METHODS FOR PRODUCING LOW-NICOTINE TOBACCO

§102 §103 §112

DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Status of Claims The amendments submitted on July 20th, 2026, have been entered. Claims 5-6 and 8-9 have been canceled. New claims 61-63 have been added. Claims 1-4, 7, 10-12, and 61-63 are pending and examined herein. The text of those sections of Title 35 U.S. Code, not included in this action, can be found in a prior Office action. Claim Objection Claims 62-63 require a method of generating the target mutation by an RNAi plasmid that suppresses expression of a gene product or by the introduction of at least one recombinant nucleic acid encoding a nuclease, respectively, with respect to one or more polynucleotides (i)-(iv). It appears that this is directed to part (B) of claim 1. Appropriate clarification is required. This is a new objection necessitated by amendments to the claims. Claim Interpretation Claim 1 recites a tobacco product from a Nicotiana plant wherein the plant comprises a targeted genomic modification that reduces activity of berberine bridge enzyme-like (BBL)a, BBLb, and BBLc. The claim does not require a targeted genomic modification of one of the enzymes. This can be broadly interpreted as any targeted genomic modification that directly or indirectly reduces activity of BBLa, BBLb, and BBLc. Claim Rejections - 35 USC § 112(b) The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. New Claim 61 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. This is a new rejection necessitated by amendments to the claims. Claim 61 recites the tobacco product of claim 1, wherein the targeted genomic modification is generated by a method comprising introducing a CRISPR/Cas system into a plant cell that encodes a nicotine biosynthesis gene. It is unclear if the Applicant intends this nicotine biosynthesis gene to be the BBL genes recited in claim 1, or another nicotine biosynthesis gene that can then indirectly reduce activity or expression of the BBL genes. Claim Rejections Under 35 USC § 112(a) Written Description Claims 1-4, 7, 10-12 remain rejected, and claims 61-63 are newly rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. The claims are broadly drawn to a tobacco product comprising tobacco from any Nicotiana plant wherein the plant comprises any targeted genomic modification that reduces activity or expression of BBLa, BBLb, and BBLc and any targeted mutation of any single MPO1.1, MPO1.2, MPO2.1, or MPO2.2 endogenous polynucleotide, or combination thereof, with 95% - 100% identity to the listed polynucleotides or polynucleotides encoding a polypeptide, wherein the plant has a nicotinic alkaloid content that is reduced due to the synergistic effect of the targeted genomic modification and targeted mutation, as compared to a plant without the modification or mutation. The claims are additionally drawn to the product wherein the nicotinic alkaloid is tobacco and wherein the nicotine content in the plant is about 0.4 or 0.1 mg/g or less. The instant disclosure describes reduced nicotinic alkaloid in a Nicotiana plant with both an EMS induced knockout triple BBL mutation and one of the following MPO mutations with 100% identity to the listed SEQ ID NOs. by RNAi transgene insertion: mutation of MPO1.1, mutation of MPO1.1 and MPO1.2, mutation of MPO1.1, MPO1.2, and MPO2.2, and mutation of all four MPO genes. The instant disclosure describes nicotine content of 0.039 mg/g with the knockout modification of BBL genes and mutation of all four MPO genes (line KB19), 0.033 mg/g in the knockout modification of BBL genes and mutation of MPO1.1 and MPO1.2 (line KB20), and 0.024 mg/g in the knockout modification of BBL genes and mutation of MPO1.1, MPO1.2, and MPO2.2 (line TB7) [Table 1; Fig. 3A-3B]. The instant disclosure describes that those same lines had 0.116 mg/g, 0.175 mg/g, and 0.313 mg/g, respectively, in field studies. The instant disclosure describes an enhanced effect when the EMS-mediated knockout mutation of the four MPO genes is combined with functioning MPO RNAi transgene insertions. The instant disclosure does not describe that any modification or mutation would result in decreased nicotinic alkaloid content as compared to a plant that is not modified by the BBL or MPO modifications. This instant disclosure does not describe that mutation of MPO2.1 or MPO2.2 alone, or a mutation that doesn’t include MPO1.1 would result in reduced nicotinic alkaloid content. The instant specification does not reduce to practice that any Nicotiana plant with any of the modifications of claim 1 would result in a nicotine content of about 0.4 mg/g or 0.1 mg/g or less of nicotine content (with regard to claim 7). Further, the claims as drafted do not even require that the targeted genomic modification even be to the BBL genes, but could instead be any targeted modification that results in an indirect reduction that could result in a variable and unpredictable level of nicotine, and not the 0.4 mg/g nicotine content now recited in claim 1. The instant disclosure does not describe that the synergistic effect of any of the combinations are greater than the nicotine content of either targeted modification or mutation alone. A synergistic effect as defined in the instant specification “[r]efers to a greater-than-additive effect (e.g., effect on alkaloid content) that is produced by combined modulation of at least two nicotine biosynthesis genes or families of nicotine biosynthesis genes.” [¶153]. A “greater than additive effect” seems to indicate that the claimed modifications and mutations would decrease nicotine by more than the decrease of nicotine obtained from the modification and the mutation alone in combination. Figures 2A and 2B show that the WT K326 line has 11.09 mg/g of nicotine, while the RNAi line reducing MPO gene expression has 0.28 mg/g alone, and the EMS knockout of the BBL genes has 1.13 mg/g. The claim of a synergistic effect by the Applicant’s definition would have to be greater than the decrease of these two combined, but Figure 2B shows that the nicotine content of the combined modification and mutation is 0.04 mg/g. Thus, the Applicant has not reduced to practice the synergistic effect of the combined modification and mutation. Additionally, the mutation in at least one endogenous polynucleotide of an MPO1.1, MPO1.2, MPO2.1, or MPO2.2 in the instant disclosure is an RNAi transgene insertion to reduce expression of MPO genes. As claimed, the mutation of the MPO genes need not reduce function or activity of the MPO genes. Shoji, T. et al. (2008, “Why does Anatabine, but not Nicotine, Accumulate in Jasmonate-Elicited Cultured Tobacco BY-2 Cells?” Plant Cell Physiol. 49(8):1209-1216, see, IDS filed 07/18/2024) teaches that increased MPO expression can lead to increase nicotine accumulation in tobacco BY-2 cells with treatment of methyl jasmonate as compared to WT BY-2 cells [¶1212, col. 1, ¶2]. Some mutations may result in an increase in gene expression. For example, de Vooght, K. et al. (2009, “Management of Gene Promoter Mutations in Molecular Diagnostics,” 55(4):698-708) teaches that a promoter mutation causes functionally important consequences for gene expression and depending on the nature of the mutation, the level of mRNA and protein may increase or decrease [Abstract; pg. 698, col. 2, ¶2]. A mutation that increases activity of MPO genes, such as a mutation to the promoter sequence, may therefore increase nicotine content. The Applicant has broadly recited that a targeted genomic modification that reduces activity or expression of the BBL genes would result in the claimed nicotine content, yet only reduces to practice EMS knockout of BBL genes. The genus claim may include modification to another gene in the nicotine pathway that would have downstream effects on the BBL genes, but would not have the same effect on expression levels as knockout of the gene function, as described. It is not clear that a different modification, that could be a targeted mutation to another gene that indirectly reduces BBL gene activity indirectly, would provide a sufficient structure function relationship. Thus, in the instant disclosure, the description of an EMS knockout mutation to BBL genes and RNAi mutation or knockout to MPO genes is not a sufficient number of species to reduce to practice the claimed genus of any modification that directly or indirectly reduces BBL genes and any mutation of the select MPO genes. The structure of the modification or mutation may not still provide the function of reduced nicotinic alkaloid content as compared to a plant without the modification. Further, the structure may not provide the function of reducing the nicotine content to about 0.4 mg/g or less or 0.1 mg/g or less without a specific structure of modifications and mutations. Similarly, it would not be clear to one of ordinary skill in the art that one would be in possession of a Nicotiana plant with the claimed nicotine content of about 0.4 mg/g or less or 0.1 mg/g or less with a mutation of one of any of the MPO genes listed in part (B) of claim 1. The Applicant concedes that MPO2.1 and MPO2.2 may not play a significant role in alkaloid biosynthesis [¶172]. Figure 3A shows that lines KB19 (containing all four knockout MPO mutations) and KB20 (containing just a knockout at both MPO1 loci, and wild type at the two MPO2 genes) did not show a difference in nicotine production. All of the lines with a mutation in a single MPO, in two MPO, three, or all MPO polynucleotides that show a reduction to below 0.1 mg/g of nicotine content necessitate a mutation of the MPO1.1 polynucleotide [¶171]. A sufficient number of species with the singular endogenous polynucleotide that is mutated resulting in nicotine content below 0.4 mg/g or 0.1 mg/g, wherein the polynucleotide is one of MPO2.1 or MPO2.2 is not reduced to practice. It is not clear that mutation of MPO2.1 or MPO2.2 would have a synergistic effect in the reduction of nicotine content in the Nicotiana plant with the modification of the BBL genes without MPO1.1 (shown to have a synergistic effect without any of the other MPO genes [Fig. 2B]), or that the reduction would be greater than the modification of the BBL genes alone. The is insufficient evidence that the structure of mutating MPO2.1 and MPO2.2 to reduce gene activity would support the function of reducing nicotine content to this degree as they may not play a significant role in alkaloid biosynthesis. Thus, the Applicant has not reduced to practice that the MPO gene mutations