DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
The instant application is a national stage entry of PCT/EP2022/087983 (filed on 12/29/2022), which claims foreign priority under 35 U.S.C. 119(a)-(d) based on application EP21218329.7 (filed on 12/30/2021).
Certified copy of the foreign priority document is on file.
Information Disclosure Statement
The information disclosure statement (IDS) submitted on 6/28/2024 complies with the provisions of 37 C.F.R. 1.97 and all references have been fully considered.
Drawings
The drawings are objected to as failing to comply with 37 CFR 1.84(p)(5) because they include the following reference character not mentioned in the description: “F2F8” in the x-axis of Figures 4A-4C.
The drawings are also objected to because the symbols and text in all figures are too small and not well-defined. 37 C.F.R. 1.84 section (p)(3) requires that “Numbers, letters, and reference characters must measure at least .32 cm. (1/8 inch) in height”, while section (l) states “All drawings must be made by a process which will give them satisfactory reproduction characteristics. Every line, number, and letter must be durable, clean, black (except for color drawings), sufficiently dense and dark, and uniformly thick and well-defined”. See MPEP § 608.02(V).
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
In addition to Replacement Sheets containing the corrected drawing figure(s), applicant is required to submit a marked-up copy of each Replacement Sheet including annotations indicating the changes made to the previous version. The marked-up copy must be clearly labeled as “Annotated Sheets” and must be presented in the amendment or remarks section that explains the change(s) to the drawings. See 37 CFR 1.121(d)(1). Failure to timely submit the proposed drawing and marked-up copy will result in the abandonment of the application.
Specification
The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code (line 13, page 13). Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01.
Claim Objections
Claim 1 is objected to because of the following informality: the full name of the abbreviation “MUCL” is missing. Any abbreviation should be defined when first introduced in a set of claims by reciting the full term followed by the abbreviation in parentheses. To resolve this issue, it is recommended that “Belgian Coordinated Collections of Microorganisms / MUCL” be changed to “Belgian Coordinated Collections of Micro-organisms/Mycotheque de l’Universite catholique de Louvain (BCCM/MUCL)”.
Claims 1, 8, and 13-15 are objected to due to lack of space in between the abbreviation “MUCL” and the deposit number “58178”. Appropriate correction is required.
Claims 1, 8, and 13-14 are objected to since the phrase “to the genome” is redundant given that it is already preceded by “over the entirety of the genome”.
Claim 10 is objected to because of the following informalities: (i) some words appear to be missing after the phrase “wherein the agricultural active composition” as it is immediately followed by “antioxidant, a preservative, an aroma, a colorant, or a combination thereof”; (ii) use of a dash at the beginning of the last two paragraphs; and (iii) the full meaning of the abbreviation “CFU/g” is not provided and should be amended to “colony forming units per gram (CFU/g)”.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
Claims 1-11, 13-15, and 17-21 are rejected under 35 U.S.C. 112(a) as failing to comply with the enablement requirement. The claims contain subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention.
The invention employs a novel biological material, specifically a strain of Penicillium bialowiezense deposited under accession number “58178”. Since this biological material is essential to the claimed invention, it must be obtainable by a repeatable method set forth in the specification or otherwise readily available to the public. If it is not so obtainable or available, the requirements of 35 U.S.C. 112(a) may be satisfied by a deposit of the biological material. Applicant must meet all the requirements of 37 C.F.R. 1.801-1.809, including providing an indication of the viability of the sample when the deposit was made.
According to the disclosure, the biological material identified as “BRA-F-F2F8” was deposited at BCCM/MUCL on 11/24/2021 under the Budapest Treaty (Table 1, page 56) and found viable on 12/20/2021 (Viability Statement Issued Pursuant to Rule 10.2 by BCCM/MUCL, page 2). However, there is no indication with regards to its public availability.
Thus, an affidavit or declaration by applicant, or a statement by the attorney of record over his/her signature and registration number, stating that the biological material will be released to the public irrevocably and without restriction or condition upon the issuance of a patent, would satisfy the requirement. Furthermore, applicant must state that the deposited material will be maintained for a period of 30 years, or 5 years after the most recent request date, whichever is longer.
Claims 1-7, 9-11, 13-14, and 17-21 are rejected under 35 U.S.C. 112(a) as failing to comply with the written description requirement. The claims contain subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor at the time the application was filed, had possession of the claimed invention.
The claimed invention is drawn to a plant-seed containing composition or an agriculturally active composition comprising a fungal strain or a functional homologue thereof, as well as a method of using the fungal strain or functional homologue.
