Prosecution Insights
Last updated: July 17, 2026
Application No. 18/730,112

POLYNUCLEOTIDES FOR MODIFYING ORGANISMS

Non-Final OA §103§112
Filed
Jul 18, 2024
Priority
Jan 20, 2022 — provisional 63/266,967 +2 more
Examiner
ZHONG, WAYNESHAOBIN
Art Unit
1662
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Flagship Pioneering Inc.
OA Round
1 (Non-Final)
72%
Grant Probability
Favorable
1-2
OA Rounds
11m
Est. Remaining
94%
With Interview

Examiner Intelligence

Grants 72% — above average
72%
Career Allowance Rate
388 granted / 536 resolved
+12.4% vs TC avg
Strong +22% interview lift
Without
With
+21.6%
Interview Lift
resolved cases with interview
Typical timeline
2y 11m
Avg Prosecution
29 currently pending
Career history
562
Total Applications
across all art units

Statute-Specific Performance

§101
3.2%
-36.8% vs TC avg
§103
58.5%
+18.5% vs TC avg
§102
10.4%
-29.6% vs TC avg
§112
17.6%
-22.4% vs TC avg
Black line = Tech Center average estimate • Based on career data from 536 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Information Disclosure Statement The Information Disclosure Statements filed on 5/13/2025 and 4/16/2026 have been entered and considered. Initialed copies of the form PTO-1449 are enclosed with this action. Restriction-Election/Status of claims Claims 1-52 had/have been canceled. On 4/16/2026, the applicant provisionally elected the following species with traverse: Election 1: combination of RNA replication elements from each of (a, 5') and (b, 3'), specifically: 5' RNA replication element: SEQ ID NO: 378, and 3' RNA replication element: SEQ ID NO: 379. Election 2: combination of genomic sequences from each of (a, 5') and (b, 3'), comprising: a genomic sequence located downstream (3') of and adjacent to the 5' UTR sequence; and a genomic sequence located upstream (5') of and adjacent to the 3' UTR sequence. Election 3: (i) a tRNA-like element. Election 3 A: (i) Arabidopsis FT mRNA. Election 4: A cargo RNA molecule comprising: at least one coding sequence Election 5: An RNA comprising: at least one ribozyme Election 6: a limitation wherein: the 5' RNA replication element, the 3' RNA replication element, and the RDRP are obtained from the same partitiviral genome or from related partitiviral genomes. The applicant states that the elected species is readable on at least claims 53-65 and 67-72, including independent claim 53 and dependent claims directed to the elected RNA replication elements, genomic sequences, tRNA-like element (Arabidopsis FT mRNA), coding cargo RNA, ribozyme- containing RNA, and genome-origin limitations. The applicant argues that “Traverse is on the grounds that the Requirement fails to provide any specific prior art citations to support its conclusion that "species are deemed to lack unity of invention because they are not so linked as to form a single general inventive concept under PCT Rule 13.1."1 Traverse is further on the grounds that the alternative species listed in claims 53-72 meet the requirements of PCT Rule 13.2 as the alternative species are of a similar nature”. The argument is fully considered but not deemed persuasive. As analyzed in the rejection under USC 103 below, the claimed technical feature is deemed obvious in view of prior art taught by Lindbo in view of Byrne et al and Rampersad et al, thus, is not a unique technical feature. Regarding the alternative species, if the claims are eventually amended such that they are deemed allowable, as stated in the office action of 2/11/2026, some or all of the non-elected species may be rejoined. In summary, claims 53-65, 67-72 are examined in this office action. Non-elected species are withdrawn. Claim 66 is exclusively drawn to non-elected species, thus is also withdrawn. The restriction is made final. Priority Instant 18730112, filed 07/18/2024, is a National Stage entry of PCT/US2023/060949, International Filing Date: 01/20/2023. PCT/US2023/060949 Claims Priority from Provisional Application 63266967, filed 01/20/2022, and from Provisional Application 63379056, filed 10/11/2022. The provisional applications disclosed the claimed subject matter except that of the elected SEQ ID NOs: 378-379. Therefore, the priority of 01/20/2022 is recognized except for claims 57-58. PCT/US2023/060949 disclosed elected SEQ ID NOs: 378-379. 