Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged.
Information Disclosure Statement
The information disclosure statements (IDS) submitted on 07/18/2024, 10/10/2025 and 04/03/2026 are in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statements are being considered by the examiner.
Status of Claims
Claims 1-11,15-17,19 and 21-25 are pending and under examination.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1-11,15-17,19 and 21-25 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as failing to set forth the subject matter which the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the applicant regards as the invention.
Claim 1 indicates that the MI impairment haplotype comprises one or more alleles in shaded portion of FIG. 5. It is pointed out that Figure 5 is a table and no shaded portion of FIG. 5 is indicated. As such the metes and bounds of this claim is unclear.
Regarding claim 1, it is indicated that where possible, claims are to be complete in themselves. Incorporation by reference to a specific figure or table “is permitted only in exceptional circumstances where there is no practical way to define the invention in words and where it is more concise to incorporate by reference than duplicating a drawing or table into the claim. Incorporation by reference is a necessity doctrine, not for applicant’s convenience.” Ex parteFressola, 27 USPQ2d 1608, 1609 (Bd. Pat. App. & Inter. 1993) (citations omitted).
Claims 2-11 inherit these rejections.
Claim 15 and 19 require detecting a homozygous negative MI haplotype. However, the specification does not provide a definition of what a “homozygous negative MI haplotype” constitutes. The specification does not clearly indicate what SNPs or what markers indicate the claimed haplotype. Because the claim does not provide objective criteria for determining whether a particular bovine genotype constitutes a “negative MI haplotype”, the metes and bounds of the claim are unclear. Claims 16-17, 21—25 inherit this rejection.
Claim 21 is indefinite because the scope of "a fragment of SEQ ID NO: 1 or SEQ ID NO: 2, wherein the fragment includes the MI SNP" is unclear. The claim does not specify any minimum or required length of the fragment, the amount of sequence identity required relative to SEQ ID NO: 1 or SEQ ID NO: 2, or what sequence context is necessary for a fragment to be considered to include the MI SNP. As drafted, the claim encompasses fragments ranging from a single nucleotide to nearly the entire disclosed sequence, without providing objective boundaries for determining the scope of the claimed nucleic acid molecules.
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-11, and 21-25 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement.
The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claim 1 recites in part “generating genetic data from the chromosomal DNA at position 78732954 to 80748266 bp on chromosome 16, or a fragment thereof,” followed by “identifying a motor impairment (MI) haplotype in the genetic data, wherein the MI haplotype.” The specification however does not describe possession of the full breadth of this limitation.
The specification describes a genome-wide association study that identified approximately 2.1 Mb region associated with the motor impairment phenotype and a specific 120-marker haplotype spanning approximately positions 78732954 to 80748266 bp. The specification further described sequencing three animals, filtering sequence variants according to predetermined inheritance criteria, identifying a single candidate SNP at position 79613592 bp and subsequently validating that specific SNP using TaqMan assay. Thus, the specification describes a particular candidate mutation within the identified interval.
However, the claims are not limited to the 120-marker haplotype, the identified candidate SNP, or fragments containing those specifically disclosed markers. Instead, the claims encompass generating genetic data from the entire recited chromosomal interval or any fragment thereof, and identifying the claimed MI haplotype therefrom. The specification does not reasonably convey possession of this broader genus. In particular, the specification does not describe or identify which fragments of the approximately 2 Mb interval are informative for identifying the claimed MI haplotype, does not provide representative examples across full scope of fragments encompassed by the claims, and does not teach that arbitrary portions of the interval are suitable for performing the claimed identification.
It is noted that the specification itself acknowledges that additional work was required to confirm the precise causal mutation, stating that “Future efforts to identify the exact location and type of mutation are needed to confirm to condition and facilitate genetic testing and selection.” (See [0107]). This statement indicates that the inventors had not yet demonstrated possession of the full breadth of the claimed chromosomal interval or arbitrary fragments thereof for identifying the claimed MI haplotype.
Accordingly, the specification does not provide an adequate written description of the full scope of the claimed invention.
Similar rejections apply to claims 9-11.
Claim 21 recites in part nucleic acid molecules comprising “a fragment of SEQ ID NO: 1 or SEQ ID NO: 2, wherein the fragment includes the MI SNP”.
The Specification provides support for specific nucleic acid sequences corresponding to SEQ ID NO: 1 and SEQ ID NO: 2 and identifies a particular C-to-T SNP at bovine chromosome 16 position 79613592 as the MI SNP. The specification further described TaqMan assay for detecting the SNP. However, the specification does not reasonably convey possession of the full scope of nucleic acid molecules encompassed by the claim including all possible fragments of SEQ ID NO: 1 or SEQ ID NO: 2.
