Prosecution Insights
Last updated: April 19, 2026
Application No. 18/727,281

FOLDING OLIGONUCLEOTIDES

Non-Final OA §103§112
Filed
Jul 08, 2024
Examiner
SULLIVAN, STEPHANIE LAUREN
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Rna Morph Ltd.
OA Round
3 (Non-Final)
62%
Grant Probability
Moderate
3-4
OA Rounds
3y 6m
To Grant
98%
With Interview

Examiner Intelligence

Grants 62% of resolved cases
62%
Career Allow Rate
38 granted / 61 resolved
+2.3% vs TC avg
Strong +36% interview lift
Without
With
+35.7%
Interview Lift
resolved cases with interview
Typical timeline
3y 6m
Avg Prosecution
58 currently pending
Career history
119
Total Applications
across all art units

Statute-Specific Performance

§101
5.7%
-34.3% vs TC avg
§103
32.4%
-7.6% vs TC avg
§102
15.1%
-24.9% vs TC avg
§112
30.8%
-9.2% vs TC avg
Black line = Tech Center average estimate • Based on career data from 61 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Continued Examination Under 37 CFR 1.114 A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 09/11/2025 has been entered. Response to Amendment Receipt of Arguments/Remarks filed on 09/11/2025 is acknowledged. Claims 1-17,19 and 20 were/stand cancelled. Claims 18,25-27,30,32,35 and 38 were amended and claims 40 and 41 are new. Claims 18 and 21-41 are pending. In consideration of the amendment and in reconsideration of the prior office actions and responses thereto, rejections and/or objections not reiterated from previous office actions are hereby withdrawn. Claims 18 and 21-41 are under examination. Claim Objections Claim 18 is objected to because of the following informalities: Line 8 of claim 18 recites “consisting of” and should recite “consists of” for proper grammar. Appropriate correction is required. Claim 31 is objected to because of the following informalities: lines 1-2 recite “wherein said heterologous oligonucleotide comprises in a delivery vector or a host cell”, and for better clarity should recite “wherein said heterologous oligonucleotide is comprised in a delivery vector or a host cell”. This was objected to in the previous office action and applicant did not amend the claim. Appropriate correction is required. Claim 35 is objected to because of the following informalities: recites “first and third sequences of nucleic acids” rather than “first and third sequences of nucleotides” in order to improve consistency and clarity. Claim 1 recites “first sequence of nucleotides” and “third sequence of nucleotides”. Appropriate correction is required. Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 18,21-29,31-35,40 and 41 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. Claims 18,21-29,31-35,40 and 41 encompass a method for hybridizing at least a portion of a large genus of heterologous oligonucleotides to a large genus of human mRNA or pre-mRNA target molecules. The method comprises bringing a human target cell into contact with the genus of heterologous oligonucleotides and hybridizing a genus of human mRNA or pre-mRNA target molecules with the heterologous oligonucleotide. The hybridization of the heterologous oligonucleotide with the human mRNA or pre-mRNA target molecule results in said first sequence and said third sequence of nucleotides masking the regions that are complementary to said first sequence of nucleotides and said third sequence of nucleotides in the human mRNA or pre-mRNA target molecule and exposing said second sequence of nucleotides, thereby rectifying the target sequence in the human mRNA or pre-mRNA target molecule and/or introducing an external motif to the human mRNA or pre-mRNA target molecule, and wherein said second sequence of nucleotides does not replace a full exon sequence in said human mRNA or pre-mRNA target molecule. Claims 30 and 36-39 recite specific heterologous oligonucleotides, Ocirc1-Ocirc8 of SEQ ID NOs: 12-19, and are therefore not included in this rejection. Regarding the large genus of heterologous oligonucleotides as recited in claims 18,21-29,31-35,40 and 41, Berger et al. (WIREs RNA, 7:487-498, July/August 2016), cited on an IDS, teach spliceosome-mediated RNA trans-splicing, or SMaRT, as a gene therapy strategy, and that an artificial RNA, called a pre-mRNA trans-splicing molecule is engineered to specifically target endogenous pre-mRNA expressed in a target cell (page 489, left column). Berger et al. teach the PTM must bind the target pre-mRNA and induce the trans-splicing reaction more