01/20/2023 is recognized for claims 57-58. Claim Objections Claims 53, 58, 61-63 are objected to because of the following informalities: In claim 53, from the context of claim (the claim recites (a), (b) and (c)), in (a), line 4, the “deletions:” should be changed to --- deletions; ---, instead. In addition, the claim recites (a), (b) and (c). However, there is no “and” between (b) and (c). Note: From the context of claim, the recited “wherein the recombinant ssRNA molecule comprises from 5' terminus to 3' terminus: (a) a 5’ RNA replication element ……..; (b) ……; (c) a 3’ RNA replication element …., which clearly indicates that all of (a), (b) and (c) are required to satisfy the 5’ and 3’ termini. Therefore, a 112(b) rejection is not made. Thus, it is suggested to insert --- and — after the “(b) a cargo RNA molecule;” to read --- (b) a cargo RNA molecule; and ---. In claim 58, from the context of claim, in (a), line 2, the “386:” should be changed to --- 386; ---, instead. See (b), line 2, which recites “387:”. In claim 61, the “tRNA” appears in a claim for the first time. The full name should be provided, followed by the abbreviation in a (). In claim 62, the “FT mRNA” appears in a claim for the first time. The full name should be provided, followed by the abbreviation in a (). In claim 63, the “OAS” appears in a claim for the first time. The full name should be provided, followed by the abbreviation in a (). See the requirement of 37 CFR 1.71(a) for “full, clear, and exact terms”. Appropriate correction is required. Claim Rejections - 35 USC § 112 Lacking written description The following is a quotation of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. Claims 53-56, 58-65, 67-72 are rejected under 35 U.S.C. 112(a), as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention. To claim a genus under the written description requirement, the applicant is required to describe a representative number of species to reflect the variation within the genus or structures sufficient to define the genus. The factors to be considered include disclosure of complete or partial structure, physical and/or chemical properties, functional characteristics, structure/function correlation, methods of making the claimed product, or any combinations thereof. By court’s statement in Regents of the Univ. of Cal. v. Eli Lilly, 119 F.3d 1559, 1566, 43 USPQ2d 1398, 1404 (Fed. Cir. 1997), a written description of an invention “requires a precise definition, such as a structure, formula, or chemical name, of the claimed subject matter sufficient to distinguish it from other materials”; further, a written description of a claimed genus requires a description of a representative number of species of the claimed genus, and one of skill in the art should be able to “visualize or recognize the identity of the members of the genus”. Claim 58 depends on claim 53, and is broadly drawn to (a) a genus of the 5' RNA replication elements comprise a genus of variants thereof encoded by a DNA molecule having at least 70% sequence identity to SEQ ID NO: 378 (elected); or a genus of variants thereof wherein one or more nucleotides in the RNA secondary structure are substituted with distinct nucleotides which maintain the RNA secondary structure; and/or (b) a genus of the 3' RNA replication elements comprise a genus of variants thereof encoded by a DNA molecule having at least 70% sequence identity to SEQ ID NO: 379 (elected); or a genus of variants thereof wherein one of more base-paired residues in the RNA secondary structure are substituted with distinct nucleotides which maintain the RNA secondary structure. Claim 53 is the parent of claim 58, and is broader than claim 53. The claim is broadly drawn to methods comprising combining a recombinant single-stranded RNA (ssRNA) molecule with a viral capsid protein, wherein the recombinant ssRNA molecule comprises from 5' terminus to 3' terminus: (a) a genus of 5' RNA replication elements recognized by a partitiviral RNA-dependent RNA polymerase (RDRP), wherein the 5' RNA replication element comprises at least a segment of the 5' untranslated