However, the specification fails to demonstrate that applicant was in possession of the claimed invention involving the entire genus encompassing “a fungal strain or a functional homologue thereof”. Applicant’s disclosure is limited only to Penicillium bialowiezense strain “BRA-F-F2F8” (deposited under accession number 58178) per se.
To satisfy the written description aspect of 35 U.S.C. 112(a) for a claimed genus of a chemical or biological material, it must be clear that: (1) the identifying characteristics of the claimed material have been disclosed, e.g., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed cor-relation between function and structure, or by a com-bination of such identifying characteristics; and (2) a representative number of species within the genus must be disclosed. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406.
In this case, the instant application fails to provide sufficient identifying characteristics of the “fungal strain” and “functional homologue” (it is noted that applicant defined the term “functional mutant” as referring to a genetically modified fungal strain in page 16 of the specification, but it is considered by the examiner to be not identical to “functional homologue”). The claims define the fungal strain as comprising “a nuclear ribosomal internal transcribed spacer (ITS) polynucleotide having at least 97.4% sequence identity to SEQ ID NO: 1”, and the functional homologue as comprising “an ITS polynucleotide having at least 98% sequence identity to SEQ ID NO: 1 and a genome having at least 98% identity over the entirety of the genome” of the deposited P. bialowiezense strain. Although the ITS sequence of BRA-F-F2F8 was submitted (SEQ ID NO: 1) and experimental results demonstrate that said strain possesses the ability to increase a plant’s biomass, height, yield, and emergence when applied to a seed at a particular amount, applicant did not identify what structures impart these various properties and shared by the fungal strain and all functional homologues. In addition, ITS sequence does not have enough variation to reliably distinguish different strains. Raja et al. (Journal of Natural Products 2017, Vol. 80, pages 756-770), for instance, states that ITS is recognized as the official DNA barcode marker for fungi but it is typically relied only for species identification of fungi (section 2, page 759; Figure 5, page 760) as supported by Iquebal et al. (Journal of Fungi 2021, Vol. 7, article 288, pages 1-15; first paragraph, page 2). Raja et al. also teaches that the ITS region does not work well in some genera like Penicillium since they have narrow or no barcode gaps in their ITS regions, and that there is no cutoff value for species determination that can be applied across all groups of fungi (section 2, page 760).
Review of the specification also fails to show disclosure of a representative number of species within the genus. The number of strains encompassed by “fungal strain” and “functional homologue” as defined by the claims is numerous, but applicant only disclosed one representative. In the absence of a functional homologue that is identified and exemplified, the specification is considered to only show reduction of practice of P. bialowiezense strain BRA-F-F2F8 (accession number 58178). Hence, the specification does not disclose a representative number of species for a broad genus as is encompassed by the breadth of “a fungal strain or a functional homologue thereof”, as required to support the written description requirement.
Accordingly, claims 1-7, 9-11, 13-14, and 17-21 lack sufficient written description under 35 USC 112(a).
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claims 2-3 and 19 are rejected under 35 U.S.C. 112(d) as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Claim 2 depends on claim 18, which is not a preceding claim, and thus does not comply with one of the two requirements for a dependent claim. Similarly, claim 10 depends on claim 19, which is not a preceding claim. MPEP § 608.01(n)(III) states that “In accordance with 35 U.S.C. 112(d), or pre-AIA 35 U.S.C. 112, fourth paragraph, a claim in dependent form shall contain: (i) a reference to a claim previously set forth, and (ii) then specify a further limitation of the subject matter claimed”. Hence, claim 2 is an improper dependent claim. Claim 3 is also considered an improper dependent claim because it depends on claim 2.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 13-15 and 20-21 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a law of nature and natural phenomenon without significantly more.
The United States Patent and Trademark Office (USPTO) issued a revised guidance for evaluating subject matter eligibility, referred to as “2019 Revised Patent Subject Matter Eligibility Guidance”, which became effective on January 7, 2019 (see 84 Fed. Reg. 50) and updated on October 2019 and July 2024. In the instant application, claims 13-15 and 20-21 recite a law of nature and natural phenomenon. The judicial exception is not integrated into a practical application, and the claims do not include additional elements that are sufficient to amount to significantly more than said judicial exception as explained below:
Subject Matter Eligibility Guidance
A three-step inquiry has been established to determine subject matter eligibility under 35 U.S.C. 101, in accordance with MPEP 2106:
Step (1). Is the claim directed to a process, machine, manufacture, or composition of matter?
Step (2A). Is the claim directed to a law of nature, natural phenomenon (product of nature), or an abstract idea?
