89.74% sequence identity (i.e., at least about 75% or more sequence identity) with an amino acid sequence of SEQ ID NO 31 ( see annotation below showing 90.89% sequence identity with Accession CP137597.1). PNG media_image10.png 181 1211 media_image10.png Greyscale Regarding claim 16, VanBuren teaches nucleic acid sequences comprising at least about 75% or more sequence identity with the sequences of SEQ ID NO 30 and SEQ ID NO 32 (Data not shown). Regarding claim 17, Yamaguchi, and VanBuren teach nucleic acid modifications in target genes. The difference between the sequences of SEQ ID NO 30 and SEQ ID NO 33, and SEQ ID NO 32 and SEQ ID NO 34 is an indel nucleic acid modification. Correspondingly, the same VanBuren-taught nucleic acid sequences that comprise at least about 75% or more sequence identity with the sequences of SEQ ID NO 30 and SEQ ID NO 32 also at least about 75% or more sequence identity with the sequences of SEQ ID NO 33 and SEQ ID NO 34. Therefore, it would have been obvious to one of ordinary skill in the art, before the effective filing date of the claimed invention to combine and modify the teachings from Yamaguchi, Cannarozzi, and VanBuren specifically in the context of proteins associated with plant architecture traits like DW1 because Yamaguchi teaches that Dw3 is a cloned dwarfing gene (page 1), Cannarozzi and VanBuren teach the Tef genome and transcripts and methods of determining the sequences of target genes in tef using knowledge from other plants (Cannarozzi, page 10, col 1, para 2; VanBuren page 9, col 2, para 3). Cannarozzi and VanBuren also teach to expect two homeologs of each targeted gene. There is a reasonable expectation of success in combining Yamaguchi, Cannarozzi, and VanBuren to arrive at the instant invention because Cannarozzi already identified twenty-six Arabidopsis, rice and sorghum breeding target genes to be at least partially present in the tef genome and where 2 homeologs were found for 21 out the 26 genes investigated. Cannarozzi’s breeding targets were not explicitly related to lodging however the goal of the project us to identify molecular breeding targets for tef as it is a prime candidate genetic improvement on several fronts: plant architecture, abiotic stress tolerance, and increased yield. One would be motivated to do so in order to identify the DW3 protein sequence in tef and confer the agriculturally beneficial semi-dwarf and lodging-tolerant phenotype associated with nucleic acid modifications in DW3 on to tef, “a high protein content” “low risk crop” that can serve as an “alternative food for people suffering from coeliac disease” due to the absence of gluten (Jost et al, Introduction, paragraph 1). Claims 18-19, and 35 are rejected under 35 U.S.C. 103 as being unpatentable over Yamaguchi, Cannarozzi, and VanBuren as applied to claim 1 above. Claim 18 depends from claim 1 with further limitations that comprise nucleic acid modification of nucleic acid sequences encoding homeologs of DW1 and DW3. Claim 19 also depends from claim 1 with further limitations that comprise nucleic acid modification of nucleic acid sequences encoding homeologs of DW1, DW3 and SD1. Regarding claim 18, Yamaguchi explicitly teaches a “double mutant (NIL-dw1dw3)” comprising nucleic acid modification of nucleic acid sequences encoding DW1 and DW3 for improving lodging resistance in sorghum, a diploid plant. Yamaguchi suggest that the “[individual nucleic acid modifications] of DW1 and DW3 decreased cell proliferation rates, whereas the double mutation had a synergistic effect on the cell proliferation rate” reduced internode length leading to the desirable dwarfing phenotype (page 7, para 1). “The two genes have been selected in modern breeding as one of the ideal combinations” and “many modern sorghum dwarf cultivars already contain mutations in both Dw1 and Dw3 (page 7, para 5). Regarding claim 19, Yamaguchi teaches “the pyramiding of dwarf genes should be useful in reducing sorghum to a suitable height” and “to combine a few semi-dwarfing genes, which …have synergistic or