region (UTR) of a partitiviral genome or a variant thereof having one or more nucleotide substitutions, insertions, and/or deletions: (b) a cargo RNA molecule; (c) a genus of 3' RNA replication elements recognized by the RDRP, wherein the 3' RNA replication element comprises at least a segment of the 3' untranslated region (UTR) of the partitiviral genome or a variant thereof having one or more nucleotide substitutions, insertions, and/or deletions; The claimed functions are for manufacturing a synthetic partitiviral satellite particle, and both the 5’ and 3’ replication elements recognized by the same RNA-dependent RNA polymerase (RDRP, as claimed), and an encapsidation recognition element (ERE) providing for encapsidation of the ssRNA by the viral capsid protein. The analysis starts from claim 58. The specification provides the sequence of SEQ ID NOs: 378 and 379 in the sequence listing. The specification also describes making many constructs including a construct comprising both SEQ ID NOs: 378 and 379 ([0388], Example 1, Table 14), and using only such construct (not the other constructs) comprising both SEQ ID NOs: 378 and 379 to infiltrate plant leaves using Agrobacterium as a medium ([0389], Example 2, Table 15). The specification plans to use such construct for vertical transmission of a cargo RNA in plants ([0390], Example 3). However, the specification fails to describe that the genus of sequences having 70% or even 94% sequence identities to SEQ ID NO: 378 or 379, can serves as 5’ and 3’ replication elements, and be recognized by the same RDRP, not to mention are connected to the claimed functions. The specification does not show any mutant(s) or variant(s) of SEQ ID NO: 378 (110 bases) or 379 (185 bases), even by one base change, not to mention to demonstrate such mutant(s) or variant(s) has/have the claimed functions. According to the specification ([0028]), the percent identities are based bioinformatics tools like BLAST. However, in the art, Friedberg (Automated protein function prediction--the genomic challenge. Brief. Bioinformatics. 7:225-242, 2006) teaches that homology-based transfer is not reliable for functional annotation even with high- alignment percentages (page 227, second column). Friedberg also teaches that identification of functionally significant sub-regions is critical to functional annotation, and that often addition, deletion, or re-shuffling of domains can lead to errors in annotation (page 227, second column; page 228, 1st paragraph). Friedberg teaches that sequence-based tools are just not sensitive enough to identify functional protein similarity as databases get larger, and diversity of sequences gets larger (page 228, first full paragraph). Wang et al (From Protein Sequence to Protein Function via Multi-Label Linear Discriminant Analysis. IEEE/ACM TRANSACTIONS ON COMPUTATIONAL BIOLOGY AND BIOINFORMATICS, VOL. 14, NO. 3, 503-513, 2017) teach that FASTA and Basic Local Alignment Search Tool (BLAST) are useful but have limitations. Because a duplicate of a gene could adopt a new function in response to selective pressure during evolution, function transfer by homology on such gene and its product could produce erroneous results (p503, left col, 2nd para). There is no literature addressing the issue which criterion and which algorithm is optimal for protein function prediction. Moreover, genes evolve at different rates due to both uneven selection pressure on their functions and the inherent mutation rate of different species, which means that it is difficult to establish a similarity measure that is reliable in all cases (p504, left col, 1st para). Computational approaches to predict function is to assist biologist to discover new functional roles for experimental verification (p508, right col, last para). Thus, the sequences and percentage identical thereof obtained by algorisms of bioinformatics tools are not consistent or reliable. Experimental data is the most reliable, specifically for new sequences and new functions. In this case, SEQ ID NO: 378 or 379 is a newly disclosed polynucleotide. There is no published sequence similar to SEQ ID NO: 378 or 379, not to mention describe common structure feature