without the inclusion of a mutation in an MPO1.1 polynucleotide would decrease nicotinic alkaloid content to the extent claimed, especially with the undefined modification to the BBLa, BBLb, and BBLc. New claim 61 recites that the targeted genomic modification is generated by a CRISPR/Cas system encoding “a nicotine biosynthesis gene”. The instant disclosure reduces to practice EMS knockout of all three BBL genes. The broad interpretation of claim 61 appears to allow for alternative nicotine biosynthesis genes that could indirectly reduce activity or expression of the BBL genes. Although the instant specification mentions that a CRISPR/Cas system may recognize a target in one or more of the MPO and BBL genes [¶101], the instant specification does not provide any structure, such as a sequence, to indicate alternative genes. Nicotine biosynthesis genes are a broad genus, are many genes are found to be involved in or influence nicotine biosynthesis. There are more than nine gene families involved in nicotine biosynthesis, including those participating in early metabolic conversion steps all the way to those utilized in the subsequent oxidation step leading to nicotine (Qin, Y. et al., 2020. “Transcriptome analysis reveals key genes involved in the regulation of nicotine biosynthesis at early time points after topping in tobacco (Nicotiana tabacum L.).” BMC Plant Biol 20, 30) [pg. 2, col. 1, ¶2]. Thus, as no structure was provided and no species were reduced to practice, claim 61 fails to meet the written description requirement. Response to Applicant’s Arguments: Applicant's arguments filed 07/20/2026 have been fully considered but they are not persuasive. Applicant argues that the written description rejection has been obviated by the claim amendments (See Remarks, page 6, paragraph 4). Applicant asserts that the amendment of claim 1 to recite the synergistic effect and a specific nicotine content now only encompasses mutations in the MPO genes that decrease its activity or expression, rendering moot that mutations in the MPO genes may increase or decrease activity or expression as currently claimed (id., page 6, paragraph 4). Applicant further argues that sufficient written description is provided to support the narrowed claim limitations, providing sequences is sufficient to support the written description requirement, and that an actual reduction to process is not required (id., page 7, paragraph 1). Applicant argues that they have provided identifying characteristics of the claimed tobacco product by describing and providing specific sequences of the targeted mutations and reduced to practice an embodiment (id., page 7, paragraph 2). Additionally, Applicant contends that extensive experimental results have been provided to demonstrate that the tobacco product would work for the intended purpose by showing that combining knockout of MPO genes with mutations in the BBL genes has a synergistic effect (id., page 7, paragraph 3). Examiner respectfully disagrees with the characterization of the amendments to the claims and the presented arguments. The Applicant has pulled in previously presented claim limitations from newly canceled claims 5-6 and 8 that were rejected under 35 USC § 112(a) written description in the previous Office Action (filed 04/20/2026). These claim limitations did not overcome the written description rejection because they did not limit the claim scope such that the claims only encompass mutations in the MPO genes that decrease its activity or expression. The amendment of the synergistic effect and a reduction in nicotine does not alter the claim language such that the mutations are limited to those that only decrease MPO activity or expression. As detailed in the Office Action filed 04/20/2026 (end of pg. 5 into page 6), any mutation of an MPO1.1, MPO1.2, MPO2.1, or MPO2.2 would not result in the function claimed. As recited in the instant specification, “[u]sing both RNAi-mediated knockdown of MPO gene expression and genome editing-based knockout of select MPO genes, the experimental examples provided herein demonstrate that dramatic reductions in the nicotine content of the leaf can be achieved in whole tobacco plants” [¶176], demonstrating that a reduction or decrease in gene expression of MPO was reduced to practice. One of ordinary skill in the art would not expect such a broad structure of any targeted mutation to lead to the function of decreased nicotine content. Additionally, Applicant has not addressed that it would not be clear to one of ordinary skill in the art that one would be in possession of a Nicotiana plant with the claimed nicotine content of about 0.4 mg/g or less or 0.1 mg/g or less with a mutation of one of any of the MPO genes listed in part (B) of claim 1. As detailed in the last paragraph of page 6 of the Office Action filed 04/20/2026, the Applicant concedes that MPO2.1 and MPO2.2 may not play a significant role in alkaloid biosynthesis [¶172]. Figure 3A shows that lines KB19 (containing all four knockout MPO mutations) and KB20 (containing just a knockout at both MPO1 loci, and wild type at the two MPO2 genes) did not show a difference in nicotine production. All of the lines with a mutation in a single MPO, in two MPO, three, or all MPO polynucleotides that show a reduction to below 0.1 mg/g of nicotine content include a mutation of the MPO1.1 polynucleotide [¶171]. A sufficient number of species with the singular endogenous polynucleotide that is mutated resulting in nicotine content below 0.4 mg/g or 0.1 mg/g, wherein the polynucleotide is one of MPO2.1 or MPO2.2 is not reduced to practice. It is not clear that mutation of MPO2.1 or MPO2.2 would have a synergistic effect in the reduction of nicotine content in the Nicotiana plant with the modification of the BBL genes without MPO1.1 (shown to have a synergistic effect without any of the other MPO genes [Fig. 2B]), or that the reduction would be greater than the modification of the BBL genes alone. The Applicant further asserts that the claimed invention was actually reduced to practice by constructing an embodiment and performing processes that meet all the limitations of the claim and demonstrating that the invention would work for its intended purpose. However, the claim limitations in light of how the claims are currently drafted includes one that requires a targeted genomic modification that reduces activity of BBLa, BBLb, and BBLc, and a targeted mutation in MPO2.1 (i.e., at least one of MPO1.1, MPO1.2, MPO2.1, and MPO2.2), wherein the combined modification and mutation result in a synergistic effect that results in a reduction in nicotine content that is greater from one modification or mutation alone. As the Applicant explicitly concedes that MPO2.1 and MPO2.2 may not play a significant role in alkaloid biosynthesis [¶172], the Applicant has not reduced to practice that the claimed invention would work for its intended function of decreasing nicotine content while meeting every limitation. Although the Applicant has reduced to practice an embodiment comprising some of the claim limitations, the Applicant concedes that there is unpredictability in the mutation of the MPO genes to successfully reduce nicotine content. The Applicant has not acknowledged the broad genus of a targeted genomic modification that reduces activity of BBL genes, as recited in claim 1. Further, the targeted genomic modification that reduces activity of BBLa-c does not actually require modification of the BBL genes as is reduced to practice and could instead be a large genus of any targeted genomic modification that indirectly reduces BBL gene activity. There is no evidence that any genomic modification that reduces BBL gene activity would sufficiently reduce nicotine to the level now claimed in instant claim 1. As explained in the MPEP, the level of detail required to satisfy the written description requirement varies depending on the nature and scope of the claims and on the complexity and predictability of the relevant technology. Ariad, 598 F.3d at 1351, 94 USPQ2d at 1172. MPEP § 2161.01. Thus, although the Applicant asserts that written description does not require an actual reduction to practice, the level of detail required is greater due to the documented discrepancies amongst the MPO genes with regard to the claimed function. In the instant case, providing examples of identifying characteristics such as sequences does not satisfy the written description requirement. Lastly, regarding the Applicant’s claim of the synergistic effect of the knockout of MPO genes with mutations in the BBL genes, synergistic effect is defined as “[a] greater-than-additive effect (e.g., effect on alkaloid content) that is produced by combined modulation of at least two nicotine biosynthesis genes or families of nicotine biosynthesis genes.” [instant specification, ¶153]. A “greater than additive effect” seems to indicate that the claimed modifications and mutations would decrease nicotine by more than the decrease of nicotine obtained from the modification and the mutation alone in combination. Figures 2A and 2B show that the WT K326 line has 11.09 mg/g of nicotine, while the RNAi line reducing MPO gene expression has 0.28 mg/g alone, and the EMS knockout of the BBL genes has 1.13 mg/g. The claim of a synergistic effect by the Applicant’s definition would have to be greater than the decrease of these two combined, but Figure 2B shows that the nicotine content of the combined modification and mutation is 0.04 mg/g. Additionally, the RNAi insertion mutation for the MPO genes alone reduced nicotine below the content claimed to occur from the synergistic effects of the modifications and mutations combined, 0.4 mg/g [Fig. 2A]. Examiner notes that new claims 61-63 appear to narrow the rejected claims, however, they do not overcome the above rejection as detailed in the rejection above. Thus, this rejection is maintained. Claim Rejections - 35 USC § 102 Claims 1-4, 7, 10-12, and 61-63 are rejected under pre-AIA 35 U.S.C. 102(a)(1) as being anticipated by Biswas, S. et al. (2016), “The Development of DNA Based Methods for the Reliable and Efficient Identification of Nicotiana tabacum in Tobacco and Its Derived Products,” International Journal of Analytical Chemistry, Volume 2016, Article ID 4352308. This is a modified rejection necessitated by amendments to the claims. Biswas teaches that tobacco identification is usually based on the detection of nicotine, neophytadiene, vitamin E, and microscopic fragments [pg. 2, col. 