efficiently than the cis-splicing one (page 487, right column). Berger et al. teach a typical PTM is composed of 1) a binding domain able to recognize the target intron on the endogenous pre-mRNA, 2) an artificial intron to catalyze the splicing reaction, and 3) the cDNA containing the coding sequence of substitution, and that the order of the elements in the PTM depends on the location of the exon to be replaced in the target mRNA (page 489, right column). Additionally, Tockner et al. (Gene Therapy 23, 775-784, 11 August 2016) teach RNA trans-splicing as a versatile tool in the gene therapy of monogenetic diseases, including correcting mutations in large genes such as COL7A1 (Abstract). Tockner et al. teach an RNA trans-splicing molecule, RTM28 as able to induce accurate trans-splicing into endogenous COL7A1 pre-mRNA transcripts in cell lines (Abstract). Tockner et al. teach RTMs containing one or more specific BDs complementary to the selected Col7A1 target region intron 46/exon 47 (Figure 2A, page 778). Therefore, both Berger et al. and Tockner et al. teach that RNA trans-splicing molecules contain binding domains that recognize and are complementary to a specific target region of a specific gene. Vashi et al. (Mammalian Genome 30: 90-110, Published 28 February 2019) teach a causative gene for Rhett syndrome disorder is mutations in methyl CpG-binding protein 2 (MECP2), and that de novo mutations in MECP2 account for 95% of typical RTT cases, and that nearly 600 RTT-causing mutations have been identified in MECP2, but that only 8 missense and nonsense mutations account for approximately 70% of mutations in RTT (page 91, left column). When claims 18,21-29,31-35,40 and 41 are analyzed in light of the specification, the instant invention encompasses methods for rectifying a mutant MeCP2 gene in a cell and that there are various types of mutations in the MeCP2 gene including a mutation in the splicing site between the 3rd intron and the 4th exon, which is a C to G mutation that abolishes the normal splicing site and causes a mis-splicing event (pages 9-10). Also, as seen above by Vashi et al., nearly 600 RTT-causing mutations have been identified in MECP2 which shows the large number of possible mutations in just this one gene, and the claims encompass the method occurring with any human mRNA or pre-mRNA target molecule. The instant examples discuss folding oligonucleotides Ocirc 1, Ocirc 2 and Ocirc 3, which correspond to SEQ ID NOs: 12-14 and constructed as shown in Figure 13, and correspond to the folding oligonucleotide in Figures 7-9 (Example 1, pages 19-20). Page 19 discusses that the arms of the folding oligonucleotides pair with the sequence bridging the end of the 3rd intron and the beginning of the 4th exon of MECP2. Page 20 shows that the folding oligonucleotides comprise a PPT portion where part of the original PPT sequence of intron 4 is replaced with a new sequence which is part of the Ocirc molecule (See also Figures 7-9). Example 3, page 44 shows the design and production of the Ocirc RNA oligonucleotides and that RNA oligonucleotides were designed to match a specific sequence in the 3’ region of the human MECP2 3rd intron, and Figure 16 shows the structure of the RNA oligonucleotides after binding. Example 3, page 44 states the dashed line is the RNA sequence between the arms of the Ocirc molecule and in this example is a PPT sequence that binds the spliceosome proteins, but can be any sequence of choice. Example 3, pages 44-45 disclose Ocirc oligonucleotides 1-8, corresponding to SEQ ID NOs: 12-19. Example 6 shows the testing of Ocirc antisense oligonucleotides in HEK293 cells, and that the results showed the Ocirc RNA is capable of entering the cell nuclease, binding to its target sequence and decreasing expression of a target gene on the RNA level (pages 49 and 56). Therefore, these specific sequences of the Ocirc oligonucleotides recited in instant claims 30 and 36-39 pair with specific portions of sequences of MECP2, and would not be able to hybridize with other human mRNA or pre-mRNA target molecules, and therefore have sufficient written description. In addition, the examiner aligned all of the Ocirc oligonucleotide sequences of SEQ ID NOs: 12-19 and found that the sequence common to all of them is CCCCTTATTCGTCCCC. See the alignment of SEQ ID NOs: 12-19 below where the common sequence is in bold. SEQ ID NO:12 5 AAAGACGCCCCCTTATTCGTCCCCGCCTGGG 35 SEQ ID NO:13 6 