DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
This action is in response to the papers filed on 06/20/2024. Claims 1-19 and 27 are currently pending. Claims 4-14, 16, 17 and 19 are currently amended, Claims 20-26 are cancelled, and Claim 27 is a newly added claim by applicant’s amendment filed 06/20/2024.
Claims 1-19 and 27 are examined on their merits to which the following grounds of rejection are applicable. Claim 1, 19 and 27 are independent claims.
Sequence Compliance - 37 CFR 1.821-1.825
This application contains sequence disclosures that are encompassed by the
definitions for nucleotide and/or amino acid sequences set forth in 37 CFR 1.821(a)(1)
and (a)(2).
However, this application fails to comply with the requirements of 37 CFR 1.821 through 1.825 for the reason(s) set forth below and on the Notice to Comply With Requirements
For Patent Applications Containing Nucleotide Sequence And/Or Amino Acid Sequence Disclosures which is attached to this communication.
Claim 14 recites a SEQ ID NO: 81, however no Sequences have been submitted with the application.
Applicant must amend the claims and specification and/or drawings to comply
with the sequence requirements.
APPLICANT IS GIVEN A THREE MONTH EXTENDABLE PERIOD WITHIN
WHICH TO COMPLY WITH THE SEQUENCE RULES, 37 CFR 1.821-1.825. Failure to comply with these requirements will result in ABANDONMENT of this application under
37 CFR 1.821 (g). Extension of time may be obtained by filing a petition accompanied by the extension fee under the provisions of 37 CFR 1.136. In no case may an applicant
extend the period for response beyond the six month statutory period. Applicant is
requested to return a copy of the attached Notice to Comply with the response.
Required response – Applicant must provide:
• A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers, including into the Brief Description of
the Drawings, consisting of:
o A copy of the previously-submitted specification, with deletions shown with
strikethrough or brackets and insertions shown with underlining (marked-
up version);
o A copy of the amended specification without markings (clean version); and
o A statement that the substitute specification contains no new matter.
The examiner acknowledges that SEQ ID NO: 81 has a sequence set forth in the specification at para 0118 of the published application. To advance prosecution, the examiner is utilizing the sequence disclosed at para 0118 to examine claim 14.
Priority
The instant application is a 371 of PCT/US2022/053404 filed on 12/19/2022
which claims benefit of 63/291,722 filed on 12/20/2021.
Thus, the earliest possible filing priority for the instant application is 12/20/2021.
Information Disclosure Statement
The information disclosure statements (IDS) submitted on 07/22/2025 was filed before the mailing date of the non-final office action. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Claim Objections
Claim 27 is objected to because abbreviations such as TP53 and MDM2 should be spelled out at their first encounter in the claims. Appropriate correction is required.
Claim Rejections - 35 USC § 112 (b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 4-6, 8, and 10-15 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 4 recites the “vector of claim, wherein”. There is no indication of what claim the applicant is referring to. Appropriate correction is required.
Claim 4-6 inherit these deficiencies insofar as they depend from claim 4
Claims 6, 8, 11 and 13 are rejected under 35 U.S.C. 112, second paragraph, as being indefinite in that it fails to point out what is included or excluded by the claim language due to improper use of Tables 5, 3, 1 and 2, respectively. As such, the metes and bounds of the claims cannot be determined.
Claim 10-15 inherit these deficiencies insofar as they depend from claim 8.
Claim 14 is indefinite in its recitation of “corresponding to” . The specification does not provide any closed definition as to what is meant by “corresponding to”. It is unclear if the phrase “corresponding to” should be interpreted narrowly to encompass only materials that have a structure identical to the SEQ ID NO: or if the phrase should be interpreted broadly to encompass materials which have a structure “similar” to the SEQ ID NO:, for example, the same nucleic acid sequence from another species. The metes and bounds are not clearly set forth.
Claim 15 inherit these deficiencies insofar as they depend from claim 14.
The examiner notes that the Specification defines a “vector” or “construct” (sometimes “as a gene delivery system or gene transfer “vehicle”) refers to a macromolecule or complex of molecules comprising a polynucleotide to be delivered to a host cell, either in vitro or in vivo.” (para [0088] of the published application).