associated to any function of the sequence. Furthermore, Hodge et al (Identification of a Conserved RNA-dependent RNA Polymerase (RdRp)-RNA Interface Required for Flaviviral Replication. JBC, 17437–17449, August 12, 2016) teach that various mutations caused interruption of RDRP recognition and replication impairments (p17437, Abstract; p17439, right col, 1st para; p17444, right col, 1st para in Discussion). Thus, 70% sequence identity or mutating 30% of the base pairs (or 94% sequence identity or mutating 6% of the base pairs) would not likely maintain the RDRP recognition and replication function of the 3’ or 5’ replication element(s). Regarding the description of a representative number of species, SEQ ID NO: 378 is a polynucleotide of 110 bases. For 70% identity, 30%, or 33 bases, can be substituted, deleted or inserted. Thus, the claimed genus has at least (33+32+31+……. +3+2+1) x 3 species for substitution only. In addition, the genus of polynucleotides can be from 77-143 bases long. SEQ ID NO: 379 is a polynucleotide of 185 bases. For 70% identity, 30%, or 55 bases, can be substituted, deleted or inserted. Thus, the claimed genus has at least (55+54+53+……. +3+2+1) x 3 species for substitution only. In addition, the genus of polynucleotides can be from 130-240 bases long. The above is the scope of claim 58. Claim 53 is much broader in scope. Thus, applicant claims an extremely large number of species that are also heterologous in structure. SEQ ID NO: 378 or 379 is the only described and demonstrated species, which does not describe the common structure feature of the claimed genus of species, and is not sufficient to represent the genus of species. Therefore, the application has not met either of the two elements of the written description requirement as set forth in the court’s decision in Eli Lilly, and has not shown her/his possession of the claimed genus. Dependent claims, except claim 57, do not cure the deficiency thus are included. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or non-obviousness. Claims 53-56, 60-61, 63-65, 67-72 are rejected under 35 U.S.C. 103 as being unpatentable over Lindbo (US20200199605, published 6/25/2020, filed 6/7/2018), in view of Byrne et al (The structure of a plant-specific partitivirus capsid reveals a unique coat protein domain architecture with an intrinsically disordered protrusion. Nature Communications. 1-8, 2021), and Rampersad et al (Chapter 3. Replication and Expression Strategies of Viruses. Viruses, p55-82, 2018). Claim 53 is broadly drawn to methods comprising combining a recombinant single-stranded RNA (ssRNA) molecule with a viral capsid protein, wherein the recombinant ssRNA molecule comprises from 5' terminus to 3' terminus: (a) a genus of 5' RNA replication elements recognized by a partitiviral RNA-dependent RNA polymerase (RDRP), wherein the 5' RNA replication element comprises at least a segment of the 5' untranslated region (UTR) of a partitiviral genome or a variant thereof having one or more nucleotide substitutions, insertions, and/or deletions: (b) a cargo RNA molecule; and (c) a genus of 3' RNA replication elements recognized by the RDRP, wherein the 3' RNA replication element comprises at least a segment of the 3' untranslated region (UTR) of the partitiviral genome or a variant thereof having one or more nucleotide substitutions, insertions, and/or deletions; wherein the 5' RNA replication element, the cargo RNA molecule, and the 3' RNA replication element are operably linked and wherein the cargo RNA molecule is heterologous to the 5' RNA replication element and the 3' RNA replication element; and an encapsidation recognition element (ERE), wherein the ERE provides for encapsidation of the ssRNA by the viral capsid protein (wherein clauses), for manufacturing a synthetic partitiviral satellite particle (preamble). Lindbo teaches a method, compositions and system for targeted plant genome editing, using replicating RNAs from a plant virus vector (Abstract). Lindbo teaches that the viral RNAs are single stranded RNAs ([0008]). Lindbo teaches that the virus vector is an RNA based expression system are used to infect plants and express foreign sequences ([0114]). Lindbo