AAGACCGCCCCCTTATTCGTCCCCGCTGGGG 36 SEQ ID NO:14 8 AAGCCCCCTTATTCGTCCCC 27 SEQ ID NO:15 23 GCCCCCTTATTCGTCCCCGCCTGGGGACAA 52 SEQ ID NO:16 22 ACGCCCCCTTATTCGTCCCCGCTGGGGACAAA 53 SEQ ID NO:17 23 CCCCCTTATTCGTCCCC 39 SEQ ID NO:18 6 ACAGAAAGACGCCCCCTTATTCGTCCCCGCCTGGG 40 SEQ ID NO:19 30 GCCCCCTTATTCGTCCCCGCCTGGG 54 The second sequence of nucleotides is recited in claim 18 as comprising a sequence that rectifies a mutation in the target sequence of the human mRNA or pre-mRNA target molecule, and/or a sequence that serves as a recognition site for an RNA binding element. Based on the common sequence above for SEQ ID NOs: 12-19, it seems that this common sequence may be part of the second sequence of nucleotides. However, the genus of heterologous oligonucleotides as claimed in claims 18,21-29,31-35,40 and 41 encompasses a large number of variants and molecules that have a different structure, and the specification does not describe an essential structure or core structure of a representative number of species of the large genus of heterologous oligonucleotides that have the function of upon hybridization with the human mRNA or pre-mRNA target molecule, the first sequence and third sequence of nucleotides mask the regions that are complementary to said first and third nucleotide sequences in the human mRNA or pre-mRNA target molecule and expose said second sequence of nucleotides, thereby rectifying the target sequence in the human mRNA or pre-mRNA target molecule, and wherein the second sequence of nucleotides does not replace a full exon sequence in said human mRNA or pre-mRNA target molecule. There is a lack of structure-function correlation for the entire genus of heterologous oligonucleotides as presented in the instant claims. As shown above, the specification shows specific structures of Ocirc oligonucleotides of SEQ ID NOs: 12-19 and that the arms of the folding oligonucleotides pair with the sequence bridging the end of the 3rd intron and the beginning of the 4th exon of MECP2 and the folding oligonucleotides comprise a PPT portion where part of the original PPT sequence of intron 4 is replaced with a new sequence which is part of the Ocirc molecule (Pages 19,20; Figures 7-9). The specification does not provide written description for the method of hybridizing other heterologous oligonucleotides to other human mRNA or pre-mRNA target molecules in a human target cell, and wherein upon hybridization with the human mRNA or pre-mRNA target molecule, the first sequence and third sequence of nucleotides mask the regions that are complementary to said first and third nucleotide sequences in the human mRNA or pre-mRNA target molecule and expose said second sequence of nucleotides, thereby rectifying the target sequence in the human mRNA or pre-mRNA target molecule, and wherein the second sequence of nucleotides does not replace a full exon sequence in said human mRNA or pre-mRNA target molecule, other than the Ocirc oligonucleotides of SEQ ID NOs: 12-19 and that the target human mRNA is MECP2, that has the recited function. The specification discloses the specific structure for the second sequence of oligonucleotides as comprising a PPT portion where part of the original sequence of intron 4 of MECP2 is replaced with a new sequence which is part of the Ocirc molecule (Pages 19,20; Figures 7-9) and is further evidenced by the underlined sequence within intron 3 of MECP2 in Figure 16. Example 3 on page 44 further describes Figure 16, and that the underlined area is the PPT sequence of the human MECP2 gene, and the PPT sequence is designed to bind the spliceosome proteins. See also Nelson et al. (Genes and Development 3:1562-1571, 1989), cited on an IDS, Figure 7 which shows that U2AF binds to the 3’ splice site/polypyrimidine tract of the pre-mRNA and recruits U2 snRNP. PNG media_image1.png 67 343 media_image1.png Greyscale As explained above, the number of species disclosed by complete structure and the lack of structure-function correlation for the claimed broad genus of heterologous oligonucleotides is not sufficient to demonstrate possession of the full invention as claimed at the time of filing. Applicant’s attention is directed to the Guidelines for the Examination of Patent Applications Under the 35 U.S.C. 112(a) or Pre-AIA 35 U.S.C. 112, first paragraph, "Written Description" Requirement (MPEP2163). In conclusion, Applicant’s disclosure of Ocirc oligonucleotides of SEQ ID NO: 12-19 for the claimed broad