Claim Rejections - 35 USC § 112 (d)
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 8 and 11 are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Claim 7 recites the vector of claim 1, wherein the nucleic acid sequence encoding the at least one therapeutic moiety is selected from a group consisting of a species of genes. Claim 8 recites the vector of claim 7 wherein the at least one therapeutic moiety is selected from a group consisting of a species of genes. Both claim 7 and claim 8 recite at least one therapeutic moiety selected from a group consisting a species of gene, thus claim 8 fails to further limit claim 7 as they both require limiting the at least one therapeutic moiety to a species of genes.
Similarly, claim 10 recites the vector of claim 8, wherein the pathogenic gene of interest is selected from a group consisting of a species of genes and claim 11 recites the vector of claim 10, wherein the pathogenic gene of interest is selected a group consisting of a species of genes, thus claim 10 fails to further limit claim 11 as they both require limiting the pathogenic to a species of genes.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 112(a) – Scope of Enablement
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claim 1-19 and 27 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for:
A vector, a method of using a vector to decrease solid tumor growth and hematopoietic cancer in two mouse models, and a composition comprising:
donor therapeutic mRNA comprising a nucleic acid sequence encoding TP53
mRNA sequence for Cas9 genome editing endonuclease, and
guide RNA sequences for guiding the endonuclease to cleave the MDM2 pathogenic gene for insertion of a functional TP53 gene,
does not reasonably provide enablement for:
any donor therapeutic mRNA comprising a nucleic acid sequence encoding at least one therapeutic moiety
any genome editing endonuclease or nucleic acid sequence encoding a genome editing endonuclease and;
Any guide RNA sequences for guiding the endonuclease to cleave at least one pathogenic gene of interest, thereby resulting in the disruption of the pathogenic gene of interest and expression of the at least one therapeutic moiety.
A method of treating any multigenic disease in any subject including a human subject comprising administering any vector that disrupts any pathogenic gene and expresses any therapeutic gene or therapeutic moiety.
The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make or use the invention commensurate in scope with these claims.
The factors to be considered in determining whether undue experimentation is
required are summarized in In re Wands, 858 F.2d 731, 737, 8 U.S.P.Q.2d 1400, 1404
(Fed. Cir. 1988) (a) the breadth of the claims; (b) the nature of the invention; (c) the state of the prior art; (d) the level of one of ordinary skill; (e) the level of predictability in the art; (f) the amount of direction provided by the inventor; (g) the existence of working examples; and (h) the quantity of experimentation needed to make or use the invention based on the content of the disclosure.
While all of these factors are considered, a sufficient number are discussed below so as to create a prima facie case.
the breadth of the claims; the nature of the invention:
Claim 1 is directed to a vast genus of vectors, comprising a vast genus of:
donor therapeutic mRNA comprising a nucleic acid sequence encoding at least one therapeutic moiety
genome editing endonucleases or nucleic acid sequences encoding a genome editing endonuclease and;
guide RNA sequences for guiding the endonuclease to cleave at least one pathogenic gene of interest, thereby resulting in the disruption of the pathogenic gene of interest and expression of the at least one therapeutic moiety.
Claim 2 further limits claim 1 to additionally comprise a targeting moiety. Claim 3 further limits claim 2 wherein the targeting moiety is a cancer cell targeting moiety. Claim 4 further limits the targeting moiety to an antibody, antibody fragment, nanobody, receptor ligand, and any combination thereof. Claim 6 further limits claim 5 to a targeting moiety that binds to a selected target. Claim 7-9 further limits claim 1 to the nucleic acid sequence encoding a selected therapeutic moiety. Claim 10 and 11 further limit claim 1 to a select pathogenic gene of interest. Claim 12, 13, and 15 further limit claim 11 to a select endonuclease. Claim 16-18 further limit claim 1 to a select vector.
the amount of direction provided by the inventor; the existence of working
examples:
As recited above, claim 1 is broadly but reasonably interpreted as a vast genus of vectors, comprising a vast genus of:
donor therapeutic mRNA comprising a nucleic acid sequence encoding at least one therapeutic moiety
genome editing endonucleases or nucleic acid sequences encoding a genome editing endonuclease and;
guide RNA sequences for guiding the endonuclease to cleave at least one pathogenic gene of interest, thereby resulting in the disruption of the pathogenic gene of interest and expression of the at least one therapeutic moiety.