1, ¶3]. Biswas teaches that these methods may fail to work, especially in reconstituted tobacco products. Reconstituted tobacco is made from a pulp of mashed tobacco waste and may be made from agglomerating finely divided tobacco from leaves, refuse, or dust and may consist partially of other substances [pg. 2, col. 1, ¶2]. Biswas teaches improved methods of identification with better specificity, but microscopic tobacco fragments may not be detected in reconstituted tobacco. Thus, a product containing reconstituted tobacco comprising tobacco from a Nicotiana plant wherein the plant comprises a modification of the BBLa-c genes and a mutation in at least one MPO gene as claimed in the instant application, would not be necessarily differentiated from a product that does not comprise the modifications and mutations. As it is the plant of the instant claims that requires the modification and not the tobacco products itself, a tobacco product where the identification of the Nicotiana is not reliable or there is no DNA content detectable could not be discernable as a product of the instant invention. Absent evidence to the contrary, other tobacco products may read on the instant claims. Response to Applicant’s arguments: Applicant's arguments filed 07/20/2026 have been fully considered but they are not persuasive. Applicant contends that a claim is anticipated only if each and every element as set forth in the claim is found either expressly or inherently described in a single prior art reference (See Remarks, page 8, paragraph 6) and that the cited reference, Biswas, does not expressly or inherently describe each and every element of claim 1 as set forth and arranged in the claim (id., page 8, paragraph 7 to page 9, paragraph 1). Examiner respectfully disagrees. Biswas teaches that tobacco fragments may not be distinguishable in reconstituted tobacco material used in numerous tobacco products (See Office Action, page 8, paragraph 2). As instantly claimed, the claims recite a tobacco product comprising tobacco from a Nicotiana plant wherein the plant comprises the claimed modifications that appear to be the inventive concept of the instant application. The claims do not explicitly require that the actual tobacco product itself has the modifications. The broadest interpretation of such an invention is any tobacco product made from the plant with the modifications. According to Biswas, this would not be structurally determinable from any product made with reconstituted tobacco which can include any nicotine plant. One of skill in the art would not be able to differentiate the tobacco from the Nicotiana plant of the instant application within reconstituted tobacco from that of a Nicotiana plant without the modifications. As cited in the MPEP § 2131, "When a claim covers several structures or compositions, either generically or as alternatives, the claim is deemed anticipated if any of the structures or compositions within the scope of the claim is known in the prior art." Brown v. 3M, 265 F.3d 1349, 1351, 60 USPQ2d 1375, 1376 (Fed. Cir. 2001). Given that Biswas teaches a product that would have a structure that is indiscernible from that of the instant claims, Biswas reads on the instantly claimed product. One would not know if such a product would infringe upon reconstituted tobacco products already in the art. The tobacco product of claim 1 remains directed to an unspecified product that does not require any of the limitations of the actual genetic material of the Nicotiana plant, such as the genomic modifications and targeted mutations. A tobacco product, which may be any product from tobacco, including anything from the reconstituted tobacco of Biswas to an alkaloid extracted from a tobacco plant, such as anabasine, to a peptide isolated from the plant that is unrelated to the genes of the instant application. One of skill in the art would not be able to tell if the extracted material actually comes from the Nicotiana plant with the modifications/mutations because the product itself does not require the DNA of the plant nor the defining modifications/mutations which appear to be the inventive concept of the instant application. Thus, this rejection is maintained. Claim Rejections under 35 USC § 103 Claims 1-2, 7, 10-12, and 61-63 are rejected under 35 U.S.C. 103 as being unpatentable over Hashimoto, T. et al. “Regulating Alkaloids.” US Patent Application Publication No. US 20080292735 A1. published 11/27/2008 (see, IDS filed 07/18/2024), in view of Bovet, L. et al. “Increasing Anatabine in Tobacco Leaf by Regulating Methyl Putrescine Oxidase.” US Patent Publication No. US 20250043298 A1. Effectively filed 12/20/2021, and Lewis, R. et al. (2020). “Genetic and Agronomic Analysis of Tobacco Genotypes Exhibiting Reduced Nicotine Accumulation Due to Induced Mutations in Berberine Bridge Like (BBL) Genes.” Front. Plant Sci. 11. Examiner notes that the Lewis reference shares common inventors but qualifies as prior art under 102(a)(1) without exception under 102(b)(1)(A). Given that the claim scope has been altered to now require 95-100% sequence identity, targeted genomic modification and a targeted mutation, that the combination of modification and mutation have a synergistic effect, that the nicotinic alkaloid is nicotine, and that the nicotine content is about 0.4 mg/g or less, this is a new rejection necessitated by amendments to the claims. Regarding claims 1-2, Hashimoto teaches that MPO1 and MPO2 can be regulated for decreasing alkaloid levels in Nicotiana plants, particularly to decreased nicotine levels [Abstract]. Hashimoto 2008 teaches that suppression of one or more of MPO1 and MPO2 may be used in combination with modification of expression of other genes encoding enzymes on the nicotinic alkaloid biosynthetic pathway. Decreasing MPO1 and/or MPO2 comprises genetically engineering MPO suppression in the plant, wherein the engineering comprises introducing into a plant cell of the plant the nucleic acid construct [¶13]. Hashimoto teaches that any method may be used for reducing alkaloid levels, though the present invention contemplates antisense, sense co-suppression, RNAi, artificial microRNA, ribozyme, and virus-induced gene silencing (VIGS), and targeted mutagenesis approaches. Expression may be reduced by introducing a nucleic acid comprising a portion of an MPO1 or MPO2 sequence that causes targeted in situ mutagenesis of an endogenous gene, resulting in its inactivation (i.e. a Nicotiana plant, wherein the plant comprises a targeted mutation in at least one endogenous polynucleotide of an MPO) [¶155]. The MPO RNAi suppression vector pBI-MPO-Ri was transformed into Agrobacterium tumefaciens strain EH.4105, which was used to transform leaf segments of tobacco variety K326 [¶274]. Transgenic TO shoots were regenerated to produce transgenic plants [¶275]. Hashimoto discloses an MPO1 having the nucleotide sequence of SEQ ID NO. 1 and polypeptide having the amino acid sequence of SEQ ID NO: 2 [¶252]. The nucleotide sequence of SEQ ID NO. 1 has 100% identity to SEQ ID NO. 1 of the instant application (i.e. a mutation in at least one endogenous polynucleotide including a MPO1.1 having about 95% to 100% identity to SEQ ID NO. 2). SEQ ID NO. 2 of instant application (100% match to SEQ ID NO. 1 of US 20080292735 A1): Query Match 100.0%; Score 2373; Length 2465; Best Local Similarity 100.0%; Matches 2373; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ATGGCCACTACTAAACAGAAAGTGACGGCACCTTCTCCTTCTCCTTCTTCTTCGACTGCT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 49 ATGGCCACTACTAAACAGAAAGTGACGGCACCTTCTCCTTCTCCTTCTTCTTCGACTGCT 108 Qy 61 TCTTGCTGTCCTTCCACTTCTATCCTCCGTCGTGAGGCAACAGCGGCCATTGCAGTCGTG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 109 TCTTGCTGTCCTTCCACTTCTATCCTCCGTCGTGAGGCAACAGCGGCCATTGCAGTCGTG 168 Qy 121 GGTGACGGCCTGCAGAATTGGACCAACATCCCCTCCGTCGACGAGAAGCAGAAAAAGACG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 169 GGTGACGGCCTGCAGAATTGGACCAACATCCCCTCCGTCGACGAGAAGCAGAAAAAGACG 228 Qy 181 GCCTCATCAGCTCTAGCGTCATTGCCAACCACTGAACCTCTTTCCACCAATACCTCTACC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 229 GCCTCATCAGCTCTAGCGTCATTGCCAACCACTGAACCTCTTTCCACCAATACCTCTACC 288 Qy 241 AAAGGTATCCAAATCATGACAAGGGCTCAAACCTGCCATCCTTTGGACCCTTTATCTGCT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 289 AAAGGTATCCAAATCATGACAAGGGCTCAAACCTGCCATCCTTTGGACCCTTTATCTGCT 348 Qy 301 GCTGAGATCTCAGTGGCTGTGGCAACTGTTAGAGCTGCCGGTGAAACACCTGAGGTCAGA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 349 GCTGAGATCTCAGTGGCTGTGGCAACTGTTAGAGCTGCCGGTGAAACACCTGAGGTCAGA 408 Qy 361 GATGGGATGCGATTTATTGAGGTGGTTCTGGTAGAACCAGATAAAAGTGTAGTTGCATTG 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 409 GATGGGATGCGATTTATTGAGGTGGTTCTGGTAGAACCAGATAAAAGTGTAGTTGCATTG 468 Qy 421 GCAGATGCATATTTCTTCCCACCTTTTCAGTCATCATTGATGCCGAGAACCAAAGGAGGA 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 469 GCAGATGCATATTTCTTCCCACCTTTTCAGTCATCATTGATGCCGAGAACCAAAGGAGGA 528 Qy 481 TCTCAGATTCCTACTAAGCTTCCTCCAAGGAGAGCTAGGCTTATTGTTTACAATAAGAAA 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 529 TCTCAGATTCCTACTAAGCTTCCTCCAAGGAGAGCTAGGCTTATTGTTTACAATAAGAAA 588 Qy 541 ACAAATGAGACAAGCATTTGGATTGTTGAGCTAAACGAAGTACATGCTGCTGCTCGAGGT 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 589 ACAAATGAGACAAGCATTTGGATTGTTGAGCTAAACGAAGTACATGCTGCTGCTCGAGGT 648 Qy 601 GGACATCACAGGGGAAAAGTCATCGCATCCAATGTTGTCCCTGATGTTCAGCCACCCATA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 649 GGACATCACAGGGGAAAAGTCATCGCATCCAATGTTGTCCCTGATGTTCAGCCACCCATA 708 Qy 661 GATGCTCAAGAGTATGCTGAATGTGAAGCTGTGGTGAAAAGTTATCCTCCCTTTCGAGAC 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 709 GATGCTCAAGAGTATGCTGAATGTGAAGCTGTGGTGAAAAGTTATCCTCCCTTTCGAGAC 768 Qy 721 GCAATGAGGAGAAGGGGTATTGATGACTTGGATCTTGTGATGGTTGACCCTTGGTGTGTT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 769 GCAATGAGGAGAAGGGGTATTGATGACTTGGATCTTGTGATGGTTGACCCTTGGTGTGTT 828 Qy 781 GGTTATCATAGTGAGGCTGATGCTCCTAGCCGCAGGCTCGCGAAACCACTTGTATTCTGC 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 829 GGTTATCATAGTGAGGCTGATGCTCCTAGCCGCAGGCTCGCGAAACCACTTGTATTCTGC 888 Qy 841 AGGACAGAGAGTGACTGCCCAATGGAAAATGGATATGCAAGACCAGTTGAAGGAATATAT 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 889 AGGACAGAGAGTGACTGCCCAATGGAAAATGGATATGCAAGACCAGTTGAAGGAATATAT 948 Qy 901 GTGCTTGTTGATGTACAAAACATGAAGATTATAGAATTTGAAGACCGAAAACTTGTACCA 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 949 GTGCTTGTTGATGTACAAAACATGAAGATTATAGAATTTGAAGACCGAAAACTTGTACCA 1008 Qy 961 TTACCTCCAGTTGACCCACTGAGGAACTACACTGCTGGTGAGACAAGAGGAGGGGTTGAT 