genus of heterologous oligonucleotides and MECP2 as the mRNA or pre-mRNA target molecule for the genus of human mRNA or pre-mRNA target molecules, is not deemed sufficient to reasonably convey to one skilled in the art that the instant disclosure was in possession of the claimed broad genus at the time the application was filed. Thus, it is concluded that the written description requirement is not satisfied for the claimed genus. Response to Arguments Applicant's arguments filed 09/11/2025 have been fully considered but they are not persuasive. Applicant argues on pages 6-7 of response that they have amended the claims as discussed during the interview, rending this rejection moot. Applicant has amended claim 18 to recite “the heterologous oligonucleotide consisting of the first, second and third sequence of nucleotides”, with a length range of each of the nucleotides, and defines that the “target sequence comprising a PPT sequence and/or splice acceptor site”. This is not found persuasive. While adding more structure to the heterologous oligonucleotide was recommended to help with the written description requirement, no specific agreement was reached. The claims as amended still encompass hybridizing at least a portion of a large genera of heterologous oligonucleotides to a large genus of human mRNA or pre-mRNA target molecules in a human target cell that comprises a large genus of human mRNA or pre-mRNA target molecules that result in the first and third sequences of oligonucleotides of the heterologous oligonucleotide masking the regions that are complementary to said first and third sequences of nucleotides in the human mRNA or pre-mRNA target molecule and expose the second sequence of nucleotides, thereby rectifying the target sequence in the human mRNA or pre-mRNA target molecule and/or introducing an external motif to the human mRNA or pre-mRNA target molecule. The amendment to claim 18 regarding that the target sequence comprises a PPT sequence and/or a splice acceptor site does not provide structure to the heterologous oligonucleotide that has the recited function. While adding a range of lengths to each of the first, second and third sequences of nucleotides making up the heterologous oligonucleotide adds more structure, it still does not provide a core structure of the heterologous oligonucleotide that is common to the species of the genes that performs the recited functions. More structure is especially needed for the second sequence of oligonucleotides, as this is the sequence that is recited to rectify a mutation in the target sequence in the human mRNA or pre-mRNA target molecule and/or serves as a recognition site for an RNA binding element. Reciting the length of the second sequence does not impart structure that shows what the sequence is that is responsible for performing the recited functions. Therefore, the examiner is maintaining the 35 U.S.C. 112(a) Written Description rejection. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. Claims 18,21-29,31-35,40 and 41 are rejected under 35 U.S.C. 103 as being unpatentable over Berger et al. (WIREs RNA, 7:487-498, July/August 2016), cited on an IDS, in view of Mitchell et al. (WO 03/104412, Published 18 Dec 2003), cited in the office action dated 10/24/2024. Claim Interpretation: The wherein statements in claims 18 and 23 (wherein upon hybridization of the heterologous oligonucleotide with the human mRNA or pre-mRNA target molecule said first sequence and said third sequence of nucleotides mask the regions that are complementary to said first sequence of nucleotide and third sequence of nucleotides in the human mRNA or pre-mRNA target molecule and expose said second sequence of nucleotides, thereby rectifying the target sequence in the human mRNA or pre-mRNA target molecule and/or introducing an external motif to the human mRNA or pre-mRNA target molecule; wherein hybridization of the heterologous oligonucleotide with the human mRNA or pre-mRNA target molecule masks a mutation in the human mRNA or pre-mRNA target molecule and aligns the second sequence of nucleotides such that the sequence of the human mRNA or pre-mRNA target molecule comprising the mutation is replaced with the sequence of a wildtype pre-mRNA or mRNA, thereby allowing the translation of a functional protein) would be carried out by the step of bringing an oligonucleotide of the same structure recited in instant claim 18 into contact with a human target