The specification does not provide support for the genus of vectors with a wide range of therapeutic mRNA nucleic acid sequences, endonucleases, and gRNAs to cleave at least one pathogenic gene of interest thereby resulting in the disruption of the pathogenic gene of interest and expression of the therapeutic moiety. The Specification does not provide support for methods of treating a multigenic disease in a subject, including a human subject, in need thereof.
The specification describes transfection of OVCAR8 (ovarian cancer) and HepG2 (hepatocellular carcinoma cells) with a vector comprising a lipid nanoparticle (LNP), Cas9 endonuclease nucleic acid sequence, guide RNA sequences targeting MDM2, and an EGFR or CD38 antibody targeting moiety, and a therapeutic mRNA sequence encoding TP53 (Figure 5, 6, 7A-B; para 00109-00112, para 00116-00121). The specification describes a method for treating solid tumor carcinoma in mice using the vector comprising a LNP, Cas9 endonuclease nucleic acid sequence, guide RNA sequences targeting MDM2, and an EGFR targeting moiety. The specification also describes a method for treating hematopoietic cancer with a mouse model for human mantal cell lymphoma using the vector system previously described, but the targeting moiety is for CD38 (para 00123).
Therefore, the specification only provides details to vectors comprising:
a lipid nanoparticle
Cas9 endonuclease nucleic acid sequence
guide RNA sequences targeting MDM2
an EGFR or CD38 antibody targeting moiety and;
and a therapeutic mRNA sequence encoding TP53
Furthermore, in regards to the methods disclosed, the specification only provides details for a method for treating solid tumor carcinoma and hematopoietic cancer in mouse models.
the state of the prior art; the level of predictability in the art:
Use of synthetic constructs for targeting expression of genes of interest in biomedical applications has been known in the art, however the use of vectors for the delivery of gene-based therapeutics and their ability to treat multigenic diseases remains an area of research as these technologies are still in their infancy stage of development. Cring et al., (Gene Therapy, 2022, pages 3-12) teaches use of vectors for gene therapy and that “many genetic diseases that are good targets for gene therapy are very genetically heterogeneous, which layers on additional complexity to the process of developing treatments” (page 8, right col, para 2) and provides examples, such as autosomal recessive retinitis pigmentosa (page 8, right col, para 2), where a plethora of genes can independently cause a disease, thus requiring one to determine which, if any, combinations of genes would be of interest as a pathogenic gene and how a therapeutic moiety would be capable of synergistically treating the disease. In regards to using CRISPR/Cas9 gene editing, Chapman et al (Journal of ABSA International, 2017, pages 7-13) teaches that off-targets effects are a known problem when using CRISPR/Cas9 and if a gRNA recognizes a closely matched sequence “an off-target genome modification can occur. Thus, the target specificity of CRISPR-Cas9 contendswith its propensity for off-target mutagenesis, or off-target genetic modification, and is believed to be affected by a number of factors, the exact parameters of which are still being determined” (page 9, right col, para 3). Similarly, in regards to CRISPR’s known problem of off-target effects and CRISPR application in human gene therapy, Yang et al (Adv. Funct. Mater. 2024, pages 1-19) teaches “that off-target effects are a significant concern associated with CRISPR-based therapy since they can potentially result in unintended DNA sequence mutation carrying unpredictable and potentially hazardous consequences” and, “at the genomic level, off-target effects can result in significant issues, such as genomic rearrangements and substantial deletion, which potentially disrupt gene function and in extreme cases, lead to the development of cancer cells” (page 11, right col, para 2).
Therefore, the prior art highlights the unpredictability in use of vectors for treating diseases due to heterogeneity in genes that cause disease and that off-target effects by CRISPR/Cas9 are possible and can cause undesirable gene editing, imparting deleterious outcomes as well as ineffective cleavage of genes of interest, thus failing to effectively treat a disease.
the quantity of experimentation needed to make or use the invention based on the
content of the disclosure:
The skilled artisan would be required to perform under levels of experimentation
in order to practice the claimed invention. The instant specification does not reduce to
practice the claimed invention; the instant specification does not provide guidance on making any vector with any therapeutic mRNA, any endonuclease, any guide RNA, and any targeting moiety except: a lipid nanoparticle, a therapeutic mRNA sequence encoding TP53, a Cas9 endonuclease nucleic acid sequence, guide RNA sequences targeting MDM2, and one vector with an EGFR antibody targeting moiety and a second vector with a CD38 antibody targeting moiety. Thus, the skilled artisan would be forced to 1) determine which combination of elements of: therapeutic mRNA, guide RNA, endonuclease, and guide RNA. 2) where each of the aforementioned elements should be in the construct, and 3) determine if that combination of elements would result in disruption of pathogenic gene of interest, expression of the therapeutic moiety, and sufficient treatment of a multigenic disease. Though the Specification supports decrease solid tumor growth and hematopoietic cancer in two mouse models, the specification is silent about methods of treating a multigenic disease in a human subject in need thereof.
the level of one of ordinary skill:
The level of one of ordinary skill is a PhD holder.