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1009 TTACCTCCAGTTGACCCACTGAGGAACTACACTGCTGGTGAGACAAGAGGAGGGGTTGAT 1068 Qy 1021 CGAAGTGATGTGAAACCCCTACATATTATTCAGCCTGAGGGTCCAAGCTTTCGTATCAGT 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1069 CGAAGTGATGTGAAACCCCTACATATTATTCAGCCTGAGGGTCCAAGCTTTCGTATCAGT 1128 Qy 1081 GGAAACTACGTAGAGTGGCAGAAGTGGAACTTTCGGATTGGTTTCACCCCTAGAGAGGGT 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1129 GGAAACTACGTAGAGTGGCAGAAGTGGAACTTTCGGATTGGTTTCACCCCTAGAGAGGGT 1188 Qy 1141 TTAGTTATACACTCTGTGGCGTATCTTGATGGTAGCAGAGGTCGTAGACCAATAGCACAT 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1189 TTAGTTATACACTCTGTGGCGTATCTTGATGGTAGCAGAGGTCGTAGACCAATAGCACAT 1248 Qy 1201 AGGTTGAGTTTTGTAGAGATGGTTGTCCCCTATGGAGATCCAAATGATCCACATTATAGG 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1249 AGGTTGAGTTTTGTAGAGATGGTTGTCCCCTATGGAGATCCAAATGATCCACATTATAGG 1308 Qy 1261 AAGAATGCATTTGATGCAGGAGAAGATGGCCTTGGAAAGAATGCTCATTCACTGAAGAGG 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1309 AAGAATGCATTTGATGCAGGAGAAGATGGCCTTGGAAAGAATGCTCATTCACTGAAGAGG 1368 Qy 1321 GGATGTGATTGTTTAGGGTACATAAAGTACTTTGATGCCCATTTCACAAACTTTACCGGA 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1369 GGATGTGATTGTTTAGGGTACATAAAGTACTTTGATGCCCATTTCACAAACTTTACCGGA 1428 Qy 1381 GGAGTTGAAACGACTGAAAATTGTGTATGCTTGCATGAAGAAGATCACGGAATGCTTTGG 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1429 GGAGTTGAAACGACTGAAAATTGTGTATGCTTGCATGAAGAAGATCACGGAATGCTTTGG 1488 Qy 1441 AAGCATCAAGATTGGAGAACTGGCCTTGCTGAAGTTAGACGGTCTAGGCGACTAACAGTG 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1489 AAGCATCAAGATTGGAGAACTGGCCTTGCTGAAGTTAGACGGTCTAGGCGACTAACAGTG 1548 Qy 1501 TCTTTTGTTTGTACAGTGGCCAATTATGAATATGCATTCTACTGGCATTTCTACCAGGAT 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1549 TCTTTTGTTTGTACAGTGGCCAATTATGAATATGCATTCTACTGGCATTTCTACCAGGAT 1608 Qy 1561 GGAAAAATTGAAGCGGAAGTCAAACTCACTGGAATTCTTAGTTTGGGAGCATTGCAACCT 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1609 GGAAAAATTGAAGCGGAAGTCAAACTCACTGGAATTCTTAGTTTGGGAGCATTGCAACCT 1668 Qy 1621 GGAGAATATCGCAAATATGGTACCACAATTTTACCAGGTTTGTATGCACCAGTTCATCAA 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1669 GGAGAATATCGCAAATATGGTACCACAATTTTACCAGGTTTGTATGCACCAGTTCATCAA 1728 Qy 1681 CACTTCTTTGTTGCACGAATGAATATGGCAGTTGATTGTAAGCCAGGAGAAGCACACAAT 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1729 CACTTCTTTGTTGCACGAATGAATATGGCAGTTGATTGTAAGCCAGGAGAAGCACACAAT 1788 Qy 1741 CAGGTTGTTGAAGTAAATGTCAAAGTTGAAGAACCTGGCAAGGAAAATGTTCATAATAAT 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1789 CAGGTTGTTGAAGTAAATGTCAAAGTTGAAGAACCTGGCAAGGAAAATGTTCATAATAAT 1848 Qy 1801 GCATTCTATGCTGAAGAAACATTGCTTAGGTCTGAATTGCAAGCAATGCGTGATTGTGAT 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1849 GCATTCTATGCTGAAGAAACATTGCTTAGGTCTGAATTGCAAGCAATGCGTGATTGTGAT 1908 Qy 1861 CCATTCTCTGCTCGTCATTGGATTGTTAGGAACACAAGAACAGTAAATAGAACAGGACAG 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1909 CCATTCTCTGCTCGTCATTGGATTGTTAGGAACACAAGAACAGTAAATAGAACAGGACAG 1968 Qy 1921 CTAACAGGGTACAAGCTGGTACCTGGTCCAAACTGTTTGCCACTGGCTGGTCCTGAGGCG 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1969 CTAACAGGGTACAAGCTGGTACCTGGTCCAAACTGTTTGCCACTGGCTGGTCCTGAGGCG 2028 Qy 1981 AAATTTTTGAGAAGAGCTGCATTTCTGAAGCACAATCTATGGGTTACACAATATGCACCT 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2029 AAATTTTTGAGAAGAGCTGCATTTCTGAAGCACAATCTATGGGTTACACAATATGCACCT 2088 Qy 2041 GGAGAAGATTTTCCAGGAGGAGAGTTCCCTAATCAAAATCCCCGTGTTGGCGAGGGATTA 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2089 GGAGAAGATTTTCCAGGAGGAGAGTTCCCTAATCAAAATCCCCGTGTTGGCGAGGGATTA 2148 Qy 2101 GCTTCTTGGGTCAAGCAAGACCGGCCTCTGGAAGAAAGTGATATTGTTCTCTGGTATATT 2160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2149 GCTTCTTGGGTCAAGCAAGACCGGCCTCTGGAAGAAAGTGATATTGTTCTCTGGTATATT 2208 Qy 2161 TTTGGAATCACACATGTTCCTCGGTTGGAAGACTGGCCTGTTATGCCAGTAGAACACATT 2220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2209 TTTGGAATCACACATGTTCCTCGGTTGGAAGACTGGCCTGTTATGCCAGTAGAACACATT 2268 Qy 2221 GGTTTTGTGCTACAGCCACATGGATACTTTAACTGCTCTCCGGCTGTTGATGTCCCTCCG 2280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2269 GGTTTTGTGCTACAGCCACATGGATACTTTAACTGCTCTCCGGCTGTTGATGTCCCTCCG 2328 Qy 2281 CCCTTTGCATGCGACTCAGAAAGCAGAGACAGTGATGTTACTGAAACTAGTGTAGCAAAG 2340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2329 CCCTTTGCATGCGACTCAGAAAGCAGAGACAGTGATGTTACTGAAACTAGTGTAGCAAAG 2388 Qy 2341 TCCACTGCCACTAGCTTGCTGGCCAAGCTTTGA 2373 ||||||||||||||||||||||||||||||||| Db 2389 TCCACTGCCACTAGCTTGCTGGCCAAGCTTTGA 2421 Hashimoto additionally teaches an MPO2 polynucleotide having the nucleotide sequence of SEQ ID NO. 3 and polypeptide having the amino acid sequence of SEQ ID NO: 4 [¶252]. The nucleotide sequence of SEQ ID NO. 3 has 100% identity to SEQ ID NO. 11 of the instant application (see, alignment below) (i.e. a mutation in at least one endogenous polynucleotide including an MPO2 polynucleotide having 95% to 100% sequence identity to SEQ ID NO. 11). SEQ ID NO. 11 of instant application (100% match to SEQ ID NO. 3 of US 20080292735 A1): Query Match 100.0%; Score 2301; Length 2405; Best Local Similarity 100.0%; Matches 2301; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ATGGCCGCAACTTTGCACAAGGTGACTCCGACTACTGCTTCGGCCTCCGCTTCTATCGCC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 32 ATGGCCGCAACTTTGCACAAGGTGACTCCGACTACTGCTTCGGCCTCCGCTTCTATCGCC 91 Qy 61 CGTCGTGAGTCCGCCGCAGCCTCCGTCCTGGTGGACGATCAGCAGAAACAAACGCCGGCT 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 92 CGTCGTGAGTCCGCCGCAGCCTCCGTCCTGGTGGACGATCAGCAGAAACAAACGCCGGCT 151 Qy 121 CTGACGTCATTGCTTAACTCTCAACCTCCTTCCTCCAATCCCTCTAGCAAAGGGAAACAA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 152 CTGACGTCATTGCTTAACTCTCAACCTCCTTCCTCCAATCCCTCTAGCAAAGGGAAACAA 211 Qy 181 ATCATGCCAAGAGCTCATACATGCCATCCTTTGGACCCTTTATCTGCTGCTGAAATCTCT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 212 ATCATGCCAAGAGCTCATACATGCCATCCTTTGGACCCTTTATCTGCTGCTGAAATCTCT 271 Qy 241 GTGGCTGTGGCGACCGTCAGAGCTGCCGGTGAAACACCCGAGGTCAGAGATGGCATGCGC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 272 GTGGCTGTGGCGACCGTCAGAGCTGCCGGTGAAACACCCGAGGTCAGAGATGGCATGCGC 331 Qy 301 TTTATTGAGGTGGTTCTTCTGGAACCTGATAAAAGTGTCGTTGCACTGGCTGATGCCTAT 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 332 TTTATTGAGGTGGTTCTTCTGGAACCTGATAAAAGTGTCGTTGCACTGGCTGATGCCTAT 391 Qy 361 TTCTTCCCACCTTTCCAATCTTCATTGATGTCCAGAAGGAAAGGAGGGCTTCCCATTCCT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 392 TTCTTCCCACCTTTCCAATCTTCATTGATGTCCAGAAGGAAAGGAGGGCTTCCCATTCCT 451 Qy 421 ACTAAGCTTCCTCCAAGGCGAGCTAGACTTATTGCATATAATAAGAAAACAAATGAGACA 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 452 ACTAAGCTTCCTCCAAGGCGAGCTAGACTTATTGCATATAATAAGAAAACAAATGAGACA 511 Qy 481 AGCATATGGATTGTTGAGCTAGCTGAAGTACATGCTGCTGCTCGAGGTGGACATCACAAG 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 512 AGCATATGGATTGTTGAGCTAGCTGAAGTACATGCTGCTGCTCGAGGTGGACATCACAAG 571 Qy 541 GGAAAAGTGATTTCATCCAATGTTGTTCCAGATGTTCAGCCACCTATAGATGCACAAGAG 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 572 GGAAAAGTGATTTCATCCAATGTTGTTCCAGATGTTCAGCCACCTATAGATGCACAAGAG 631 Qy 601 TATGCTGACTGTGAAGCTGTAGTTAAAAATTATCCTCCTTTTAGGGAAGCAATGAAGAGA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 632 TATGCTGACTGTGAAGCTGTAGTTAAAAATTATCCTCCTTTTAGGGAAGCAATGAAGAGA 691 Qy 661 AGGGGTATTGATGACATGGATGTTGTGATGGTGGACCCCTGGTGCGTTGGTTATCACAGT 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 692 AGGGGTATTGATGACATGGATGTTGTGATGGTGGACCCCTGGTGCGTTGGTTATCACAGT 751 Qy 721 GAGGCTGATGCTCCTAGCCGCAGGCTTGCCAAACCGCTAGTATTCTGCAGAACAGAGAGT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 752 GAGGCTGATGCTCCTAGCCGCAGGCTTGCCAAACCGCTAGTATTCTGCAGAACAGAGAGT 811 Qy 781 GACTGCCCAATGGAAAATGGATATGCAAGACCGGTTGAAGGAATATATGCCCTTGTTGAT 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 812 GACTGCCCAATGGAAAATGGATATGCAAGACCGGTTGAAGGAATATATGCCCTTGTTGAT 871 Qy 841 GTGCAAAACATGCAGGTGATAGAGTTTGAAGACCGCAAACTTGTACCTTTACCTCCAGCT 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 872 GTGCAAAACATGCAGGTGATAGAGTTTGAAGACCGCAAACTTGTACCTTTACCTCCAGCT 931 Qy 901 GATCCACTGAGGAATTACACTGCTGGTGAGACAAGAGGAGGGGTCGATCGAAGTGATGTA 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 932 GATCCACTGAGGAATTACACTGCTGGTGAGACAAGAGGAGGGGTCGATCGAAGTGATGTA 991 Qy 961 AAACCCCTCCAGATTATTCAGCCAGAGGGTCCAAGCTTTCGAGTCAATGGGAACTATGTG 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 992 AAACCCCTCCAGATTATTCAGCCAGAGGGTCCAAGCTTTCGAGTCAATGGGAACTATGTG 1051 Qy 1021 GAATGGCAAAAGTGGAACTTCCGAGTAGGTTTCACCCCTAGGGAGGGTTTGGTTATACAC 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1052 GAATGGCAAAAGTGGAACTTCCGAGTAGGTTTCACCCCTAGGGAGGGTTTGGTTATACAC 1111 Qy 1081 TCTGTGGCATATCTTGACGGTAGCAGGGGTCGGAGACCCATAGCCCATAGGTTGAGTTTT 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1112 TCTGTGGCATATCTTGACGGTAGCAGGGGTCGGAGACCCATAGCCCATAGGTTGAGTTTT 1171 Qy 1141 GTGGAGATGGTTGTCCCCTATGGGGATCCAAATGACCCACATTACAGAAAGAACGCTTTT 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1172 GTGGAGATGGTTGTCCCCTATGGGGATCCAAATGACCCACATTACAGAAAGAACGCTTTT 1231 Qy 1201 GATGCAGGAGAAGATGGGCTCGGAAAGAATGCTCATTCACTTAAGAGGGGATGCGATTGT 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1232 GATGCAGGAGAAGATGGGCTCGGAAAGAATGCTCATTCACTTAAGAGGGGATGCGATTGT 1291 Qy 1261 TTAGGATACATAAAGTACTTTGATGCCAATTTTGCAAATTTTACTGGAGGAGTAGAAACC 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1292 TTAGGATACATAAAGTACTTTGATGCCAATTTTGCAAATTTTACTGGAGGAGTAGAAACC 1351 Qy 1321 ACTGAAAATTGTGTATGTTTGCATGAAGAAGATCACGGGATGCTCTGGAAGCATCAAGAT 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1352 ACTGAAAATTGTGTATGTTTGCATGAAGAAGATCACGGGATGCTCTGGAAGCATCAAGAT 1411 Qy 1381 TGGAGAACTGGCCTTGCAGAAGTTAGACGGTCTAGACGACTTACAGTTTCTTTTATTTGC 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1412 TGGAGAACTGGCCTTGCAGAAGTTAGACGGTCTAGACGACTTACAGTTTCTTTTATTTGC 1471 Qy 1441 ACTGTGGCCAATTATGAATATGGATTCTACTGGCACTTATACCAGGATGGGAAAATTGAA 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1472 ACTGTGGCCAATTATGAATATGGATTCTACTGGCACTTATACCAGGATGGGAAAATTGAA 1531 Qy 1501 GCAGAAGTCAAACTCACAGGAATTCTCAGTTTGGGAGCATTGCCCCCCGGAGAGTCTCGT 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1532 GCAGAAGTCAAACTCACAGGAATTCTCAGTTTGGGAGCATTGCCCCCCGGAGAGTCTCGT 1591 Qy 1561 AAATATGGCACCACAATAGCACCAGGATTGTATGCACCTGTTCATCAACACTTCTTTGTT 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1592 AAATATGGCACCACAATAGCACCAGGATTGTATGCACCTGTTCATCAACACTTCTTTGTT 1651 Qy 1621 GCTCGTATGAATATGGCAGTTGATTGTAAACCAGGAGAAGCACACAATCAGGTTGTTGAA 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1652 GCTCGTATGAATATGGCAGTTGATTGTAAACCAGGAGAAGCACACAATCAGGTTGTTGAA 1711 Qy 1681 GTTAATGTAAGAGTTGAAGAACCTGGGAAAGAAAATGTTCACAACAATGCGTTCTATGCT 