cell. Regarding claims 18,21,23,27,28 and 32 Berger et al. teach spliceosome-mediated RNA trans-splicing or SMaRT as a gene therapy strategy, and that an artificial RNA, called a pre-mRNA trans-splicing molecule (PTM) is engineered to specifically target endogenous pre-mRNA expressed in a target cell (page 489, left column). Berger et al. teach the structure of a PTM and mode of action of trans-splicing in Figure 1(d) below: PNG media_image2.png 236 442 media_image2.png Greyscale Berger et al. teach the PTM must bind the target pre-mRNA and that a typical PTM is composed of 1) a binding domain able to recognize the target intron on the endogenous pre-mRNA, 2) an artificial intron to catalyze the splicing reaction, and 3) the cDNA containing the coding sequence of substitution, and that the order of the elements in the PTM depends on the location of the exon to be replaced in the target mRNA (page 489, right column). Figure 1(d) (above) shows the orientation of a PTM for replacement of an internal exon (page 489, right column). Therefore, Fig 1(d) teaches a PTM with a first sequence complementary in the 3’-5’ direction to a region in a pre-mRNA target, a second sequence comprising a sequence that rectifies a point mutation in the internal exon, and a third sequence complementary in the 3’-5’ direction to a region in the pre-mRNA target upstream to the hybridization site. Berger et al. teach that SMaRT can be used for repair of mutations at the mRNA level, and has been evaluated for a significant number of recessive pathologies in which studies have shown that it is possible to partially correct the cellular pool of mutated mRNA (page 490, right column). Berger et al. also teach design of PTM’s, and shows the pre-mRNA target as comprising a PPT, branch point and splice acceptor sites (Fig 2), and that the PTM is composed of a binding domain, artificial intron containing a PPT, branch point, a 3’-acceptor site, and replacement cDNA containing the coding sequence of the exon to be corrected. PNG media_image3.png 244 605 media_image3.png Greyscale Berger et al. also teach that combining a PTM with antisense oligonucleotide capable of blocking the splice-site targeted by the PTM increases the trans-splicing rate (page 492, right column). Berger teach aspects of the PTM’s design, target, environment and delivery can be modulated and are constantly improved leading to better understanding (page 493, left column). Berger et al. does not teach the length of the first, second and third sequences of nucleotides of the heterologous oligonucleotide recited in instant claim 18, or a method of bringing the heterologous oligonucleotide into contact with a human target cell or that the second sequence does not replace a full exon sequence in the human pre-mRNA target molecule. However, before the effective filing date, Mitchell et al. teach pre-trans-splicing molecules (PTMs) comprising (i) one or more target binding domains that targets binding of the PTM to a pre-mRNA, (ii) a 3’-splice region that includes a branch point, pyrimidine tract and a 3’-splice acceptor site and/or 5’-splice donor site and (iii) may also include binding domains targeted to intron sequences in close proximity to the 3’ or 5’ splice signals of the target intron (page 11, lines 24-30). Mitchell et al. teach the PTM can contain any nucleotide sequence encoding a translatable protein product (page 12, lines 2-3) and the target binding domain may contain multiple domains which are complementary to and in anti-sense orientation to the targeted region of the pre-mRNA, and the binding domains may comprise at least 10-30 nucleotides (page 12, lines 22-26). Mitchell et al. teach a second target binding region may be placed at the 3’ end of the molecule (page 12, line 32- page 13, line 1). Mitchell et al. teach transfecting constructs comprising PTM sequences into human embryonic kidney cells (page 37, lines 30-32). Mitchell et al. teach the PTMs of the invention may be used to correct genetic mutations found to be associated with genetic diseases, and can be used to replace internal exons (page 6, lines 29-31). Regarding claim 22, Berger et al. teach the open circle structure of the PTM upon hybridization with the pre-RNA target molecule as shown in Figure 1(d) above. Berger et al. does not teach that the PTM is synthesized as a linear single-stranded molecule. However, Mitchell et al. teach the PTM comprises a target binding domain, and that although