additive effects on height” (page 7, para 5). More so, Yamaguchi discusses a sorghum cultivar, “bmr-6, which carries three dwarfing genes, including dw1” dw2, and dw3 (page 2, para 2-3; page 3, fig 1 caption). Yamaguchi also teaches that the Sd1 gene has been a widely and successfully used dwarf gene in rice (page 7, para 2). Yamaguchi does not explicitly teach of nucleic acid modification of nucleic acid sequences encoding homeologs of DW1, DW3 and SD1 in tef. Cannarozzi teaches the partial genome of allotetraploid tef and VanBuren teaches the complete genome with subgenomes A and B sorted into individual chromosomes. Both Cannarozzi (page 6, fig 3 caption; page 10, col 1, para 2) and VanBuren (page 5, para 2; fig 4d; page 8, col 2 , para 2) teach to expect two homeologs for each gene. VanBuren teaches a 2:1 synteny pattern between tef and Oropetium, a diploid plant, where the “ratio corresponds to the A and B homeologs of tetraploid [tef] and the single orthologs of diploid Oropetium” (page 5, para 2). Cannarozzi teaches a 2:1 synteny pattern between tef and sorghum also (page 6, fig 3). Both also teach using sequences from other plants, including sorghum and rice, to identify genes in tef (Cannarozzi page 10, col 1, para 2;VanBuren page 9, col 2, para 3). Regarding claim 19, Cannarozzi also teaches that Sd1 homologs have been cloned and sequenced for 31 tef cultivars. Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine and modify these the teachings to arriving at the claimed invention because: 1) Lodging affects tef (allotetraploid), rice (diploid) and sorghum (diploid); 2)Yamaguchi teaches nucleic acid modifications in the sequences of dwarfing genes Sd1, Dw1, and Dw3, and pyramiding of dwarfing genes to get synergistic/additive effects of height reduction, highlighting Dw1 and Dw3 as an ideal combination; 3) VanBuren provides a complete sorted and annotated tef genome with subgenomes A and B, teaches that future “efforts to produce semidwarf, lodging-resistant teff using a mutagenesis approach…must take gene redundancy into account” because “the vast majority of genes in [tef] are maintained as homoeologous gene pairs in the A and B subgenomes” (page 8, col 2 , para 2); and 4) Cannarozzi teaches and exemplifies using known targets from other plants, including rice and sorghum, to identify breeding targets in tef. The motivation to do this would be to improve lodging resistance in tef as has been done in rice and sorghum order to see rapid gains in harvestable yield. There is a reasonable expectation of success because all three plants are susceptible to lodging, the three genes have been identified as dwarfing genes and Cannarozzi already found targets for improvement of agronomic traits in tef from other plants. Claim 35 is dependent on claim 19 within the further limitation that nucleic acid modification in the nucleic acid sequences encoding SD1A, SD1B, DW1A, DW1B, DW3A, and DW3B proteins comprise at least 75% or more sequence identity with SEQ ID NO 21, SEQ ID NO 22, SEQ ID NO 27, SEQ ID NO 28, SEQ ID NO 33, and SEQ ID NO 34, respectively. All of these are aimed at dwarfing as described above. Picking any one of these would be good; modifying both homeologs accounts for the gene redundancy in the tetraploid tef. Regarding claim 35, it would have been prima facie obvious at the time of filing for one of ordinary skill in the art to combine mutations in all six genes in one tef plant. One having ordinary skill would have been motivated to do so because "it is prima facie obvious to combine two compositions each of which is taught by the prior art to be useful for the same purpose, in order to form a third composition to be used for the very same purpose.... [T]he idea of combining them flows logically from their having been individually taught in the prior art" MPEP 2144.06. As set forth previously in Yamaguchi, combining multiple modified genes in one plant is known in the art and therefore obvious. Claims 20 and 33 are rejected under 35 U.S.C. 103 as being unpatentable over Yamaguchi, Cannarozzi, and