teaches assembling/synthesizing virion particles ([0155]), and that such replicating RNAs are enclosed/in combination with a viral capsid ([0159]). Lindbo teaches that in order to express ‘foreign’ sequences from a TMV vector the sequence of interest must be placed under the control of a promoter (RNA sequence) which will be recognized by the replicase of the present disclosure (e.g., TMV RNA dependent RNA Polymerase (RDRP) enzyme) and functionally act as a ‘start site’ (promoter) ([0239]). The start site reads on 5’. Lindbo teaches that the synthetic particle/complex comprises untranslated region ([0250]). Lindbo teaches that the replicating RNA comprises a 3’ terminator site ([0268]). Lindbo teaches that modifications include substitutions, insertions and deletions ([0080]), and specifically teaches that one base substitution occurs in the 5’ of the sequence. Lindbo demonstrated making the viral vector (Example 1, [0375]-[0381]), and demonstrated success of using the vector to express foreign protein, foreign RNA or both protein and RNA, all reading on cargo molecules (Examples 2-4, [0382]-[0406]). Lindbo suggests that with the viral capsid, the system can accommodate large cargo particles ([0386]). Lindbo teaches that an encapsidation element cannot be absent, otherwise the RNAs are easily degraded by RNAse contamination ([0210]). Accordingly, Lindbo teaches or suggests the limitations of claim 53, except does not explicitly teach that the viral vector is derived from a partitiviral genome. Lindbo nevertheless teaches that the recombinant self-replicating RNAs of the present disclosure are based on the double stranded (ds) RNA genomes such as Partitiviridae and so on ([0160]). Lindbo teaches that the recombinant vector is a double stranded DNA vector encoding the self-replicating RNA ([0194], figures 13-17). Thus, Lindbo at the very least strongly suggests using a partitiviral genome and its components to make the vector. Byrne et al teach the structure of partitivirus in detail (whole article). Specifically, Byrne et al teach that partitivirus has typical capsid proteins common like other dsRNA viruses. Partitivirus has RNA-dependent RNA polymerase (RdRp) (p2, left col, 2nd para). Byrne et al teach that there is host recognition of RdRp to partitivirus genome (p2, left col, 3rd para). Byrne et al teach that there is genome encapsidation and capsid protein (CP) (p5, right col, last para). Accordingly, partitivirus has all of components that are needed for making the particle/vector of Lindbo. Moreover, Byrne et al teach and demonstrated making a synthetic expression vector/particle comprising the partitivirus. Byrne et al further teach and demonstrated expressing the vector in plants (p2, 2nd to last paras; p5, right col, 1st para). As analyzed above, Lindbo strongly suggests using a partitiviral genome and its components to make the vector. Byrne et al provide a strong motivation to do so. Rampersad et al teach that double-stranded RNA viruses carry their own RNA synthesizing enzymes within their virions. Once inside a cell, the enzymes transcribe one of the RNA strands of the dsRNA genome to single stranded-RNA (ssRNA) within the virion (p57, 2nd para). Rampersad et al teach that such enzyme is RdRp (p57, FIGUE 3.1). Thus, Rampersad et al provide a strong reason to combine Lindbo and Byrne et al, and provide the expectation of success by combining Lindbo and Byrne et al. Regarding dependent claims, vessel in biology refers to a tubular structure for transporting fluids, nutrients and so on. Lindbo teaches that the virion/viral vector is a tubular filament comprising coat protein (capsid) and single stranded RNA ([0151]), the limitation of claim 54. Byrne et al teach that there is host recognition of RdRp to partitivirus genome (p2, left col, 3rd para). Byrne et al teach and demonstrated making a synthetic expression vector/particle comprising the partitivirus. Byrne et al further teach and demonstrated expressing the vector in plants (p2, 2nd to last paras; p5, right col, 1st para). Thus, Byrne et al teach the limitation of claim 55. Lindbo teaches that a mixture of culture harboring/carrying the viral vector, the limitation of claim 