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1712 GTTAATGTAAGAGTTGAAGAACCTGGGAAAGAAAATGTTCACAACAATGCGTTCTATGCT 1771 Qy 1741 AAGGAAACAGTGCTTACGTCTGAATTGCAAGCAATGCGGGACTGTGATACTTTATCTGCT 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1772 AAGGAAACAGTGCTTACGTCTGAATTGCAAGCAATGCGGGACTGTGATACTTTATCTGCT 1831 Qy 1801 CGTCATTGGATTGTTAGGAACACAAGAACATCCAATAGAACAGGACAGCTAACAGGGTAC 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1832 CGTCATTGGATTGTTAGGAACACAAGAACATCCAATAGAACAGGACAGCTAACAGGGTAC 1891 Qy 1861 AAGCTGGTACCTGGCCCTAGCTGTTTGCCATTAGCTGGTCCTGAGGCTAAGTTTTTGAGA 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1892 AAGCTGGTACCTGGCCCTAGCTGTTTGCCATTAGCTGGTCCTGAGGCTAAGTTTTTGAGA 1951 Qy 1921 AGAGCTGCATTTTTGAAGCACAATCTATGGGTTACACAATATGCACCCGGAGAAGATTTT 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1952 AGAGCTGCATTTTTGAAGCACAATCTATGGGTTACACAATATGCACCCGGAGAAGATTTT 2011 Qy 1981 CCAGGGGGAGAGTTCCCTAATCAAAATCCACGTGTTGGTGAGGGATTAGCTTCTTGGGTT 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2012 CCAGGGGGAGAGTTCCCTAATCAAAATCCACGTGTTGGTGAGGGATTAGCTTCTTGGGTT 2071 Qy 2041 AAGCAAGATCGTTCTCTGGAAGAAAGTGATGTTGTTCTCTGGTATGTTTTTGGAATCACA 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2072 AAGCAAGATCGTTCTCTGGAAGAAAGTGATGTTGTTCTCTGGTATGTTTTTGGAATCACA 2131 Qy 2101 CATGTTCCTCGGTTGGAGGACTGGCCTGTTATGCCAGTTGAACATATCGGTTTTATGCTT 2160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2132 CATGTTCCTCGGTTGGAGGACTGGCCTGTTATGCCAGTTGAACATATCGGTTTTATGCTT 2191 Qy 2161 CAGCCGCATGGATTCTTTAACTGCTCTCCTGCTGTAGATGTACCTCCTCCTCGGGGATGT 2220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2192 CAGCCGCATGGATTCTTTAACTGCTCTCCTGCTGTAGATGTACCTCCTCCTCGGGGATGT 2251 Qy 2221 GACTTGGAAATCAAAGACAGTGATGGTTCAGAAAATGGTGTAGCAAAGCCCACTCCCAGT 2280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2252 GACTTGGAAATCAAAGACAGTGATGGTTCAGAAAATGGTGTAGCAAAGCCCACTCCCAGT 2311 Qy 2281 AGTTTGATGGCCAAGCTTTGA 2301 ||||||||||||||||||||| Db 2312 AGTTTGATGGCCAAGCTTTGA 2332 Hashimoto teaches that suppressing one or more of MPO1 and MPO2 may be used to decrease nicotine and nicotinic alkaloid levels in tobacco plants (i.e. wherein the Nicotiana plant has a nicotinic alkaloid content that is reduced as compared to a plant that does not comprise the mutations of (B); wherein the nicotinic alkaloid is nicotine) [Abstract]. Hashimoto teaches that multiple forms of MPO1 and MPO2 may exist, which may be due to multiple forms of the respective MPO1 or MPO2, genes [¶124]. Hashimoto teaches that use of reduced-nicotine tobacco may be for smoking cessation [¶06]. Nicotine-reduced or nicotine-free tobacco cigarettes have assisted smokers in quitting smoking. Additionally, denicotinized cigarettes relieve craving and other smoking withdrawal symptoms. Hashimoto 2008 teaches that reduced-nicotine tobacco product may be in the form of leaf tobacco, shredded tobacco, cut tobacco and tobacco fractions (i.e. the tobacco product wherein the tobacco is selected from leaf tobacco, etc.) [¶127]. A reduced-nicotine tobacco product may include cigarette tobacco, cigar tobacco, snuff, chewing tobacco, pipe tobacco, and cigarettes made from genetically engineered reduced-nicotine tobacco for use in smoking cessation (i.e. the tobacco product wherein the product is selected from snuff, etc.). Hashimoto teaches a method of producing a reduced-alkaloid plant comprising (a) genetically engineering MPO suppression in said plant, and (b) suppressing at least one additional nicotine biosynthesis enzyme [claim 8]. Hashimoto teaches that suppression of one or more of MPO1 and MPO2 may be used in combination with modification of expression of other genes encoding enzymes on the nicotinic alkaloid biosynthetic pathway, such as A622, NBB1, PMT, and QPT. Hashimoto teaches that previous reports indicate that suppressing more than one nicotine biosynthesis gene in Nicotiana decreases nicotinic alkaloid content further than suppressing one. For example, suppressing both A622 and NBB1 further reduces nicotine levels than suppressing either A622 or NBB1 (Hashimoto, T. et al., WO/2006/109197, incorporated herein by reference1) [¶83]. Hashimoto teaches further decreasing nicotinic alkaloid content by suppressing at least one of MPO1 and MOP2 and one or more of A622, NBB1, QPT, and PMT in Nicotiana. A nucleic acid construct comprising a segment of at least one of MPO1 and MOP2 and one or more of A622, NBB1 (a member of the BBL gene family1), QPT, and PMT is introduced into a Nicotiana cell or plant. An illustrative nucleic acid construct may comprise segments of both MPO1 and QPT. Although Hashimoto teaches decreasing nicotine content further than merely targeted mutation of a MPO polynucleotide with the addition of a targeted modification to another nicotine biosynthesis gene (i.e., wherein the combination of the targeted genomic modification of (A) and the targeted modification of (B) has an effect that comprises a reduction of nicotinic alkaloid content in the plant that is greater than that resulting from either (a) or (B) alone), Hashimoto do not explicitly teach reduced activity of BBLa, BBLb, and BBLc, however Bovet teaches transgenic Nicotiana plant leaf or part of the plant leaf having reduced expression or activity of MPO which confers an increase in the level of anatabine and a reduction in the level of nicotine in the plant leaf or part of the plant leaf [¶1]. Similarly to Hashimoto, Bovet teaches decreased nicotine content with targeted mutation of MPO genes, but explicitly teaches that one or more genes that are involved in the nicotine synthesis pathway can be additionally modified selected from the group consisting of: A622, BBLa, BBLb, JRE5L1, JRE5L2, MATE1, MATE 2, MPO1, MPO2, MYC2a, MYC2b, NBB1, nic1, nic2, NUP1, NUP2, PMT1, PMT2, PMT3, PMT4 and QPT or a combination of one or more thereof [¶259]. Bovet teaches that the level of nicotine in the plant leaf, part of the plant leaf and/or stem is about 0.03% dry weight or less (i.e., wherein the Nicotiana plant comprises a nicotine content of about 0.4 mg/g or less) [claim 4]. Hashimoto and Bovet do not explicitly teach wherein activity or expression of BBLa, BBLb, and BBLc are reduced, however, Lewis teaches deleterious mutations generated via ethyl methanesulfonate treatment of seed or gene editing into six known members of the BBL gene family (BBLa, BBLb, BBLc) and assembled them in different combinations to assess their relative contribution to nicotine accumulation (i.e., targeted genomic modification that reduces activity of BBLa, BBLb, and BBLc) [Abstract]. Plants in which BBL mutations were combined with naturally occurring recessive alleles at the Nic1 and Nic2 loci exhibited further reductions in percent nicotine (i.e., targeted genomic modification). The lowest alkaloid levels were measured for bbl-a/bbl-a bbl-b/bbl-b bbl-c/bbl-c plants that were also homozygous for the recessive alleles at both the Nic1 and Nic2 loci [pg. 8, col. 2, ¶1; Fig. 8]. The average nicotine content of plants with this genotype was very low (0.014% or 0.14 mg/g (i.e., wherein the Nicotiana plant comprises a nicotine content of about 0.4 mg/g or less). Given that Hashimoto teaches decreasing nicotine through targeted mutation of an endogenous MPO polynucleotide with 100% identity to the MPO1.1 polynucleotide sequence of the instant application (SEQ ID NO: 1) and teaches the addition of a targeted modification to another nicotine biosynthesis gene; given that Bovet teaches targeted modification of MPO genes in addition to BBL genes to enhance reductions in nicotine; and Lewis teaches targeted modification of BBLa, BBLb, BBLc at the NIC loci to further reduce nicotine content, wherein the content is reduced to 0.014 % (0.14 mg/g), it would have been prima facie obvious to one of ordinary skill in the art at the time of filing to create a tobacco product comprising tobacco from a Nicotiana plant comprising a targeted modification of BBLa, BBLb, BBLc and targeted mutation of an MPO gene to decreased nicotine content in the tobacco product. One would have reasonable expectation of success given that methodology for modification of BBLa, BBLb, and BBLc has been demonstrated in the prior art, as has mutation of MPO1 and MPO2, in numerous Nicotiana species, resulting in reduced alkaloid content and nicotine content. Mutation of MPO has previously been suggested in tandem with modification of other nicotine biosynthesis genes encoding enzymes on the nicotinic alkaloid biosynthetic pathway such as BBL by Bovet. One would be motivated to use the BBL gene modifications of Lewis as Hashimoto and Bovet teach that further modification of gene in the nicotine biosynthesis pathway can reduce nicotine content past that of the individual modification of an MPO gene. One would expect a synergistic effect comprising a reduction of nicotine in the plant that is greater than that of the modification or mutation alone given that Hashimoto and Bovet explicitly teach that modifying other nicotine biosynthesis genes will have a greater effect on the nicotine content. One would be additionally motivated to create such a product comprising tobacco from a Nicotiana plant comprising modification of BBL and MPO as Hashimoto teaches that reduced-nicotine tobacco may be for smoking cessation and that denicotinized cigarettes relieve craving and other smoking withdrawal symptoms. Thus, a tobacco plant with further reduced nicotine content would be beneficial to the public. Regarding claim 7, one would expect the combined mutation and modification to reduce the nicotine content to about 0.1 mg/g or less given that the modification of the BBL genes at Nic1 and Nic2 alone decreased the content to 0.14 mg/g and, based on the teachings of Hashimoto, the addition of the modification of the MPO genes would further reduce the nicotine content (i.e., wherein the Nicotiana plant comprises a nicotine content of about 0.1 mg/g or less). Regarding claim 10, Hashimoto teaches that although reduced MPO expression reduced nicotine, reduced expression restricts the pyrrolidine branch of tobacco alkaloid biosynthesis, and leads to elevated levels of alkaloids that do not possess the pyrrolidine moiety, such as anatabine [¶272]. Bovet teaches similar reductions in anatabine with MPO modification [Abstract]. The BBL mutations, on the other hand, successfully reduce anatabine content [Lewis, pg. 11, col. 2, ¶4]. Thus, one would expect that the anatabine content in the Nicotiana plant of claim 1 would be reduced as compared to a plant lacking the targeted