In particular the specification does not describe the structural boundaries, required length, sequence context or functional characteristics of nucleic acid fragments that would encompass the claimed genus. The claimed “fragment” may encompass any portion of SEQ ID NO: 1 or SEQ ID NO: 2 and contains the MI SNP. The specification did not identify such a broad range of genus of fragments or describe a representative number of species or common structural feature defining the claimed scope.
Therefore, the disclosure does not support satisfy the written description.
Claims 22-25 inherit the rejection.
Claim interpretation
For the purposes of this examination, the term “motor impairment” is given its broadest reasonable interpretation consistent with the Specification, the specification defines motor impairment as a condition in which an animal is “unable to coordinate, control, or respond normally with respect to voluntary muscle movement. By way of example, motor impairment may include the following traits noted, for example, in a calf: the inability to stand; the inability to stand without assistance; the inability to stand for the first 24 hours after birth; losing the ability to stand; the inability to stand, followed by recovery of the ability to stand, followed by poor growth and health.” (See [0040]). The specification does not limit the term to the haplotypes found in chromosome 16 or to any particular recumbency pattern found in Holstein cattle. As such the specification defines the term through the phenotype or function.
Therefore, under broadest reasonable interpretation, the term “motor impairment” will encompass inherited bovine disorders that impair coordination, control or execution of voluntary muscle movements, including hereditary disorders such as progressive ataxia.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 21-25 are rejected under 35 U.S.C. 101 because the claimed invention is directed to naturally occurring substance without significantly more.
The claims have been analyzed for eligibility in accordance with their broadest reasonable interpretation.
Regarding claim 21: The claim is directed to a composition comprising at least one nucleic acid molecule, wherein the nucleic acid molecule comprises SEQ ID NO: 1, SEQ ID NO: 2, or a fragment of SEQ ID NO: 1 or SEQ ID NO: 2, wherein the fragment includes the MI SNP.
The claim is directed to a composition, which is a statutory category of invention (Step 1: YES).
The claim is then analyzed to determine whether it is directed to any judicial exception. The broadest reasonable interpretation of claim 21 is a DNA of a cow, as it comprises nucleic acid molecule comprises SEQ ID NO: 1, or SEQ ID NO: 2. It is noted that SEQ ID NO: 1 occurs naturally in at least two species of cow: Bos taurus and Bos indicus (See alignment below). As such the indicated claim sets forth a judicial exception, because this is a naturally occurring substance. It is noted that even if the claim were directed to an isolated nucleic acid comprising SEQ ID NO: 1 or SEQ ID NO: 2, it would not overcome the naturally occurring substance judicial exception. Thus, the claim recites at least one exception, which may be termed a law of nature, an abstract idea, or both. (Step 2A prong 1: YES).
The claim is then analyzed to determine if additional elements integrates the judicial exception into a practical application. The claim recites no additional elements and is limited to a composition comprising at least one nucleic acid molecule, comprising SEQ ID NO: 1 or SEQ ID no; 2. (Step 2A prong 2: NO). Therefore the claim is directed to a law of nature judicial exception.
The claim is analyzed to determine if it adds additional elements that amount to significantly more beyond generally linking the use of judicial exception to technological environment. The claim does not add any additional elements that amount to significantly more beyond generally linking the use of judicial exception to technological environment. (Step 2B: NO).
The claim is patent ineligible.
Regarding claim 22: It is indicated that a solid support does not meaningfully modify the nucleic acid of claim 1, and therefore does not add significantly more to the judicial exception. Similar analyses apply to claims 23-25.
Query 21 CTGCATGCCGATGACCGCGTAGATGAAGAAGAGCATGACG 60
||||||||||||||||||||||||||||||||||||||||
Sbjct 3967 CTGCATGCCGATGACCGCGTAGATGAAGAAGAGCATGACG 3928
Alignment between PREDICTED: Bos indicus calcium voltage-gated channel subunit alpha1 S (CACNA1S), transcript variant X3, mRNA and SEQ ID NO: 1
Query 21 CTGCATGCCGATGACCGCGTAGATGAAGAAGAGCATGACG 60
||||||||||||||||||||||||||||||||||||||||
Sbjct 3967 CTGCATGCCGATGACCGCGTAGATGAAGAAGAGCATGACG 3928
Alignment between PREDICTED: Bos indicus calcium voltage-gated channel subunit alpha1 S (CACNA1S), transcript variant X3, mRNA and SEQ ID NO: 1
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 15-16 and 19 are rejected under 35 U.S.C. 103 as being unpatentable over Duchesne et al (PLOS Genetics, 2018; hereinafter “Duchesne;” See PTO-892) in view of Upperman et al (Genet Sel Evol. 2019 Aug 6; hereinafter “Upperman;” See PTO-892).