56. Lindbo teaches that replicating RNA is natively located 3' to and adjacent to the 5' UTR sequence region ([0030]), the limitation of claim 60. Lindbo teaches that the vector comprises a viral movement protein to prevent unwanted gene silencing ([0252]), the limitation of claim 61. Regarding claim 62, according to the specification ([0047]), Regarding claim 63, according to the specification ([0047]), OAS is the abbreviation of origin of assembly sequence. Lindbo teaches that TMV assembly region can be included in the vector ([0154]). The recognition should be inherent. Thus, Lindbo suggests the limitation of claim 63. Lindbo teaches that the foreign gene (in the cargo molecule) comprises selectable marker particularly for selecting infected plants from non-infected plants ([0368]), the limitation of claim 64. Lindbo teaches that a ribosomal binding site and the starting codon AUG (of the cargo carried foreign gene) are expressed ([0243]), the limitation of claim 65. Lindbo teaches and demonstrated that a gene encoding a ribozyme in the vector ([0453]), the limitation of claim 67. Lindbo teaches that a gene encoding a ribozyme in the vector ([0453]), the limitation of claim 67. Lindbo teaches that RNA replication elements have 85%, 90%, 95%, 98%, or 99% sequence identity to one another (sequence(s), [0197]), the limitation of claim 68. Regarding claim 69, Byrne et al teach that capsid protein (CP) involves and regulates virus genome encapsidation (including vector comprising the partitivirus genome, p5, right col, last para). As analyzed above, Lindbo teach the vector expresses ssRNA. Thus, Lindbo and Byrne et al collectively suggest the limitation of claim 69. As analyzed above, the synthetic particle and the formulation comprising only the particle of claims 70-71 are the obvious product taught by Linbo in view of Byrne et al. Linbo teaches contacting the replicating RNA of the vector/particle with plants ([0275]), the limitation of claim 72. An invention would have been obvious to one ordinary skill in the art if any teaching, suggestion or motivation in prior art leading the one to combine the teaching(s) or suggestion(s) of the cited references to arrive the claimed invention. In this case, it would have been obvious for one ordinary skill in the art to modify the invention of Lindbo, such that partitivirus is used to make the synthetic viral satellite particle of Lindbo, as suggested by Lindbo and taught by Byrne et al. One ordinary skill in the art would have been motivated to do so because (1) partitivirus has all of the needed component of Lindbo including RDRP, as taught by Byrne et al; and (2) double-stranded RNA viruses synthesize ssRNA using enzyme RDRP, as taught by Rampersad et al. The expectation of success would have been reasonably high, because not only partitivirus has all of the needed component of Lindbo, but also a partitivirus expression vector had been made and transformed into plants by Byrne et al, as a virus expression vector had been made and transformed into plants by Lindbo. Rampersad et al provide additional expectation of succuss because double-stranded RNA viruses synthesize ssRNA using enzyme RDRP. Therefore, the invention would have been obvious to one ordinary skill in the art. Claim 62 is rejected under 35 U.S.C. 103 as being unpatentable over Lindbo in view of Byrne et al and Rampersad et al, as applied to claims 53 and 61 above, and further in view of Waterhouse et al (WO 2017066845, published 4/27/2017, filed 10/24/2026). The teachings of Lindbo in view of Byrne et al and Rampersad et al, as applied to claims 53 and 61 as they are applied to claims 53 and 61 are set forth previously herein and are incorporated by reference. Claim 62 limits claim 61, wherein the tRNA-like element is a tRNA-like sequence SEQ ID NO: 184 (elected by the examiner). Lindbo in view of Byrne et al and Rampersad et al do not teach the specific limitation. Waterhouse et al teach (disclose and characterize) a DNA sequence from Arabidopsis 100% identical to instant SEQ ID NO: 184 as a plant defense-related gene (SEQ ID NO: 44 of Waterhouse et al). See “Sequence Matches” at the end of office action. Waterhouse et al further teach