Conclusion:
When all of the Wands factors are considered together, they establish a prima
facie case that the specification is not enabling for the claims. The Specification only
provides details for a vector comprising:
a lipid nanoparticle
Cas9 endonuclease nucleic acid sequence
guide RNA sequences targeting MDM2
an EGFR or CD38 antibody targeting moiety and;
and a therapeutic mRNA sequence encoding TP53
Additionally, the specification only provides details for a method for treating solid tumor carcinoma and hematopoietic cancer in mouse models comprising the aforementioned vector with either an EGFR or CD38 antibody targeting moiety.
Claim Interpretation
Claim 1, 7, 8, 9, 19, and 27 recite the word “therapeutic”. The examiner interprets “therapeutic” as eliciting, either indirectly or directly, a beneficial effect to a subject.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claim(s) 1-19, and are rejected under 35 U.S.C. 103 as being unpatentable over Scharenberg et al (US 20200377911 A1; as cited in IDS) and further in view of Davies et al (US 20240424094 A1), Furch et al (US 20180140717 A1), Pirollo et al (Molecular Therapy, 2016, pages 1697-1706), Harvey et al (Cancer Gene Therapy, 2011, pages 773-784), Staudt et al (US 10607717 B2), Offen et al (US 20200009180 A1), and as evidenced by Wikipedia (Programmed cell death protein 1, Wikipedia, page 1-14, downloaded 06/08/2026).
Regarding claims 1, 12, 13-14, 17, 18, Scharenberg teaches a gene-editing system comprising adeno-associated virus vector (AAV) comprising a first nucleic acid sequence encoding a CRISPR guide RNA, wherein the CRISPR guide RNA is complimentary to at least one target gene in a cell and, wherein said first nucleic acid sequence is present in a vector; a second nucleic acid sequence encoding a Cas9 protein (endonuclease that cleaves DNA) (para 008). Scharenberg teaches the gene-editing system can be an approach that causes gene disruption of a target gene (para 0007) and that inactivation of a target gene for therapeutic, agricultural and/or other commercially useful purposes can occur utilizing their systems (para 0007).
Scharenberg does not teach at least one donor therapeutic mRNA comprising a nucleic acid sequence encoding at least one therapeutic moiety and expression of the at least one therapeutic moiety.
However, one of ordinary skill in the art would have considered the teachings of Davies as this reference is analogous prior art pertaining to use of a vector comprising mRNA as a therapeutic moiety for cancer treatment.
Davies teaches a cancer treatment method comprising targeting of cells of interest (i.e. cancer cells) to deliver a mRNA containing instructions for the target cell to express a universal cancer antigen (UCA; i.e. a therapeutic mRNA/moiety) into a target cell such that the target cell expresses the UCA. Davies teaches that the UCA can be targeted by the body’s own antibodies (claim 17; para 0006) and teaches that antibodies can both directly kill tumor cells while simultaneously engage the host immune system to develop long-lasting effector responses (para 0003 and 0006).
It would have been prima facie obvious to one of ordinary skill, in the art at the time of the effective filing date, to modify the teachings of an AAV comprising nucleic acids encoding an endonuclease and guide RNA to disrupt a gene from Scharenberg to include the teachings of an therapeutic mRNA (i.e. a UGA) that can kill cancerous cells via interacting with antibodies from Davies to achieve a comprehensive AAV that has collectively: 1) a therapeutic mRNA which encodes a therapeutic moiety such as a UCA, 2) a genome editing endonuclease, and 3) a guide RNA to disrupt a pathogenic gene of interest such that the comprehensive AAV has dual ability to both disrupt a pathogenic gene of interest and deliver a therapeutic mRNA to the cell to ultimately treat cancer. One would be motivated to do so to ensure higher likelihood of eradicating cancerous cells as two approaches (gene disruption and therapeutic mRNA expression which can, for instance, recruit cancer-killing antibodies) could simultaneously kill the cancer cell via this dual vector system. As use of the endonucleases with guide RNA targeting and expression of a therapeutic mRNA agent are both known in the art, one would have a reasonable expectation of success.