Regarding claims 15-16 and 19: Duchesne was directed to “[h]ereditary spastic paraplegias (HSPs) are clinically and genetically heterogeneous human neurodegenerative diseases.” (See Duchesne Abstract). It is noted that Duchesne indicated that “[h]ereditary spastic paraplegias (HSPs) are human neurodegenerative diseases mainly associated with lower extremity weakness and spasticity. Motor-sensory axons degeneration, implying heterogeneous cellular and molecular mechanisms and various genetic causes, is the neuropathological hallmark of this disease.” (See Duchesne Author Summary). Duchesne taught that “progressive ataxia of Charolais cattle, a neurodegenerative disease with autosomal recessive inheritance, is caused by a substitution in the KIF1C gene, which leads to a functional knock-out.” (See Duchesne Author Summary). Duchesne stated that “[i]dentification of the genetic basis of this disease was thus needed in order to eradicate the disease in the Charolais breed.” As such, Duchesne taught using genetic information associated with an inherited motor impairment in connection with breeding decisions to reduce, or eliminate the propagation of the disease. Duchesne however did not explicitly teach detecting a homozygous negative genotype or haplotype in breeding animals and using semen from bull or oocytes from a female identified as free of deleterious genotype for breeding.
Upperman taught that knowledge of deleterious loss-of-function alleles in breeding candidates enables more profitable breeding candidates enables more profitable breeding selection and mate allocation to avoid producing homozygous affected offspring. For example Upperman taught that “[b]eef cattle fertilization rates to a single artificial insemination (AI) service of about 90 to 100% have been observed, and yet the subsequent calving rates reach about 55%, which suggests that at least 35% of pregnancies are lost between fertilization and calving [3]. The low frequencies of recessive loss-of-function (LOF) alleles of genes that are essential for life may be associated with part of this early embryonic mortality. Genomic tools have enabled the identification of early embryonic mortality LOF mutations in dairy cattle that are evidenced by decreased fertility scores in genetic evaluations” (See Upperman p.2, col. 1, first para).
It would have been obvious to a person of ordinary skill in the art at the time of invention to apply the genotype-based breeding strategy taught by Upperman to the inherited motor impairment disclosed by Duchesne by obtaining genomic DNA from breeding animals, determining whether the animals carried the deleterious genotype for breeding and using the semen from selected bulls in artificial insemination or oocytes from females for embryo production. One would be motivated to do so because Upperman clearly taught that genomic screening of breeding stock for deleterious alleles improves breeding efficiency by avoiding propagation of harmful recessive traits, while Duchesne expressly recognized that identification of mutation enables eradication of inherited motor impairment from the breed. The combination merely applies known genotype-assisted breeding techniques to a known inherited bovine motor impairment and would have predictably reduced the incidence of affected offspring.
Claim 17 is rejected under 35 U.S.C. 103 as being unpatentable over Duchesne et al (PLOS Genetics, 2018; hereinafter “Duchesne;” See PTO-892) in view of Upperman et al (Genet Sel Evol. 2019 Aug 6; hereinafter “Upperman;” See PTO-892) and VanRaden et al (J Dairy Sci. 2011 Dec; hereinafter “VanRaden;” See IDS of 10/10/25).
Regarding claim 17: the teachings of Duchene in view of Upperman are set forth above. It is noted that the cited references did not teach detecting a homozygous negative MI haplotype in the sample, and using semen from the bull for fertilizing a female bovine wherein the bovine is a Holstein. VanRaden taught “recessive defects were discovered in Holsteins, Jerseys, and Brown Swiss by examining haplotypes” VanRaden taught that the recessive haplotypes in Holstein cattle can be identified using genetic testing and be used in selection of cows for breeding.
Accordingly, it would have been obvious to try the genotype-based breeding approach of Duchene in view of Upperman to Holstein cattle, as taught by VanRaden to identify and manage undesirable phenotypes.
Conclusion
No claim is allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JAGAMYA VIJAYARAGHAVAN whose telephone number is (703)756-5934. The examiner can normally be reached 9:00a-5:00p.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Christopher M. Babic can be reached at 571-272-8507. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JAGAMYA NMN VIJAYARAGHAVAN/Examiner, Art Unit 1633
/EVELYN Y PYLA/Primary Examiner, Art Unit 1633
Prosecution Insights