the target binding domain may be “linear”, it is understood that the RNA will very likely fold to form second structures that may stabilize the complex, thereby increasing efficiency of splicing (page 12, lines 29-31). Mitchell et al. teach the nucleic acid molecules of the invention may be single-stranded (page 23, lines 13-14). Regarding claim 24, Berger et. all teaches trans-splicing only requires the delivery of the engineered PTM, and the other two components of the reaction (targeted pre-mRNA and spliceosome) are naturally present in the target cell. The examiner is interpreting the spliceosome as the cellular complex in instant claim 24. Berger et al. does not explicitly teach the second sequence of nucleotides binds to a cellular complex. Mitchell et al. cures this deficiency. Mitchell et al. teach spliceosome-mediated targeted trans-splicing (page 6, lines 6-7). Mitchell et al. teach a PTM with a target binding domain which endows the PTM with a binding affinity for the target pre-mRNA and anchors the pre-mRNA closely in a space to the synthetic PTM so that the spliceosome processing machinery in the nucleus can trans-splice a portion of the synthetic PTM to a portion of the pre-mRNA (page 12, lines 16-21). Regarding claim 25, Berger et al. does not teach wherein the first, second and third sequence of nucleotides are ribonucleotides. However, Mitchell et al. teach the nucleic acid molecules of the invention can be RNA, and by nucleic acid is meant a PTM molecule whether composed of deoxyribonucleotides or ribonucleotides (page 23, lines 13-16). Regarding claim 26, Berger et al. teach in Figure 1(d) that the pre-mRNA has a point mutation (*) in the Exon (Ex n). The instant specification defines mutation as encompassing point mutations in which a single wild-type nucleotide is substituted by another nucleotide (page 9). Therefore, Berger et al. teach the mutation is substitution mutation in the pre-mRNA molecule. Regarding claim 29, Berger et al. does not teach a portion of an exon of wildtype pre-mRNA terminated in a YAG acceptor site. However, Mitchell et al. teach a PTM containing a 3’ splice region that includes a branchpoint sequence and 3’ splice acceptor AG site and/or a 5’ splice donor site, and the 3’ splice region may further comprise a polypyrimidine tract and that consensus sequences for the 5’ splice donor site and 3’ splice region used in RNA splicing are well known in the art (page 14, lines 3-7). Mitchell et al. teach the 3’ splice site consists three separate sequence elements: the branchpoint or branch site, a polypyrimidine tract and the 3’ consensus sequence (YAG) (page 14, lines 12-14). Regarding claim 31, Berger et al. teach a viral vector for PTM delivery in targeted cells, and the SMaRT technology could enlarge viral vector choice for diseases involving genes that are usually considered too large to be included in an AAV vector (page 490, left column). Regarding claims 33,34 and 40, Berger et al. does not teach the second sequence of nucleotides comprises a sequence that serves as a recognition site for an RNA binding element. However, Mitchell et al. teach a PTM with target binding domains and that binding may also be achieved through other mechanisms such as those in which the PTM is engineered to recognize a specific RNA binding protein (page 13, lines 13-16) and teach a PTM with a target binding domain which endows the PTM with a binding affinity for the target pre-mRNA and anchors the pre-mRNA closely in a space to the synthetic PTM so that the spliceosome processing machinery in the nuclease can trans-splice a portion of the synthetic PTM to a portion of the pre-mRNA (page 12, lines 16-21). Regarding claim 35, Berger et al. does not teach that the first and third sequences of nucleic acids hybridize to the same intron, or to the same exon, or to successive intron and exon, or to successive exon and intron in the target molecule. However, Mitchell et al. teach a PTM for factor VIII pre-mRNA target, the PTM comprising a first binding domain that hybridizes to intron 15 and a second binding domain that hybridizes to exon 16 and therefore teaches two binding domains that hybridize to successive intron and exon (Fig. 14B). PNG media_image4.png 324 525 media_image4.png Greyscale Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date, to modify the PTM of Berger et al. with the teachings regarding the PTM of Mitchell et al. and to use the modified PTM in a