VanBuren as applied to claim 1 above, and further in view of Jost. Claim 20 is dependent on any preceding claims with the further limitation that the synergistic reduction in height comprises an approximate 50 percent reduction in height of the plant. Claim 33, dependent on claims 1-20, is a method of improving the yield of Eragrostis tef comprising cultivating a genetically modified lodging resistant Eragrostis tef. Yamaguchi, Cannarozzi, and VanBuren do not explicitly teach that growing or cultivating a genetically modified lodging resistant Eragrostis tef. Jost teaches growing or cultivating a genetically modified lodging resistant Eragrostis tef, kegne, that “attained only one-third of the height of the [wildtype (WT)]” which equates to a reduction in height comprising more than 50 percent reduction in height of the plant (see fig 2A snippet below; page 936, col 2, para 3). PNG media_image11.png 200 400 media_image11.png Greyscale Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine and modify these the teachings to arriving at the claimed invention because: Yamaguchi teaches a synergistic reduction in height of sorghum cultivar, bmr-6, due to nucleic acid modifications in the 3 dwarfing genes. Jost teaches the use of known targets in other plants to identify breeding targets in tef as discussed concerning claim 7, and a more than 50 percent reduction in height of the genetically modified tef plant, kegne. One would be motivated to combine the teaching of dwarfing genes from Yamaguchi with the teachings of Jost in order to ascertain tef plants that have reduced height and are thus more resistant to lodging. Regarding claim 33, absent of any meaningful difference in the cultivation of genetically modified tef compared to WT tef defined by applicant, Jost and VanBuren teach the cultivation of genetically modified tef and WT tef in growth chambers, on agar, and in the field (Jost, page 935, Plant material and growth conditions; VanBuren, page 8, Plant materials). List of prior art cited but not applied The prior art made of record and not relied upon is considered pertinent to applicant's disclosure. Smith (Smith SM, Yuan Y, Doust AN, Bennetzen JL. Haplotype Analysis and Linkage Disequilibrium at Five Loci in Eragrostis tef. G3 (Bethesda). 2012 Mar;2(3):407-19. doi: 10.1534/g3.111.001511. Epub 2012 Mar 1. PMID: 22413094; PMCID: PMC3291510.) teaches SD1 clones and sequences from several tef cultivars. Zhu (Zhu Q, Smith SM, Ayele M, Yang L, Jogi A, Chaluvadi SR, Bennetzen JL. High-throughput discovery of mutations in tef semi-dwarfing genes by next-generation sequencing analysis. Genetics. 2012 Nov;192(3):819-29. doi: 10.1534/genetics.112.144436. Epub 2012 Aug 17. PMID: 22904035; PMCID: PMC3522160) teaches the amino acid sequences of DW3 proteins in tef. Hirano (Hirano K, Kawamura M, Araki-Nakamura S, Fujimoto H, Ohmae-Shinohara K, Yamaguchi M, Fujii A, Sasaki H, Kasuga S, Sazuka T. Sorghum DW1 positively regulates brassinosteroid signaling by inhibiting the nuclear localization of BRASSINOSTEROID INSENSITIVE 2. Sci Rep. 2017 Mar 9;7(1):126. doi: 10.1038/s41598-017-00096-w. PMID: 28273925; PMCID: PMC5428356.) teaches that DW1 is involved with auxin transport and brassinosteriod signaling. Conclusion No claim is allowed. Contact Information Any inquiry concerning this communication or earlier communications from the examiner should be directed to YVETTE B TAMUKONG whose telephone number is (571)272-1040. The examiner can normally be reached M-Th 730-5 EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at (571) 270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /Yvette B. Tamukong/ Patent Examiner of Art Unit 1662 /BRATISLAV STANKOVIC/Supervisory Patent Examiner, Art Units 1661 & 1662
Read full office action

Prosecution Timeline

Jun 14, 2024
Application Filed
Jan 12, 2026
Non-Final Rejection — §103, §112 (current)

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
Grant Probability
3y 2m
Median Time to Grant
Low
PTA Risk
Based on 0 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month