Regarding claim 2-5 and 16, the teachings of Davies and Scharenberg render obvious claim 1.
The combined teachings of Davies and Scharenberg do not teach the vector further comprising a targeting moiety (claim 2), the targeting moiety is a cancer cell targeting moiety (claim 3), the targeting moiety is selected from the group consisting of an antibody, an antibody fragment, a nanobody, a receptor ligand, and any combination therefore (claim 4), the targeting moiety is configured to bind to a target and deliver the vector to cells in a tumor environment (claim 5), and the vector is a lipid nanoparticle.
However, one of ordinary skill in the art would have considered the teachings of Furch as this reference is analogous prior art pertaining lipid-based nanoparticles with targeting moieties to target diseased cells and avoid killing healthy cells.
Furch teaches lipid-based nanomedicines that target and deliver tools for genome editing (i.e. the disease-cell specific targeting is achieved by using nanocarriers that have a targeting moiety that can be an antibody or antibody fragment thereof (abstract; para 0025)) and the disease-related marker is expressed on the surface of the diseased cells in malignant diseases—including, but not limited to, cancer (para 0061). Furch teaches that “such targeted strategies allow to specifically deliver the chemotherapeutic agents to tumors, to avoid normal healthy tissues, to reduce systemic toxicity, to protect the drugs from degradation, and to increase their half-life, solubility as well as to reduce renal clearance.” (para 0008).
It would have been prima facie obvious to one of ordinary skill, in the art at the time of the effective filing date, to modify the teachings of a vector comprising 1) a therapeutic mRNA, 2) a genome editing endonuclease, and 3) a guide RNA to disrupt a pathogenic gene of interest, to additionally comprise a targeting moiety as taught by Furch to result in a complete vector with 1) a therapeutic mRNA, 2) a genome editing endonuclease, and 3) a guide RNA to disrupt a pathogenic gene of interest and that is able to specifically target cells of interest through additionally comprising a targeting moiety. One would be motivated to do so to ensure higher efficacy of the vector such that it selectively targets cells of interest based on the targeting moiety and does not detrimentally affect healthy cells. As use of vector systems and targeting moieties is known in the art, one would have a reasonable expectation of success.
Regarding claim 6, the teachings of Davies, Scharenberg, and Furch render obvious claim 1 and 5. Moreover, Furch teaches that the targeting moiety specifically binds to a receptor molecule expressed on the surface of the cell species and examples of receptor molecules are CD20, EGFR/ErbB1, and HER2/ErbB2, rendering obvious wherein the targeting moiety binds to a target selected from the group consisting of: EGFR, HER2, and CD20.
Regarding claim 7, the teachings of Davies and Scharenberg render obvious claim 1. Moreover, Davies teaches that the mRNA payload (i.e. UCA) can induce an immune response via binding of an UCA antibody on the targeted cell (para 0071), rendering obvious wherein the nucleic acid sequence encoding the at least one therapeutic moiety is selected from the group consisting of: an immune stimulatory gene.
Regarding claim 8, the teachings of Davies and Scharenberg render obvious claim 1 and 7.
The combined teachings do not teach wherein the at least one therapeutic moiety is selected from the group consisting of: p53, PTEN, Rb, IL24, APC, BAX, BAK, BCLX, an interleukin, an interferon, a CD122/132 agonist, a chemokine, HSP 70/90, Calreticulin, HMGB1, a Toll Like Receptor, CGAS, STING1, ARHI, RASSF1A, DLEC1, SPARC, DAB2, PLAGL1, RPS6KA2, PTEN, OPCML, BRCA2, ARL11, WWOX, TP53, DPH1, BRCA1, mTORC2, PEG3, IGF2, SAT2, p16INK4A, p14ARF, IRF3/7, any therapeutic moiety listed in Table 3, and any combination thereof.
However, one of ordinary skill in the art would have considered the teachings of Pirollo as this reference is analogous prior art pertaining to the importance of TP53 in the prevention of cancer.