Prong 1 – Does the claim recite a law of nature, natural phenomenon, or an abstract idea?
Prong 2 – If the claim recites a judicial exception, does it recite additional elements that integrate the judicial exception into a practical application? Limitations that are indicative of integration into a practical application include:
Improvements to the functioning of a computer, or to any other technology or technical field. See MPEP 2106.05(a)
Applying or using a judicial exception to effect a particular treatment or prophylaxis for a disease or medical condition. See Vanda Memo
Applying the judicial exception with, or by use of, a particular machine. See MPEP 2106.05(b)
Effecting a transformation or reduction of a particular article to a different state or thing. See MPEP 2106.05(c)
Applying or using the judicial exception in some other meaningful way beyond generally linking the use of the judicial exception to a particular technological environment, such that the claim as a whole is more than a drafting effort designed to monopolize the exception. See MPEP 2106.05(e) and Vanda Memo.
Step (2B). If the recited judicial exception is not integrated into a practical application, does the claim recite additional elements that amount to significantly different than the judicial exception such that they provide an inventive concept? This step includes evaluation of the same considerations under Step (2A), Prong 2, as well as two additional considerations:
Adding a specific limitation or combination of limitations that are not well-understood, routine, conventional activity in the field, which is indicative that an inventive concept may be present; and
Simply appending well-understood, routine, conventional activities previously known to the industry, specified at a high level of generality, to the judicial exception, which is indicative that an inventive concept may not be present.
Analysis in View of the Interim Guidance
The answer to Step (1) is “yes” since the claims are directed to a composition of matter, which is a statutory category.
The answer to Step (2A) is “yes” because the claimed composition is directed to a law of nature and natural phenomenon, specifically natural products.
Prong 1: The claimed composition comprises “a fungal strain or a functional homologue thereof”. Claims 13-15 define the fungal strain or functional homologue as comprising a nuclear ribosomal ITS polynucleotide having at least 97.4% sequence identity to SEQ ID NO: 1, which is the DNA sequence of P. bialowiezense BRA-F-F2F8 deposited under accession number 58178, or is said deposited strain and therefore recite a natural product. Claim 13 requires that the claimed composition further contains “a plant seed” which is a product of nature, while claim 14 stipulates that it can additionally contain “one or more agriculturally acceptable auxiliaries, a solvent, a carrier, a surfactant, a sticker, an antifreeze agent, a thickener, a buffering agent, an antifoaming agent, an antioxidant, a preservative, an aroma, a colorant, or a combination thereof” which encompass products of nature (ex. water is a natural solvent and carrier, soybean lecithin is a natural surfactant, plant starches and gums like guar gum are natural thickeners). Accordingly, the claimed composition is mixture of natural products, i.e., a nature-based product. There is no evidence clearly showing that the claimed composition is markedly different from a P. bialowiezense strain as it occurs in nature.
Prong 2: Claim 14 recites that the claimed composition can alternatively be “a liquid composition, an aqueous composition, a sprayable liquid or a concentrate, a non-liquid composition, or a powder” and/or “comprises fungal strain or a functional homologue thereof at an amount of at least about 102 CFU/g”. Neither the specified formulation nor amount causes a transformation or reduction to a different state or thing. Moreover, none of these alternative limitations limits the natural products to a particular field of application. Claims 20-21 merely require that the fungal strain/functional homologue is coated on the plant seed or specify the type of plant seed. Thus, there are no additional elements that integrate the recited judicial exception into a practical application.
The answer to Step (2B) is “no”. Formulating the fungal strain or functional homologue thereof as a composition suitable for application to plants including plant seeds is well-understood and conventional in the art. Murphy et al. (WO 2019/115582 A1; IDS cited), for example, teaches combining a fungal endophyte with a carrier medium to provide a seed coating composition that can be applied to a seed. The fungal endophyte is selected from a species of Penicillium, Alternaria, or Cladosporium and having a nuclear ribosomal ITS selected from SEQ ID NOs: 3, 4, 5, 10, 11, or 12 (lines 14-16 & 30-36, page 3). The carrier medium is selected from a group that includes water, emulsified suspension, and wettable powder (lines 33-35, page 5).
Hence, claims 13-15 and 20-21 are directed to a judicial exception and do not qualify as eligible subject matter.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 1-4, 6, 9-11, 13-14, and 17-21 are rejected under 35 U.S.C. 102(a)(1)/102(a)(2) as being anticipated by Murphy et al. (Pub. No. WO 2019/115582 A1).