making genetically modified plants by modifying the plant defense-related genes including SEQ ID NO: 44 of Waterhouse et al to enhance plant defense ([0120]-[0121]). Thus, it would have been prima facie obvious to one ordinary skill in the art to modify the invention rendered obvious by the teaching of Lindbo in view of Byrne et al and Rampersad et al, such that the method includes SEQ ID NO: 184 as a cargo or tRNA gene as taught by Waterhouse et al, and to infect and transform plants. One ordinary skill in the art would have been motivated to do so for enhancing plant defense also as taught by Waterhouse et al. The expectation of success would have been high because the sequence had been taught and characterized and ready to use. In addition, the specification does not provide specific reason for using SEQ ID NO: 184-231, not to mention to demonstrate infecting plants to obtain any benefit. Therefore, the dependent claim would have been obvious to one ordinary skill in the art. Remarks Prior art does not disclose, teach or suggest sequences of SEQ ID NOs: 378-379. The closest matches are in the “Sequence Matches” below. Claims 57-59 are thus excluded from art rejection. Sequence Matches Against instant SEQ ID NO: 378 RESULT 1 EX887526 LOCUS EX887526 701 bp mRNA linear EST 30-OCT-2007 DEFINITION RS1BU79TF RS1(AR) Raphanus sativus var. oleiformis cDNA 5', mRNA sequence. ACCESSION EX887526 VERSION EX887526.1 DBLINK BioSample: SAMN00153409 KEYWORDS EST. SOURCE Raphanus sativus var. oleiformis ORGANISM Raphanus sativus var. oleiformis Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; malvids; Brassicales; Brassicaceae; Brassiceae; Raphanus. REFERENCE 1 (bases 1 to 701) AUTHORS Conner,J.K., Shiu,S.H. and Xiao,Y. TITLE Comparative cDNA sequencing in radish (Raphanus), a crop, weed, and model system in ecology and evolution JOURNAL Unpublished COMMENT Contact: Yongli Xiao Plant Genomics J. Craig Venter Institute 9712 Medical Center Drive, Rockville, MD 20850, USA Tel: 301 795 7807 Fax: 301 838 0208 Email: yxiao\@jcvi.org This library is also referred to as AR. FEATURES Location/Qualifiers source 1..701 /organism="Raphanus sativus var. oleiformis" /mol_type="mRNA" /variety="oleiformis" /cultivar="Arena" /db_xref="taxon:463157" /tissue_type="whole seedling (with 1 set of true leaves), buds, and anthers" /clone_lib="SAMN00153409 RS1(AR)" /note="Vector: pDNR-LIB(Clontech); Site_1: SfiIA; Site_2: SfiIB; Total RNA from whole seedling (with 1 set of true leaves), buds, and anthers were pooled together. Double strand cDNA were synthesized from pooled RNA using SMART technology (Clontech). Then the prepared cDNA was normalized by cDNA denaturation/reassociation, treatment by duplex-specific nuclease(DSN) and amplification of normalized fraction by PCR. The normalized cDNA was then digested with SfiI, fractioned, directionally ligated into pDNR-LIB (Clontech) and electroprated into GC10 competent cell (Gene Choice). Sequences were generated from 5' and 3' ends of clones." ORIGIN Query Match 56.5%; Score 62.2; Length 701; Best Local Similarity 84.3%; Matches 70; Conservative 0; Mismatches 13; Indels 0; Gaps 0; Qy 1 GATTAACAGCCTTCATAACGCTTTTTGCAATCAAAATAGAACGCAAATCTCAGCTGCTCT 60 || ||||| | | | |||||||||||||||||||||||||||||||||| |||||| Db 11 GAATAACAACTCTTGACAAGCTTTTTGCAATCAAAATAGAACGCAAATCTCAGTTGCTCT 70 Qy 61 AACTCAACTTTTTACTTACTCTA 83 | |||||||| |||| ||||||| Db 71 ATCTCAACTTGTTACCTACTCTA 93 Against instant SEQ ID NO: 379 RESULT 1 FK630077 LOCUS FK630077 234 bp mRNA linear EST 02-JUL-2008 DEFINITION 454GmaGlobSeed364709 Soybean Seeds Containing Globular-Stage Embryos Glycine max cDNA, mRNA sequence. ACCESSION FK630077 VERSION FK630077.1 DBLINK BioSample: SAMN00165961 KEYWORDS EST. SOURCE Glycine max (soybean) ORGANISM Glycine max Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; fabids; Fabales; Fabaceae; Papilionoideae; 50 kb inversion clade; NPAAA clade; indigoferoid/millettioid clade; Phaseoleae; Glycine; Glycine subgen. Soja. REFERENCE 1 (bases 1 to 234) AUTHORS Bui,A.Q., Le,B.H. and Goldberg,R.B. TITLE A Transcriptome of Soybean Seeds Containing Globular-Stage Embryos JOURNAL Unpublished COMMENT Contact: Goldberg, R.B. Department of