Pirollo teaches p53 gene (TP53) is an important tumor-suppressor gene in
humans and loss of such critical tumor-suppressor activity is believed to be responsible for the involvement of p53 in a broad array of human tumors (page 1697, Introduction, para 1). Pirollo teaches SGT-53 is a nanocomplex that contains a normal human wildtype p53 cDNA (i.e. transcribed from RNA) and has a targeting moiety that is an antibody (abstract) and that systemic administration of SGT-53 demonstrated the ability to target tumor cells throughout the body with exquisite specificity and displayed significant antitumor activity (page 1698, left col, para 3).
It would have been prima facie obvious to one of ordinary skill, in the art at the time of the effective filing date, to substitute the therapeutic mRNA in the vector, as taught by Davies, with a TP53 wildtype gene as taught by Priollo to generate a vector that expresses TP53 as the therapeutic agent when delivered to a target cell. One would be motivated to do so as Priollo teaches that TP53 has significant anti-tumor abilities, could be delivered in nucleic acid form as a therapeutic moiety, and by combining into a vector that also has ability to gene edit, one would have a complete, dual vector that has the ability to express p53 as a tumor-killing agent, and disrupt expression of a pathogenic gene.
Regarding claim 9, the teachings of Davies and Scharenberg render obvious claim 1. The combined teachings do not teach the at least one therapeutic moiety is a prodrug modifying enzyme.
However, one of ordinary skill in the art would have considered the teachings of Harvey as this reference is analogous prior art pertaining to using prodrug-activating enzyme genes in gene therapy to kill undesirable cells.
Harvey teaches that “use of viral vectors is an attractive and well-established approach for the delivery of gene therapies” (page 774, left col, para 2) and teaches adenovirus vectors for targeted gene therapy wherein the adenovirus comprises a herpes simplex virus thymidine kinase (HSVtk) gene (i.e. a prodrug modifying enzyme). Harvey teaches that virus-directed enzyme prodrug therapy involves the delivery of genes encoding a prodrug-activating (‘suicide’) enzyme, which metabolizes a non-toxic prodrug to produce toxic metabolites that are freely diffusible and able to kill neighboring cells via a ‘bystander effect’” (page 774, left col, para 2).
It would have been prima facie obvious to one of ordinary skill, in the art at the time of the effective filing date, to modify the teachings of a vector comprising a therapeutic moiety from Davies and Scharenberg to specifically have the therapeutic moiety be a prodrug modifying enzyme, such as HSVtk gene. One would be motivated to do so to generate a vector that has the capability to both disrupt a pathogenic gene of interest and concurrently be able to express a prodrug modifying enzyme such that there is a synergistic effect of killing cancer cells from a single vector design. As use prodrug modifying enzyme genes in vectors for gene therapy purposes is well known in the art, one would have a reasonable expectation of success.
Regarding claim 10 and 11, the teachings of Davies, Scharenberg, and Priollo render obvious claim 1, 7, and 8. Moreover, Scharenberg teaches that the CRISPR guide RNA is complimentary to a target gene on interest which includes PD-1, an immune checkpoint protein which downregulates the immune system and promoting self-tolerance by suppressing T cell inflammatory activity, as evidenced by Wikipedia (Programmed cell death protein 1, Wikipedia, page1, downloaded 06/08/2026). Therefore, Scharenberg renders obvious wherein the pathogenic gene of interest is an immune suppressive gene (claim 10) which is PD1 (claim 11).
Regarding claim 14, the teachings of Davies, Scharenberg, and Priollo render obvious claim 1, 7, 8, 10-13. The combined teachings do not teach wherein the one or more gRNA sequences comprises a nucleic acid sequence corresponding to SEQ ID NO: 81.
Staudt teaches a probe for MDM2 comprising a sequence set forth in SEQ ID NO: 1256 which has 100% sequence identity match to instant application SEQ ID NO: 81 which is disclosed as the sequence “CTTGGTAGTAGTCAATCAGC” in the specification (para 00120). See sequence alignment below:
Query = instant application SEQ ID NO: 81, Sbjct = Staudt SEQ ID NO: 1256
PNG
media_image1.png
214
812
media_image1.png
Greyscale
Regarding claim 19, Offen teaches a method of treating Alzheimer's Disease comprising administering to a subject in need thereof a therapeutically effective amount of a polynucleotide agent (i.e. a vector, para 0098) which downregulates an amount and/or activity of caspase-6 in the brain of the subject via targeting DNA with gene targeting tools (i.e. disrupting) specifically at the Casp6 gene (abstract, para 0055-0066). Offen teaches the expression of a Cas9 nuclease from the vector to elicit the disruption of the caspase-6 gene, thus causing improvement in memory retention, therefore the Cas9 demonstrating therapeutic properties (Figure 2A, para 0225). Hence, Offen renders obvious a method of treating a multigenic disease in a subject in need thereof, the method comprising administering an effective amount of a vector composition that (i) disrupts a pathogenic gene and (ii) expresses at least one therapeutic gene or therapeutic moiety.