Murphy et al. discloses a seed coating composition comprising a fungal endophyte isolated from a tissue of Hordeum murinum and a carrier medium, as well as a seed coated or encapsulated with said seed coating composition (Abstract; lines 18-19, page 7). In one aspect, the fungal endophyte is selected from an Alternaria sp., a Penicillium sp., or a Cladosporium sp. and has a nuclear ribosomal internal transcribed spacer (nrlTS) selected from SEQ ID NOs: 3, 4, 5, 10, 11 or 12 (lines 30-36, page 3).
Moreover, Murphy et al. teaches a method of producing a plant from a target seed comprising: (i) coating the target seed with the disclosed composition; (ii) planting the coated seed in an appropriate medium; (iii) growing the plant from the seed; and (iv) harvesting a crop from the plant (lines 27-20 & 36-37, page 7).
Murphy et al. reads on the instant application as follows:
Regarding claim 1: coating the target seed with the disclosed composition containing a fungal endophyte isolated from a tissue of Hordeum murinum such as Penicillium (lines 27-28, page 7) is the same as “administering the fungal strain or functional homologue thereof to the plant, a part thereof, a seed”.
Planting the coated seed and growing the plant from the seed (lines 29 & 36-37, page 7) meets the intended function “for growing the plant, or the location of the plant”.
The fungal endophyte being a Penicillium species having a nuclear ribosomal ITS of SEQ ID NO: 3, which is 97.8% identical to applicant’s SEQ ID NO: 1 (see below), satisfies “wherein the fungal strain comprises a nuclear ribosomal internal transcribed spacer (ITS) polynucleotide having at least 97.4% sequence identity to SEQ ID NO: 1”.
Best Local Similarity 97.8%;
Matches 487; Conservative 0; Mismatches 11; Indels 0; Gaps 0;
Qy 3 TTTACCTTGTTGCTTCGGCGAGCCTGCCTTTTGGCTGCCGGGGGACGTCAGTCCCCGGGT 62
|||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||
Db 48 TTTACCTTGTTGCTTCGGCGAGCCTGCCTTTTGGCTGCCGGGGGACATCTGTCCCCGGGT 107
Qy 63 CCGTGCTCGCCGGAGACACCTTAGAACTCTGTCTGAAGATTGTAGTCTGAGATTAAATAT 122
||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||
Db 108 CCGCGCTCGCCGAAGACACCTTAGAACTCTGTCTGAAGATTGTAGTCTGAGATTAAATAT 167
Qy 123 AAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGC 182
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 168 AAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGC 227
Qy 183 GAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCAC 242
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 228 GAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCAC 287
Qy 243 ATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGC 302
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 288 ATTGCGCCCTCTGGTATTCCGGAGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGC 347
Qy 303 ACGGCTTGTGTGTTGGGCCCCGTCCTCCTTCCGGGGGACGGGTCCGAAAGGCAGCGGCGG 362
|||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||
Db 348 ACGGCTTGTGTGTTGGGCTCCGTCCTCCTTCCGGGGGACGGGCCCGAAAGGCAGCGGCGG 407
Qy 363 CACCGCGTCCGGTCCTCAAGCGTATGGGGCTTTGTCACTCGCTTTGTAGGCCTGGCCGGC 422
|||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||
Db 408 CACCGCGTCCGGTCCTCAAGCGTATGGGGCTTTGTCACCCGCTTTGTAGGACTGGCCGGC 467
Qy 423 GCTTGCCGATCAACCAAACTTTTTATCAGGTTGACCTCGGATCAGGTAGGGATACCCGCT 482
|| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
Db 468 GCCTGCCGATCAACCAAACTTTTTTCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCT 527
Qy 483 GAACTTAAGCATATCAAA 500
||||||||||||||||||
Db 528 GAACTTAAGCATATCAAA 545
Regarding claims 2 and 18: using the disclosed composition to increase one or more traits in a plant including grain dry weight, number of heads, and number of grains per head (lines 4-9, page 8) fulfills “wherein the administration improves a plant growth feature of the plant as compared to an otherwise identical plant which has not been administered the fungal strain or functional homologue thereof” and “wherein the plant growth feature comprises biomass, height, yield, emergence, or any combination thereof”.
Regarding claim 3: the prior art’s working example shows that coating seeds with a Penicillium strain having an ITS of SEQ ID NO: 3 increased the average number of heads, average number of grains, and average number of grain dry weight by 11.7%, 67.8%, and 13.8% compared to the negative control, respectively (Table 3, page 21). These results read on “wherein the biomass, height, yield, and/or emergence of the plant is each independently increased by at least about 2%”.