method of contacting with a human target cell as taught by Mitchell et al. for the purpose of optimizing the modified PTM for trans-splicing of a pre-mRNA target molecule in a human cell. There would be a reasonable expectation of success, because both Berger et al. and Mitchell et al. pertain to PTM molecules. One of ordinary skill in the art would have been motivated to do so because Berger et al. teach that the order of the elements in the PTM depends on the location of the exon to be replaced in the target mRNA (page 489, right column) and teach aspects of PTM design, target, environment and delivery can be modulated and are constantly improved leading to better understanding (page 493, left column). In addition, Mitchell et al. teach the PTMs of the invention may be used to correct genetic mutations found to be associated with genetic diseases, and can be used to replace internal exons (page 6, lines 29-31). An ordinary artisan would look to Berger et al. and be motivated to design a PTM as taught by Berger et al. with the structure as taught in Figure 1(d) and provide different nucleotide lengths of the portions making up the PTM as taught by Mitchell et al., and that the second sequence of nucleotides will not replace a full exon sequence in the pre-mRNA target molecule as Berger et al. teach a sequence that rectifies a point mutation in the internal exon. Therefore one would be motivated to only replace a portion of the exon sequence comprising the point mutation rather than the entire sequence of the exon, in order to reduce the size of the PTM to provide a small-size molecule for easier delivery. Accordingly, the limitations of claims 18,21,23,25-28,31 and 32 would have been prima facie obvious to one of ordinary skill in the art before the effective filing date. It would have been obvious to one of ordinary skill in the art before the effective filing date, to modify the PTM of Berger et al. with the teachings regarding the PTM of Mitchell et al. regarding the PTM being synthesized as a linear single-stranded molecule that forms an open-circle structure upon hybridization with the pre-mRNA target molecule. Both Berger et al. and Mitchell et al. teach the open circle structure of the PTM upon hybridization with the pre-RNA target molecule as shown in Figure 1(d) of Berger et al. and Mitchell et al. regarding that the RNA will likely fold to form secondary structures. One of ordinary skill in the art would have been motivated to do so because Mitchell et al. teach single-stranded nucleic acid molecules of the invention and that the PTM comprises a target binding domain, and that although the target binding domain may be “linear”, it is understood that the RNA will very likely fold to form secondary structures that may stabilize the complex, thereby increasing efficiency of splicing (page 12, lines 29-31). Accordingly, the limitations of claim 22 would have been prima facie obvious to one of ordinary skill in the art before the effective filing date. It would have been obvious to one of ordinary skill in the art before the effective filing date, to modify the PTM of Berger et al. with the teachings of Mitchell et al. regarding the second sequence of nucleotides binding to a cellular complex. One of ordinary skill in the art would have been motivated to use a sequence of nucleotides that binds to a cellular complex in the second sequence of nucleotides because Berger et. all teaches the spliceosome is naturally present in the target cell and Mitchell et al. teach spliceosome-mediated targeted trans-splicing (page 6, lines 6-7) in which a PTM with a target binding domain which endows the PTM with a binding affinity for the target pre-mRNA and anchors the pre-mRNA closely in a space to the synthetic PTM so that the spliceosome processing machinery in the nucleus can trans-splice a portion of the synthetic PTM to a portion of the pre-mRNA (page 12, lines 16-21). Accordingly, the limitations of claim 24 would have been prima facie obvious to one of ordinary skill in the art before the effective filing date. It would have been obvious to one of ordinary skill in the art before the effective filing date, to modify the PTM of Berger et al. with the teachings of Mitchell et al. regarding the sequence of a portion of an exon of wildtype pre-mRNA terminated in a YAG acceptor site. One of ordinary skill in the art would have been motivated to do so because Mitchell et al. teach a PTM containing a 