Claim 27 is rejected under 35 U.S.C. 103 as being unpatentable over Scharenberg et al (US 20200377911 A1; as cited in IDS) and further in view Wade et al (Nature Reviews, 2013, pages 83-96).
Regarding claim 27, Scharenberg teaches a gene-editing system (i.e. composition) comprising adeno-associated virus vector (AAV) comprising a first nucleic acid sequence encoding a CRISPR guide RNA, wherein the CRISPR guide RNA is complimentary to at least one target gene in a cell and, wherein said first nucleic acid sequence is present in a vector; a second nucleic acid sequence encoding a Cas9 protein (endonuclease that cleaves DNA) (para 008). Scharenberg teaches the gene-editing system can be an approach that causes gene disruption of a target gene (para 0007) and that inactivation of a target gene for therapeutic, agricultural and/or other commercially useful purposes can occur utilizing their systems (para 0007).
Scharenberg does not teach a one donor therapeutic TP53 nucleic acid sequence and one or more gRNA sequences for guiding the genome editing endonuclease to cleave an MDM2 gene.
However, one of ordinary skill in the art would have considered the teachings of Wade as this reference is analogous prior art pertaining to biological function of MDM2 as a negative regulator of p53 (i.e. TP53), p53 having a crucial role in tumor suppression, and the motivation to develop therapies targeting TP53 and MDM2.
Wade teaches that in cancer, the TP53 gene (which encodes p53) can be wildtype or mutant and, in each case, the protein is inactivated, thus offering an attractive strategy for cancer therapy based on the reactivation of p53 (page 83, left col, para 1; page 89 left col, para 3). Wade teaches that MDM2 is a major negative regulator of p53 and approaches to identify and treat patients whose tumors are particularly susceptible to the targeting of defective MDM2–MDMX–p53 circuitry should be considered (page 83, right col, para 1). Wade teaches that “wild-type p53 is a valid therapeutic target, and that reactivation of p53 via selective targeting of either MDM2 or MDMX is a viable strategy for cancer therapy” and that “interfering with MDM2 and MDMX is the most direct approach” (page 89, right col, para 1).
It would have been prima facie obvious to one of ordinary skill, in the art at the time of the effective filing date, to modify the teachings from Scharenberg for a vector comprising a guide RNA and endonuclease to disrupt a pathogenic gene and incorporate the teachings from Wade pertaining to the relationship between MDM2 and TP53 which together play active roles in cancer development to generate a comprehensive vector that comprises an endonuclease, a therapeutic TP53 nucleic acid sequence, and a guide RNA that specifically targets MDM2 gene such that the MDM2 gene is disrupted and the TP53 nucleic acid sequence is expressed. One would be motivated to do so because Wade teaches that upregulation of p53 can have anti-tumor effects and inhibition of expression of MDM2 can also increase p53 expression, and collectively, this would cause anti-oncogenic effects. Similarly, one would be motivated to generate a vector with both TP53 expression and MDM2 disruption to have a more powerful, dual-approach to modulating the MDM2-TP53 relationship by causing both increase p53 and decreased MDM2 and, therefore, a stronger anti-oncogenic effect. As the use of vectors for gene disruption and expression of a therapeutic moiety are known in the art, one would have a reasonable expectation of success.
Conclusion
Claims 1-19 and 27 are rejected.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Juliana Candelaria whose telephone number is (571)272-5488. The examiner can normally be reached Monday - Friday 8am - 5pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Maria Leavitt can be reached at (571) 272-1085. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JULIANA IRENE CANDELARIA/ Examiner, Art Unit 1634
/MARIA G LEAVITT/ Supervisory Patent Examiner, Art Unit 1634
Prosecution Insights