Regarding claim 4: the Penicillium strain having a nuclear ribosomal ITS of SEQ ID NO: 3 that shares 97.8% identity with applicant’s SEQ ID NO: 1 (as shown in the previous page) is equivalent to “wherein the fungal strain comprises an ITS polynucleotide having at least 97.8%”.
Regarding claim 6: the fungal endophyte being a Penicillium strain is identical to “wherein the fungal strain is a strain of the genus Penicillium”.
Regarding claim 9: the prior art also teaches treating the seeds with more than one fungal endophyte, such as all of the disclosed fungal strains which increased grain dry weight, number of heads, and number of grains per head (lines 11-12, page 18; Table 3, page 21), thereby meeting the limitation “administering to the plant, the part thereof, the seed for growing the plant, or the location comprising the plant one or more additional plant-beneficial microorganisms”.
Regarding claims 10 and 19: as set forth above (see Claim Objections section), claim 10 is missing some words after the phrase “wherein the agricultural active composition”. In the interest of compact prosecution, claim 10 is treated as if it recites “comprises one or more agriculturally acceptable auxiliaries, a solvent, a carrier, a surfactant, a sticker, an antifreeze agent, a thickener, a buffering agent, an antifoaming agent” before “antioxidant, a preservative, an aroma, a colorant, or a combination thereof”.
Applying the disclosed composition comprising the fungal endophyte and a carrier medium like water to a seed (lines 33-35, page 5; lines 18-20, page 18) corresponds to “a solvent, a carrier” and satisfies the requirement that the administering step comprises “administering an agricultural active composition comprising the fungal strain or functional homologue thereof”.
Regarding claim 11: coating the target seed with the disclosed composition prior to planting the coated seed in an appropriate medium and growing the plant from the seed is analogous to “administering the fungal strain or functional homologue thereof to the plant, the part thereof, the seed for growing the plant, or the location comprising the plant occurs prior to planting the seed, at planting, or after planting and before germination”.
Regarding claim 13: the seed coated or encapsulated with the disclosed seed coating composition (lines 18-19, page 7) comprising the fungal endophyte, which can be present in the amount of 200,000 spores per seed or 2 x 105 spores/seed (lines 18-19, page 18) is comparable to “A composition comprising a plant seed and at least 10 CFU of a fungal strain or a functional homologue thereof”.
One applicable fungal endophyte is a Penicillium species having a nuclear ribosomal ITS of SEQ ID NO: 3, which is 97.8% identical to applicant’s SEQ ID NO: 1. This teaching fulfills “wherein the fungal strain comprises a nuclear ribosomal internal transcribed spacer (ITS) polynucleotide having at least 97.4% sequence identity to SEQ ID NO: 1”.
Regarding claim 14: the disclosed seed coating composition comprising one or more fungal endophytes isolated from H. murinum (Abstract; lines 30-36, page 3) is the same as “An agricultural active composition comprising a fungal strain or a functional homologue thereof”.
The fungal endophyte being a Penicillium species having a nuclear ribosomal ITS of SEQ ID NO: 3 that shares 97.8% identity with applicant’s SEQ ID NO: 1 is considered equivalent to “wherein the fungal strain comprises a nuclear ribosomal internal transcribed spacer (ITS) polynucleotide having at least 97.4% sequence identity to SEQ ID NO: 1”.
The disclosed composition also comprises a carrier medium such as water (line 32, page 3; lines 33-35, page 5; lines 18-20, page 18), thereby meeting “wherein the composition comprises one or more agriculturally acceptable auxiliaries, a solvent, a carrier…”.
Having water as the carrier medium indicates the disclosed composition is provided in the form of a liquid, specifically an aqueous composition, which satisfies the alternative limitation that the composition “is a liquid composition, an aqueous composition…”.
Regarding claim 17: an example of the seed being coated with the disclosed seed composition and then planted is barley seed. This teaching satisfies “wherein the plant is a monocotyledon, wheat, maize, barley…”
Regarding claim 20: the seed being coated with the fungal endophyte is identical to “wherein the plant seed is coated with the fungal strain or functional homologue thereof”.
Regarding claim 21: barley seed corresponds to “wherein the plant seed is a monocotyledon, a cereal, wheat, maize, barley…”.
Conclusion
No claim is allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to MICHELLE F PAGUIO FRISING whose telephone number is (571)272-6224. The examiner can normally be reached Monday-Friday, 8:00 a.m. - 4:00 p.m..
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Melenie L. Gordon can be reached at (571) 272-8037. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/Michelle F. Paguio Frising/Primary Examiner, Art Unit 1651
Prosecution Insights