modification of the BBL genes but comprising the mutation of the MPO genes. Regarding claims 11-12, Hashimoto teaches that the reduced nicotine product may be in the form of leaf tobacco or snuff (i.e., wherein the tobacco is leaf tobacco; wherein the tobacco product is snuff) [¶217]. Regarding claim 61, it would have been prima facie obvious to one of ordinary skill in the art at the time of filing to use the methodology of the CRISPR engineered modification of the BBLa, BBLb, and BBLc as taught by Lewis in Nicotiana tabacum with the mutations of MPO1 and/or MPO2 as taught by Hashimoto, as Lewis teaches that previous experimentation using members of the BBL family was carried out using CRISPR/Cas9 [pg. 9, col. 1, ¶2] (i.e., wherein the targeted genomic modification is generated by a method comprising introducing a CRISP/Cas system into a plant cell that comprises and expresses a DNA molecule having a target sequence and encoding a nicotine biosynthesis gene). Regarding claim 62, Hashimoto teaches that the invention contemplates antisense, sense co-suppression, RNAi, artificial microRNA, ribozyme, and virus-induced gene silencing (VIGS), and targeted mutagenesis approaches for decreasing alkaloid content (i.e., wherein the targeted mutation is generated by a method comprising introducing into the plant at least one RNAi plasmid that suppresses expression of a gene product encoded by one or more of polynucleotides (i)-(iv)) [¶139]. Regarding claim 63, Bovet teaches that methods of gene editing to obtain the MPO modifications includes deleting a gene segment by the simultaneous action of two nucleases on the same DNA strand (i.e., wherein the targeted mutation is generated by a method comprising introducing into the plant at least one recombinant nucleic acid encoding a nuclease that targets one or more polypeptides) [¶55]. Claim 3 is rejected under 35 U.S.C. 103 as being unpatentable over Hashimoto, Bovet, and Lewis, as applied to claim 1 above, and further in view of GenBank: DQ873385.1, Nicotiana tabacum methylputrescine oxidase (MPO1) mRNA, complete cds. Published 2011. This is a new rejection necessitated by amendments to the claims. Claim 3 recites the tobacco product of claim 1, wherein the Nicotiana plant comprises a targeted mutation in at least three of polynucleotides (i) - (iv) of (B). Regarding claim 3, Hashimoto teaches a Nicotiana plant comprising reduced nicotinic alkaloid content with a mutation in at least one endogenous polynucleotide of an MPO1 with 100% identity to SEQ ID NO. 2 of the instant application, as well as an MPO2 with 100% identity to SEQ ID NO. 11 of the instant application, as well as a tobacco including leaf tobacco and shredded tobacco (etc.) and tobacco products including a cigar and snuff (etc.). Bovet teaches modification of MPO genes with BBL genes. Lewis teaches a modification reducing activity of BBLa, BBLb, and BBlc resulting in reduced nicotinic alkaloid content, specifically nicotine. As detailed the combined references render obvious the tobacco product comprising tobacco from a Nicotiana plant. Hashimoto teaches that multiple forms of MPO1 and MPO2 may exist, which may be due to posttranslational modification of a gene product, or to multiple forms of the respective MPO1 or MPO2, genes [¶123]. Hashimoto, Bovet, and Lewis do not explicitly teach an MPO gene having 95-100% identity to SEQ ID NO: 5, however, a BLAST analysis revealed that there are a finite number of annotated MPO genes. GenBank: DQ873385.1 has 97% identity to SEQ ID NO: 5 of the instant application and is annotated as an MPO1 gene (see alignment below). Given that Hashimoto teaches that multiple forms of MPO1 genes exist and teaches that the mutations may include more than one MPO, it would have been prima facie obvious to one of ordinary skill in the art at the time of filing to use a different known MPO1 gene as a different form to further reduce nicotine content. One would be selecting from a finite number of defined sequences. One would have reasonable expectation of success given that Hashimoto teaches that multiple genes may be suppressed for the reduction of nicotine. Additionally, a paper which published this sequence indicates that MPO enzyme levels in N. tabacum increase during conditions that stimulate nicotine and that the Nic1 and Nic2 loci regulate MPO2, indicating that it would function in the method provided by Hashimoto, Bovet, and Lewis. SEQ ID NO. 5 of instant application (97% match to GenBank: DQ873385.1): Alignment statistics for match #1 Score Expect Identities Gaps Strand 3967 bits(2148) 0.0 2300/2373(97%) 12/2373(0%) Plus/Plus Query 1 ATGGCCACTACTAAACAGAAAGTGACGGCA------------CCTTCTTCTTCGACTGCT 48 |||||||||||||||||||||||||||||| |||||||||||||||||| Sbjct 143 ATGGCCACTACTAAACAGAAAGTGACGGCACCTTCTCCTTCTCCTTCTTCTTCGACTGCT 202 Query 49 CCTTGCTGTCCTTCCACTTCCATCCTCCGTCGTGAGGCGACAGCTGCCGTTGCAGGCGTG 108 ||||||||||||||||||| ||||||||||||||||| ||||| ||| |||||| |||| Sbjct 203 TCTTGCTGTCCTTCCACTTCTATCCTCCGTCGTGAGGCAACAGCGGCCATTGCAGTCGTG 262 Query 109 GGCGACGGCCTGCAAAATTGGAACAACGTCCCGTCCGTGGATGATAAGCAGAAAAAGACG 168 || ||||||||||| ||||||| |||| |||| ||||| || || ||||||||||||||| Sbjct 263 GGTGACGGCCTGCAGAATTGGACCAACATCCCCTCCGTCGACGAGAAGCAGAAAAAGACG 322 Query 169 GCCTCATCAGCTCTAGCGTCATTGGCAAGCACTGAACCTCTTTCCTCCAATACCTCTACC 228 |||||||||||||||||||||||| ||| |||||||||||||||| |||||||||||||| Sbjct 323 GCCTCATCAGCTCTAGCGTCATTGCCAACCACTGAACCTCTTTCCACCAATACCTCTACC 382 Query 229 AAAGGTATACAAATCATGACAAGGGCTCAGACTTGCCATCCTTTGGACCCTTTATCTGCT 288 |||||||| |||||||||||||||||||| || ||||||||||||||||||||||||||| Sbjct 383 AAAGGTATCCAAATCATGACAAGGGCTCAAACCTGCCATCCTTTGGACCCTTTATCTGCT 442 Query 289 GCTGAGATCTCTGTGGCTGTGGCAACTGTTAGAGCTGCCGGTGAAACACCTGAGGTTAGA 348 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct 443 GCTGAGATCTCAGTGGCTGTGGCAACTGTTAGAGCTGCCGGTGAAACACCTGAGGTCAGA 502 Query 349 GATGGGATGCGATTTATTGAGGTGGTTCTGTTAGAACCAGATAAAAGTGTTGTTGCATTG 408 |||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||| Sbjct 503 GATGGGATGCGATTTATTGAGGTGGTTCTGGTAGAACCAGATAAAAGTGTAGTTGCATTG 562 Query 409 GCAGATGCATATTTCTTCCCACCATTTCAGTCATCATTGATGCCCAGAACCAAAGGAGGA 468 ||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||| Sbjct 563 GCAGATGCATATTTCTTCCCACCTTTTCAGTCATCATTGATGCCGAGAACCAAAGGAGGA 622 Query 469 TCTCTAATTCCTACTAAGCTTCCTCCAAGGAGAGCTAGGCTTATTGTTTACAATAAGAAA 528 |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 623 TCTCAGATTCCTACTAAGCTTCCTCCAAGGAGAGCTAGGCTTATTGTTTACAATAAGAAA 682 Query 529 ACAAATGAGACAAGCATATGGATTGTTGAGCTAAATGAAGTACATGCTGCTGCTCGAGGT 588 ||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| Sbjct 683 ACAAATGAGACAAGCATTTGGATTGTTGAGCTAAACGAAGTACATGCTGCTGCTCGAGGT 742 Query 589 GGACATCACAGGGGAAAAGTCATCTCATCCAATGTTGTCCCTGATGTTCAGCCACCCATA 648 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct 743 GGACATCACAGGGGAAAAGTCATCGCATCCAATGTTGTCCCTGATGTTCAGCCACCCATA 802 Query 649 GATGCTCAAGAGTATGCTGAATGTGAAGCTGTGGTGAAAAGTTATCCTCCCTTTCGAGAC 708 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 803 GATGCTCAAGAGTATGCTGAATGTGAAGCTGTGGTGAAAAGTTATCCTCCCTTTCGAGAC 862 Query 709 GCAATGAGGAGAAGGGGTATTGATGACTTGGATCTTGTGATGGTTGACCCTTGGTGTGTT 768 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 863 GCAATGAGGAGAAGGGGTATTGATGACTTGGATCTTGTGATGGTTGACCCTTGGTGTGTT 922 Query 769 GGTTATCATAGTGAGGCTGATGCTCCTAGCCGCACGCTCGCGAAACCACTTGTATTCTCC 828 |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | Sbjct 923 GGTTATCATAGTGAGGCTGATGCTCCTAGCCGCAGGCTCGCGAAACCACTTGTATTCTGC 982 Query 829 AGGACAGAGAGTGACTGCCCAATGGAAAATGGATATGCAAGACCAGTTGAAGGAATATAT 888 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 983 AGGACAGAGAGTGACTGCCCAATGGAAAATGGATATGCAAGACCAGTTGAAGGAATATAT 1042 Query 889 GTGCTTGTTGATGTACAAAACATGCAGATTATAGAATTTGAAGACCGAAAACTTGTACCG 948 |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct 1043 GTGCTTGTTGATGTACAAAACATGAAGATTATAGAATTTGAAGACCGAAAACTTGTACCA 1102 Query 949 TTACCTCCAGCTGATCCACTGAGGAACTACACTGCTGGTGAGACAAGAGGAGGGGTTGAT 1008 |||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1103 TTACCTCCAGTTGACCCACTGAGGAACTACACTGCTGGTGAGACAAGAGGAGGGGTTGAT 1162 Query 1009 CGAAGTGATGTGAAACCCCTACATATTATTCAGCCCGAGGGTCCAAGCTTTCGTATCAGT 1068 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Sbjct 1163 CGAAGTGATGTGAAACCCCTACATATTATTCAGCCTGAGGGTCCAAGCTTTCGTATCAGT 1222 Query 1069 GGAAACTACATAGAGTGGCAGAAGTGGAACTTTCGGATTGGTTTCACCCCTAGAGAGGGT 1128 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1223 GGAAACTACGTAGAGTGGCAGAAGTGGAACTTTCGGATTGGTTTCACCCCTAGAGAGGGT 1282 Query 1129 TTAGTTATACACTCTGTGGCGTATCTTGATGGTAGCAGAGGTCGCAGACCAATAGCACAT 1188 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct 1283 TTAGTTATACACTCTGTGGCGTATCTTGATGGTAGCAGAGGTCGTAGACCAATAGCACAT 1342 Query 1189 AGGTTGAGTTTTGTAGAGATGGTTGTCCCTTATGGGGATCCAAATGATCCACATTATAGG 1248 ||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||| Sbjct 1343 AGGTTGAGTTTTGTAGAGATGGTTGTCCCCTATGGAGATCCAAATGATCCACATTATAGG 1402 Query 1249 AAGAATGCATTTGATGCAGGAGAAGATGGCCTTGGAAAGAATGCTCATTCACTGAAGAGG 1308 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1403 AAGAATGCATTTGATGCAGGAGAAGATGGCCTTGGAAAGAATGCTCATTCACTGAAGAGG 1462 Query 1309 GGATGTGATTGTTTAGGGTACATAAAGTACTTTGATGCCCATTTCACAAACTTTACGGGA 1368 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct 1463 GGATGTGATTGTTTAGGGTACATAAAGTACTTTGATGCCCATTTCACAAACTTTACCGGA 1522 Query 1369 GGAGTTGAAACGACTGAAAATTGTGTATGCTTGCATGAAGAAGATCACGGAATGCTTTGG 1428 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1523 GGAGTTGAAACGACTGAAAATTGTGTATGCTTGCATGAAGAAGATCACGGAATGCTTTGG 1582 Query 1429 AAGCATCAAGATTGGAGAACTGGCCTTGCTGAAGTTAGACGGTCTAGGCGACTAACGGTG 1488 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct 1583 AAGCATCAAGATTGGAGAACTGGCCTTGCTGAAGTTAGACGGTCTAGGCGACTAACAGTG 1642 Query 1489 TCTTTTGTTTGTACAGTGGCCAATTATGAATATGCATTCTACTGGCACTTCTACCAAGAT 1548 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||| Sbjct 1643 TCTTTTGTTTGTACAGTGGCCAATTATGAATATGCATTCTACTGGCATTTCTACCAGGAT 1702 Query 1549 GGAAAAATTGAAGCGGAAGTCAAACTCACTGGAATACTTAGTTTGGGAGCATTGCAACCT 1608 ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| Sbjct 1703 GGAAAAATTGAAGCGGAAGTCAAACTCACTGGAATTCTTAGTTTGGGAGCATTGCAACCT 1762 Query 1609 GGAGAATATCGCAAATATGGTACCACAATTTTACCAGGGTTGTATGCACCAGTTCATCAA 1668 |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct 1763 GGAGAATATCGCAAATATGGTACCACAATTTTACCAGGTTTGTATGCACCAGTTCATCAA 1822 Query 1669 CACTTCTTTGTTGCGCGAATGAATATGGCAGTTGATTGTAAGCCAGGAGAAGCACACAAT 1728 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1823 CACTTCTTTGTTGCACGAATGAATATGGCAGTTGATTGTAAGCCAGGAGAAGCACACAAT 1882 Query 1729 