3’ splice region that includes a branchpoint sequence and 3’ splice acceptor AG site and/or a 5’ splice donor site, and the 3’ splice region may further comprise a polypyrimidine tract and that consensus sequences for the 5’ splice donor site and 3’ splice region used in RNA splicing are well known in the art (page 14, lines 3-7) and the 3’ splice site consists of three separate sequence elements: the branchpoint or branch site, a polypyrimidine tract and the 3’ consensus sequence (YAG) (page 14, lines 12-14). Accordingly, the limitations of claim 29 would have been prima facie obvious to one of ordinary skill in the art before the effective filing date. It would have been obvious to one of ordinary skill in the art before the effective filing date, to modify the PTM of Berger et al. with the teachings of Mitchell et al. regarding the second sequence of nucleotides of the PTM comprising a sequence that serves as a recognition site for an RNA binding element. One of ordinary skill in the art would have been motivated to do so because Mitchell et al. teach a PTM with target binding domains and that binding may also be achieved through other mechanisms such as those in which the PTM is engineered to recognize a specific RNA binding protein (page 13, lines 13-16) and teach a PTM with a target binding domain which endows the PTM with a binding affinity for the target pre-mRNA and anchors the pre-mRNA closely in a space to the synthetic PTM so that the spliceosome processing machinery in the nuclease can trans-splice a portion of the synthetic PTM to a portion of the pre-mRNA (page 12, lines 16-21). Accordingly, the limitations of claims 33,34 and 40 would have been prima facie obvious to one of ordinary skill in the art before the effective filing date. It would have been obvious to one of ordinary skill in the art before the effective filing date, to modify the PTM of Berger et al. with the teachings of Mitchell et al. regarding the first and third nucleotide sequences hybridizing to a successive intron and exon. One of ordinary skill in the art would be motivated to do so based on the PTM of Mitchell et al. for factor VIII pre-mRNA target, the PTM comprising a first binding domain that hybridizes to intron 15 and a second binding domain that hybridizes to exon 16 and therefore teaches two binding domains that hybridize to successive intron and exon (Fig. 14B). Accordingly, the limitations of claim 35 would have been prima facie obvious to one of ordinary skill in the art before the effective filing date. Conclusion Claims 18,21-29,31-35,40 and 41 are rejected. Claims 30 and 36-39 are objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims. Any inquiry concerning this communication or earlier communications from the examiner should be directed to STEPHANIE L SULLIVAN whose telephone number is (703)756-4671. The examiner can normally be reached Monday-Friday, 7:30-3:30 EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram R Shukla can be reached on 571-272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /STEPHANIE L SULLIVAN/Examiner, Art Unit 1635 /RAM R SHUKLA/Supervisory Patent Examiner, Art Unit 1635
Read full office action

Prosecution Timeline

Jul 08, 2024
Application Filed
Oct 17, 2024
Non-Final Rejection — §103, §112
Jan 29, 2025
Interview Requested
Feb 11, 2025
Examiner Interview Summary
Mar 24, 2025
Response Filed
Apr 07, 2025
Final Rejection — §103, §112
Jul 23, 2025
Interview Requested
Aug 08, 2025
Examiner Interview Summary
Sep 11, 2025
Request for Continued Examination
Sep 18, 2025
Response after Non-Final Action
Oct 10, 2025
Non-Final Rejection — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12565648
MICRORNA-MEDIATED METHODS FOR REJUVENATING CNS GLIAL POPULATIONS
2y 5m to grant Granted Mar 03, 2026
Patent 12534727
NOVEL TARGET TO TREAT A METABOLIC DISEASE IN AN INDIVIDUAL
2y 5m to grant Granted Jan 27, 2026
Patent 12522830
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Jan 13, 2026
Patent 12522826
THERAPEUTICS FOR THE TREATMENT OF NEURODEGENERATIVE DISORDERS
2y 5m to grant Granted Jan 13, 2026
Patent 12496347
NUCLEIC ACID, COMPOSITION AND CONJUGATE CONTAINING NUCLEIC ACID, PREPARATION METHOD THEREFOR AND USE THEREOF
2y 5m to grant Granted Dec 16, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
62%
Grant Probability
98%
With Interview (+35.7%)
3y 6m
Median Time to Grant
High
PTA Risk
Based on 61 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month