CAGGTTGTTGAAGTAAATGTCAAAGTTGAAGAACCTGGCAAGGAAAATGTTCACAATAAT 1788 ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Sbjct 1883 CAGGTTGTTGAAGTAAATGTCAAAGTTGAAGAACCTGGCAAGGAAAATGTTCATAATAAT 1942 Query 1789 GCATTCTATGCTGAAGAAACATTGCTTAGGTCTGAATTGCAAGCAATGCGTGACTGTGAT 1848 ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Sbjct 1943 GCATTCTATGCTGAAGAAACATTGCTTAGGTCTGAATTGCAAGCAATGCGTGATTGTGAT 2002 Query 1849 CCATTCTCTGCTCGTCATTGGATTGTTAGGAACACAAGAACTGTAAATAGAACAGGACAG 1908 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Sbjct 2003 CCATTCTCTGCTCGTCATTGGATTGTTAGGAACACAAGAACAGTAAATAGAACAGGACAG 2062 Query 1909 CTAACAGGGTACAAGCTGGTACCTGGTCCAAACTGTTTGCCATTGGCTGGTCCTGAGGCG 1968 |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| Sbjct 2063 CTAACAGGGTACAAGCTGGTACCTGGTCCAAACTGTTTGCCACTGGCTGGTCCTGAGGCG 2122 Query 1969 AAATTTTTGAGAAGAGCTGCATTTCTGAAGCACAATCTATGGGTTACACAATATGCACCT 2028 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2123 AAATTTTTGAGAAGAGCTGCATTTCTGAAGCACAATCTATGGGTTACACAATATGCACCT 2182 Query 2029 GGAGAAGAATTTCCAGGAGGAGAGTTCCCTAATCAAAATCCCCGTGTTGGCGAGGGATTA 2088 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2183 GGAGAAGATTTTCCAGGAGGAGAGTTCCCTAATCAAAATCCCCGTGTTGGCGAGGGATTA 2242 Query 2089 GCTTCATGGGTCAAGCAAGACCGGCCTCTAGAAGAAAGTGATATTGTTCTCTGGTATATT 2148 ||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| Sbjct 2243 GCTTCTTGGGTCAAGCAAGACCGGCCTCTGGAAGAAAGTGATATTGTTCTCTGGTATATT 2302 Query 2149 TTTGGAATCACACATGTTCCTCGGTTGGAAGACTGGCCTGTTATGCCAGTGGAACACATT 2208 |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct 2303 TTTGGAATCACACATGTTCCTCGGTTGGAAGACTGGCCTGTTATGCCAGTAGAACACATT 2362 Query 2209 GGTTTTGTGCTACAGCCACATGGATTCTTTAACTGCTCTCCGGCTGTTGATGTCCCTCCG 2268 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct 2363 GGTTTTGTGCTACAGCCACATGGATACTTTAACTGCTCTCCGGCTGTTGATGTCCCTCCG 2422 Query 2269 CCCTCTGCATGCGACTCGGAAAGCAGAGACAGTGATGTTACTGAAACCAGTGTAGCAAAG 2328 |||| |||||||||||| ||||||||||||||||||||||||||||| |||||||||||| Sbjct 2423 CCCTTTGCATGCGACTCAGAAAGCAGAGACAGTGATGTTACTGAAACTAGTGTAGCAAAG 2482 Query 2329 TCCACTGCCACTAGCTTGCTGGCCAAGCTTTGA 2361 ||||||||||||||||||||||||||||||||| Sbjct 2483 TCCACTGCCACTAGCTTGCTGGCCAAGCTTTGA 2515 Claim 4 is rejected under 35 U.S.C. 103 as being unpatentable over Hashimoto, Bovet, Lewis, and GenBank: DQ873385.1 as applied to claim 3 above, and further in view of NCBI Reference Sequence: NM_001324810.1, Nicotiana tabacum copper methylamine oxidase-like (LOC107763693), mRNA. First publicly available 2007. This is a new rejection necessitated by the claim amendments. Claim 4 recites tobacco product of claim 1, wherein the Nicotiana plant comprises a targeted mutation in each of polynucleotides (i) - (iv) of (B). Regarding claim 4, Hashimoto teaches a Nicotiana plant comprising reduced nicotinic alkaloid content with a mutation in at least one endogenous polynucleotide of an MPO1 with 100% identity to SEQ ID NO. 2 of the instant application, as well as an MPO2 with 100% identity to SEQ ID NO. 11 of the instant application, as well as a tobacco including leaf tobacco and shredded tobacco (etc.) and tobacco products including a cigar and snuff (etc.). Bovet teaches MPO gene modification in combination with modification of BBL genes for nicotine reduction. Lewis teaches a modification reducing activity of BBLa, BBLb, and BBlc resulting in reduced nicotinic alkaloid content, specifically nicotine. GenBank: DQ873385.1 has 97% identity to SEQ ID NO: 5 of the instant application and is annotated as an MPO1 gene. As detailed above, Hashimoto 2008 and 2006, Lewis, and GenBank: DQ873385.1 has 97% identity to SEQ ID NO: 5 of the instant application and is annotated as an MPO1 gene render obvious the tobacco product comprising tobacco from a Nicotiana plant comprising a targeted genomic modification that reduces activity of BBL genes and at least three of the MPO genes (i), (ii), and (iv). Hashimoto teaches that multiple forms of MPO1 and MPO2 may exist, which may be due to posttranslational modification of a gene product, or to multiple forms of the respective MPO1 or MPO2, genes [¶123]. Hashimoto and Lewis do not explicitly teach an MPO2.1 gene having 95-100% identity to SEQ ID NO: 8, however, a BLAST analysis revealed that there are a finite number of annotated MPO2 genes. NCBI Reference Sequence: NM_001324810.1 has 98% identity to SEQ ID NO: 8 of the instant application and is annotated as a copper methylamine oxidase-like gene with the synonym of MPO2 (see alignment below). Given that Hashimoto teaches that multiple forms of MPO2 genes exist and teaches that the mutations may include more than one MPO, it would have been prima facie obvious to one of ordinary skill in the art at the time of filing to use a different known MPO2 gene as a different form to further reduce nicotine content. One would be selecting from a finite number of defined sequences. One would have reasonable expectation of success given that Hashimoto and Bovet teaches that multiple genes may be suppressed for the reduction of nicotine. One would have been motivated to try different MPO forms in combination because Lewis teaches that combinations of the BBL genes further reduce nicotine levels. SEQ ID NO. 8 of instant application (98% match to NCBI Reference Sequence: NM_001324810.1): Score Expect Identities Gaps Strand 3927 bits(2126) 0.0 2218/2264(98%) 0/2264(0%) Plus/Plus Query 62 CTTCGGCTTCCGCTTCTGTCATCCGTCGTGAGTCCGCCGCAGCCTCCGTCGTGGAGGACG 121 ||||||| ||||||||| || |||||||||||||||||||||||||||| ||| ||||| Sbjct 69 CTTCGGCCTCCGCTTCTATCGCCCGTCGTGAGTCCGCCGCAGCCTCCGTCCTGGTGGACG 128 Query 122 ATCAGCAGAAACAAACGCCGGCGCTGACGTCATTGGTTAACTCTCAACCTCCTTCCTCCA 181 |||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||| Sbjct 129 ATCAGCAGAAACAAACGCCGGCTCTGACGTCATTGCTTAACTCTCAACCTCCTTCCTCCA 188 Query 182 ATCCCTCCGGCAAAGGGAAACAAATCATGCCAAGAGCTCATACATGCCATCCTTTGGACC 241 ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 189 ATCCCTCTAGCAAAGGGAAACAAATCATGCCAAGAGCTCATACATGCCATCCTTTGGACC 248 Query 242 CTTTATCTGCTGCTGAAATCTCTGTGGCTGTGGCGACCGTCAGAGCTGCCGGTGAAACAC 301 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 249 CTTTATCTGCTGCTGAAATCTCTGTGGCTGTGGCGACCGTCAGAGCTGCCGGTGAAACAC 308 Query 302 CCGAGGTCAGAGATGGCATGCGCTTTATTGAGGTGGTTCTACTGGAACCTGATAAAAGTG 361 |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| Sbjct 309 CCGAGGTCAGAGATGGCATGCGCTTTATTGAGGTGGTTCTTCTGGAACCTGATAAAAGTG 368 Query 362 TCATTGCACTGGCTGATGCCTATTTCTTCCCACCTTTCCAATCTTCGTTGATGTCCAGAA 421 || ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 369 TCGTTGCACTGGCTGATGCCTATTTCTTCCCACCTTTCCAATCTTCATTGATGTCCAGAA 428 Query 422 GGAAAGGAGGGCTTCCCATTCCTACTAAGCTTCCTCCAAGGCGAGCTAGACTTATTGTAT 481 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct 429 GGAAAGGAGGGCTTCCCATTCCTACTAAGCTTCCTCCAAGGCGAGCTAGACTTATTGCAT 488 Query 482 ATAATAAGAAAACAAATGAGACAAGCATATGGATTGTTGAGCTAGCTGAAGTACATGCTG 541 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 489 ATAATAAGAAAACAAATGAGACAAGCATATGGATTGTTGAGCTAGCTGAAGTACATGCTG 548 Query 542 CTGCTCGAGGTGGACATCACAAGGGAAAAGTGATTTCATCCTATGTTGTTCCAGATGTTC 601 ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| Sbjct 549 CTGCTCGAGGTGGACATCACAAGGGAAAAGTGATTTCATCCAATGTTGTTCCAGATGTTC 608 Query 602 AGCCACCTATAGATGCACAAGAGTATGCAGACTGTGAAGCTGTAGTTAAAAATTATCCTC 661 |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| Sbjct 609 AGCCACCTATAGATGCACAAGAGTATGCTGACTGTGAAGCTGTAGTTAAAAATTATCCTC 668 Query 662 CTTTTAGGGAAGCAATGAAGAGAAGGGGTATTGATGACATGGATCTTGTGATGGTGGACC 721 |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct 669 CTTTTAGGGAAGCAATGAAGAGAAGGGGTATTGATGACATGGATGTTGTGATGGTGGACC 728 Query 722 CCTGGTGCGTTGGTTTTCACAGTGAGGCTGATGCTCCTAGCCGCAGGCTTGCCAAACCGC 781 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Sbjct 729 CCTGGTGCGTTGGTTATCACAGTGAGGCTGATGCTCCTAGCCGCAGGCTTGCCAAACCGC 788 Query 782 TAGTATTCTGCAGATCAGAGAGTGACTGCCCAATGGAAAATGGATATGCAAGACCGGTTG 841 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Sbjct 789 TAGTATTCTGCAGAACAGAGAGTGACTGCCCAATGGAAAATGGATATGCAAGACCGGTTG 848 Query 842 AAGGAATTTATGTACTTGTTGATGTGCAAAAAATGCAGGTGATAGAGTTTGAAGACCGCA 901 ||||||| |||| ||||||||||||||||| |||||||||||||||||||||||||||| Sbjct 849 AAGGAATATATGCCCTTGTTGATGTGCAAAACATGCAGGTGATAGAGTTTGAAGACCGCA 908 Query 902 AACTTGTACCTTTACCTCCAGCTGATCCACTGAGGAATTACACTGCTGGTGAGACAAGAG 961 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 909 AACTTGTACCTTTACCTCCAGCTGATCCACTGAGGAATTACACTGCTGGTGAGACAAGAG 968 Query 962 GAGGGGTCGATCGAAGTGATGTGAAACCCCTCCAGATTATTCAGCCAGAGGGTCCAAGCT 1021 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Sbjct 969 GAGGGGTCGATCGAAGTGATGTAAAACCCCTCCAGATTATTCAGCCAGAGGGTCCAAGCT 1028 Query 1022 TTCGAGTCAATGGGAACTATGTGGAGTGGCAAAAGTGGAACTTCCGAGTAGGTTTCACCC 1081 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct 1029 TTCGAGTCAATGGGAACTATGTGGAATGGCAAAAGTGGAACTTCCGAGTAGGTTTCACCC 1088 Query 1082 CTAGGGAGGGTTTGGTTATACACTCTGTGGCATATATTGACGGTAGTAGGGGTCGGAGAC 1141 ||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| Sbjct 1089 CTAGGGAGGGTTTGGTTATACACTCTGTGGCATATCTTGACGGTAGCAGGGGTCGGAGAC 1148 Query 1142 CCATAGCCCATAGATTGAGTTTTGTGGAGATGGTTGTCCCCTATGGGGATCCAAATGACC 1201 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1149 CCATAGCCCATAGGTTGAGTTTTGTGGAGATGGTTGTCCCCTATGGGGATCCAAATGACC 1208 Query 1202 CACATTACAGAAAGAACGCTTTTGATGCAGGAGAAGATGGGCTCGGAAAGAATGCTCATT 1261 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1209 CACATTACAGAAAGAACGCTTTTGATGCAGGAGAAGATGGGCTCGGAAAGAATGCTCATT 1268 Query 1262 CACTTAAGAGGGGATGCGATTGTTTAGGATACATAAAGTACTTTGATGCCAATTTTGCAA 1321 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1269 CACTTAAGAGGGGATGCGATTGTTTAGGATACATAAAGTACTTTGATGCCAATTTTGCAA 1328 Query 1322 ATTTTACCGGAGGAGTAGAAACCACTGAAAATTGTGTATGTTTGCATGAAGAAGATCACG 1381 ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1329 ATTTTACTGGAGGAGTAGAAACCACTGAAAATTGTGTATGTTTGCATGAAGAAGATCACG 1388 Query 1382 GGATGCTCTGGAAGCATCAAGATTGGAGAACTGGCCTTGCAGAAGTTAGACGGTCTAGAC 1441 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1389 GGATGCTCTGGAAGCATCAAGATTGGAGAACTGGCCTTGCAGAAGTTAGACGGTCTAGAC 1448 Query 1442 GACTTACAGTTTCTTTTATTTGCACTGTGGCCAATTATGAATATGGATTCTACTGGCACT 1501 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1449 GACTTACAGTTTCTTTTATTTGCACTGTGGCCAATTATGAATATGGATTCTACTGGCACT 1508 Query 1502 TTTACCAGGATGGGAAAATTGAAGCAGAAATCAAACTCACAGGAATTCTCAGTTTGGGAG 1561 | ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Sbjct 1509 TATACCAGGATGGGAAAATTGAAGCAGAAGTCAAACTCACAGGAATTCTCAGTTTGGGAG 1568 Query 1562 CACTGCCTCCCGGAGAGTCTCGTAAATATGGCACCACAATAGCACCGGGATTGTATGCAC 1621 || |||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| Sbjct 1569 CATTGCCCCCCGGAGAGTCTCGTAAATATGGCACCACAATAGCACCAGGATTGTATGCAC 1628 Query 1622 CTGTTCATCAACACTTCTTTGTTGCTCGTATGAATATGGCAGTTGATTGTAAACCAGGAG 1681 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1629 CTGTTCATCAACACTTCTTTGTTGCTCGTATGAATATGGCAGTTGATTGTAAACCAGGAG 1688 Query 1682 AAGCACACAATCAGGTTGTTGAAGTTAATGTTAGAGTTGAAGAACCTGGGAAAGAAAATG 1741 ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| Sbjct 1689 AAGCACACAATCAGGTTGTTGAAGTTAATGTAAGAGTTGAAGAACCTGGGAAAGAAAATG 1748 Query 1742 TTCACAACAATGCATTCTATGCTAAGGAAACAGTGCTTACGTCTGAATTGCAAGCAATGC 1801 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1749 TTCACAACAATGCGTTCTATGCTAAGGAAACAGTGCTTACGTCTGAATTGCAAGCAATGC 1808 Query 1802 GTGACTGTGATACTTTATCTGCTCGTCATTGGATTGTTAGGAACACAAGAACATCCAATA 1861 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1809 GGGACTGTGATACTTTATCTGCTCGTCATTGGATTGTTAGGAACACAAGAACATCCAATA 1868 Query 1862 GAACAGGACAGCTAACAGGGTACAAGCTGGTACCTGGCCCTAACTGTTTGCCATTGGCTG 1921 |||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||| Sbjct 1869 GAACAGGACAGCTAACAGGGTACAAGCTGGTACCTGGCCCTAGCTGTTTGCCATTAGCTG 1928 Query 1922 GTCCTAAGGCTAAGTTTTTGAGAAGAGCTGCATTTTTGAAGCACAATCTATGGGTTACAA 1981 ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1929 GTCCTGAGGCTAAGTTTTTGAGAAGAGCTGCATTTTTGAAGCACAATCTATGGGTTACAC 1988 Query 1982 AATATGCACCCGGAGAAGATTTTCCCGGGGGAGAGTTCCCTAATCAAAATCCACGTGTTG 2041 ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct 1989 AATATGCACCCGGAGAAGATTTTCCAGGGGGAGAGTTCCCTAATCAAAATCCACGTGTTG 2048 Query 2042 GTGAGGGATTAGCTTCTTGGGTTAAGCAAGATCGTTCTCTGGAAGAAAGTGATGTTGTTC 2101 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2049 GTGAGGGATTAGCTTCTTGGGTTAAGCAAGATCGTTCTCTGGAAGAAAGTGATGTTGTTC 2108 Query 2102 TCTGGTATGTTTTTGGAATCACACATGTTCCTCGGTTGGAGGACTGGCCTGTTATGCCAG 2161 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2109 TCTGGTATGTTTTTGGAATCACACATGTTCCTCGGTTGGAGGACTGGCCTGTTATGCCAG 2168 Query 2162 TTGAACATATCGGTTTTATGCTTCAGCCACATGGATTCTTTAACTGCTCTCCCGCTGTAG 2221 |||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||| Sbjct 2169 TTGAACATATCGGTTTTATGCTTCAGCCGCATGGATTCTTTAACTGCTCTCCTGCTGTAG 2228 Query 2222 ATGTACCTCCTCCTCGGGGATGTGACATGGAAATCAAAGACAGTGATGGTTCAGAAAATG 2281 |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct 2229 ATGTACCTCCTCCTCGGGGATGTGACTTGGAAATCAAAGACAGTGATGGTTCAGAAAATG 2288 Query 2282 GTGTAGCAAAGCCCACTCCCAGTAATTTGATGGCCAAGCTTTGA 2325 |||||||||||||||||||||||| ||||||||||||||||||| Sbjct 2289 GTGTAGCAAAGCCCACTCCCAGTAGTTTGATGGCCAAGCTTTGA 2332 Response to Applicant’s Arguments: Applicant's arguments filed 7/20/2026 have been fully considered but they are not persuasive. Applicant contends that the Hashimoto (US 20080292735 A1) and Lewis (US 20180346917 A1) do not teach or suggest all the elements of instant claim 1 and that the Examiner has not identified any teaching or suggestion of a synergistic effect (See Remarks, page 10, paragraph 2). The Applicant argues that the Examiner has not identified any motivation in the references to combine the modifications of the BBL genes with the mutations in the MPO genes (id., pg. 10, paragraph 3). Further the Applicant asserts that one of ordinary skill in the art cannot reasonably expect that combining the modification of the BBL genes with the mutations in the MPO genes would produce a synergistic effect according to the amended claim 1 (id., page 10, paragraph 3 to page 11, paragraph 1). First, with regard to Hashimoto and Lewis not teaching all the elements of instant claim 1 as amended, the amendments to the claims necessitated new grounds of rejection and the argument is moot. Hashimoto in view of Bovet and Lewis (2020. “Genetic and Agronomic Analysis of Tobacco Genotypes Exhibiting Reduced Nicotine Accumulation Due to Induced Mutations in Berberine Bridge Like (BBL) Genes.” Front. Plant Sci. 11(368); herein referred to as Lewis 2020) teach the combined modifications and mutations. The Examiner recognizes that obviousness may be established by combining or modifying the teachings of the prior art to produce the claimed invention where there is some teaching, suggestion, or motivation to do so found either in the references themselves or in the knowledge generally available to one of ordinary skill in the art. See In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988), In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992), and KSR International Co. v. Teleflex, Inc., 550 U.S. 398, 82 USPQ2d 1385 (2007). In this case, as stated above, Hashimoto provides suggestion of combining the MPO gene mutations with other nicotine biosynthesis genes. The BBL genes were fully present in the art at the time of filing with annotated sequences and documented research on the effects of their mutation on nicotine content. Bovet explicitly teaches the combination of MPO mutation and BBL modification. Lewis (2020) explicitly teaches the instantly claimed BBL gene modifications. One would have reasonable expectation of success given that methodology for modification of BBLa, BBLb, and BBLc has been demonstrated in the prior art, as has mutation of MPO1 and MPO2, in numerous Nicotiana species, resulting in reduced alkaloid content and nicotine content. Mutation of MPO has previously been suggested in tandem with modification of other nicotine biosynthesis genes encoding enzymes on the nicotinic alkaloid biosynthetic pathway such as A622, NBB1, PMT, and QPT, as taught by Hashimoto [Abstract], and is explicitly taught by Bovet [¶259]. The Applicant argues that the Examiner has not identified any teaching or suggestion of a synergistic effect as required by instant amended claim 1. However, Examiner notes that the definition of “synergistic effect” in the instant specification “[r]efers to a greater-than-additive effect (e.g., effect on alkaloid content) that is produced by combined modulation of at least two nicotine biosynthesis genes or families of nicotine biosynthesis genes.” [¶153]. A “greater than additive effect” seems to indicate that the claimed modifications and mutations would decrease nicotine by more than the decrease of nicotine obtained from the modification and the mutation alone in combination. Figures 2A and 2B of the instant application show that the WT K326 line has 11.09 mg/g of nicotine, while the RNAi line reducing MPO gene expression has 0.28 mg/g alone, and the EMS knockout of the BBL genes has 1.13 mg/g. The claim of a synergistic effect by the Applicant’s definition would have to be greater than the decrease of these two combined, but Figure 2B shows that the nicotine content of the combined modification and mutation is 0.04 mg/g. Additionally, the RNAi insertion mutation for the MPO genes alone reduced nicotine below the content claimed to occur from the synergistic effects of the modifications and mutations combined in claim 1, 0.4 mg/g [Fig. 2A]. The claim language, “wherein the combination of the targeted genomic modification of (A) and the targeted mutation of (B) has a synergistic effect that comprises a reduction of nicotinic alkaloid content in the Nicotiana plant that is greater than that resulting from either the targeted genomic modification of (A) alone or the targeted mutation of (B) alone” appears to indicate that the synergy merely requires a greater reduction than either (A) or (B) alone, and not the additive effect. This is not consistent with the instant specification. It is unclear what the actual synergistic effect is per the specification. As such, the instant claims are not commensurate with the specification. Second, regarding the assertation that Examiner has provided no motivation to combine the modifications of the BBL genes with the mutations in the MPO genes, Hashimoto teaches that although reduced MPO expression reduced nicotine, reduced expression restricts the pyrrolidine branch of tobacco alkaloid biosynthesis, and leads to elevated levels of alkaloids that do not possess the pyrrolidine moiety, such as anatabine [¶272]. The BBL mutations, on the other hand, successfully reduced anatabine content [Bovet, Abstract]. Thus, one would be motivated to create a tobacco plant with reduced levels of anatabine and further reduced levels of nicotine. Examiner notes that additional motivation provided in the 103 rejection above is to create such a product comprising tobacco from a Nicotiana plant comprising modification of BBL and MPO as Hashimoto teaches that reduced-nicotine tobacco may be for smoking cessation and that denicotinized cigarettes relieve craving and other smoking withdrawal symptoms. Thus, a tobacco plant with further reduced nicotine content would be beneficial to the public. Third, Applicant contends that one of ordinary skill cannot reasonably expect that combining the modification of the BBL genes with the mutations in the MPO genes would produce synergistic effect. Although an explicit synergistic effect is not disclosed in the references, the suggestion and motivation to combine are present, as detailed above. As stated in the MPEP, “[c]onclusive proof of efficacy is not required to show a reasonable expectation of success.” OSI Pharm., LLC v. Apotex Inc., 939 F.3d 1375, 1385, 2019 USPQ2d 379681 (Fed. Cir. 2019). [MPEP § 2143.02]. This rejection is new based on new grounds of rejection recited in the rejection under 35 USC § 103 detailed above. Summary Claims 1-4, 7, 10-12, and 61-63 are rejected. Applicants’ amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR § 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Contact Information Any inquiry concerning this communication or earlier communications from the examiner should be directed to EMILY K. JOHNSON whose telephone number is (571)272-5761. The examiner can normally be reached Monday - Friday 7:30 am - 5:00 pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at 571-270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /EMILY K JOHNSON/Examiner, Art Unit 1662 /BRATISLAV STANKOVIC/Supervisory Patent Examiner, Art Units 1661 & 1662 1 Hashimoto, T. et al. (“Reducing Levels of Nicotine Alkaloids in Plants. WO/2006/109197. Published 2006) teaches that NBB1 is involved in nicotine biosynthesis and is under the control of the NIC loci [¶207]. Hashimoto teaches that NBB1 and PMT have the same expression pattern in tobacco plants and teaches that the NBB1 polypeptide shares homology to the berberine bridge enzyme [¶208]. 2 Heim, W. et al. 2007. “Cloning and characterization of a Nicotiana tabacum methylputrescine oxidase transcript.” Phytochemistry. 68(4):454-463. ISSN 0031-9422. [pg. 455, col. 2, ¶2].