Molecular, Cell, & Developmental Biology University of California, Los Angeles 621 Charles E. Young Drive South, Los Angeles, CA 90095-1606, USA Tel: 310 825 3270 Fax: 310 825 8201 Email: bobg\@ucla.edu Raw sequences were initially processed using SeqClean (http://compbio.dfci.harvard.edu/tgi/software/) (parameter -l 25). Processed sequences were then screened against a rRNA database using blastn (parameter -e 0.01). FEATURES Location/Qualifiers source 1..234 /organism="Glycine max" /mol_type="mRNA" /cultivar="Asgrow A3237" /db_xref="taxon:3847" /clone_lib="SAMN00165961 Soybean Seeds Containing Globular-Stage Embryos" /dev_stage="Globular-stage" /note="Organ: Whole seeds; Soybean were grown in the UCLA Plant Growth Center with a 16:8 light-dark cycle at 22oC. Total RNA isolated from soybean seeds containing globular-stage embryos was subjected two rounds of poly(A) selection using a Dynabeads oligo(dT) system (Invitrogen). Complementary DNA (cDNA) was generated from 500 ng of poly(A)-selected mRNA using a SMART PCR cDNA Synthesis kit (Clontech) with 20 cycles of PCR amplification. The cDNA sample was digested with a restriction enzyme Sfi I (New England Biolabs) and then size-fractionated over the Chroma-spin column (Clontech). Fractions containing Sfi I-digested cDNA with size greater than 400 bp were pooled and precipitated. Five micrograms of the size-selected Sfi I-digested cDNA sample was sent to Roche 454 Sequencing Core Facility for generating Soybean Globular-Stage Seed 454 ESTs." ORIGIN Query Match 23.9%; Score 44.2; Length 234; Best Local Similarity 56.6%; Matches 82; Conservative 0; Mismatches 63; Indels 0; Gaps 0; Qy 37 TGCTGTCAAACAGTCTATCTGATTAGAAAGGGTTTTTTTTGCTTTAACTTAACTTTTATC 96 ||||||| | || || | | |||||| | || ||| | | | || || || Db 82 TGCTGTCCCATAGCCTGCCCAAGTAGAAACTATCTTATTTTGTGTCCATGAATCATTTTC 141 Qy 97 TTTAATTTTCTCTTTCCTATACTGATTCCTCGCTTCCTCCCGAAGCGTATTCTTGGAAGC 156 ||||| | || ||| | ||| || | ||| ||| || | |||| | Db 142 TTTAAAATCTATTTGCCTGTGCTGTTTATTTTCTTGGTCCTAAATTTTTTTCTATATATG 201 Qy 157 TCAGCTTCCGACCTAGGAACAAAAA 181 || | || || || || || || Db 202 TCTTTTGCCTTCCAAGAAAAAATAA 226 Against instant SEQ ID NO: 184 BDW04653 (NOTE: this sequence has 11 duplicates in the database searched. See complete list at the end of this report) ID BDW04653 standard; DNA; 4759 BP. XX AC BDW04653; XX DT 15-JUN-2017 (first entry) XX DE Arabidopsis thaliana plant defense-related (PDR) gene, SEQ 44. XX KW PDR gene; crop improvement; ds; gene expression; growth; plant; KW plant defense-related gene; seed; stress tolerance; transgenic plant. XX OS Arabidopsis thaliana. XX CC PN WO2017066845-A1. XX CC PD 27-APR-2017. XX CC PF 24-OCT-2016; 2016WO-AU050997. XX PR 23-OCT-2015; 2015AU-00904348. XX CC PA (UYQU-) UNIV QUEENSLAND TECHNOLOGY. XX CC PI Waterhouse PM, Bally JLS; XX DR WPI; 2017-27143D/33. XX CC PT Improving a growth characteristic of a plant, as compared to a control CC PT plant, comprises inhibiting expression in the plant of a plant defense- CC PT related (PDR) gene and/or inhibiting activity of an expression product of CC PT the PDR gene. XX CC PS Disclosure; SEQ ID NO 44; 148pp; English. XX CC The present invention relates to a method for improving a growth CC characteristic of a plant, as compared to a control plant. The method CC involves inhibiting the expression in the plant of a plant defense- CC related (PDR) gene and/or inhibiting activity of an expression product CC (e.g., RNA or polypeptide) of the PDR gene. The invention also provides: CC a plant cell comprising a genetic modification; a harvestable part or a CC progeny of the plant; a seed comprising a genetic modification; a method CC for producing a plant with an improved growth characteristic by CC introducing a genetic modification in a plant cell; a method for CC expressing a nucleic acid sequence of interest in a plant by co- CC expressing the nucleic acid sequence of interest and modulator nucleic CC acid sequence in cells of the plant; and a method for monitoring a CC population of plants for exposure to a stress condition (e.g., biotic or CC abiotic stress condition) or combination of stress conditions. Sequences CC BDW04610-BDW04826 are Arabidopsis thaliana PDR genes, which can be CC inhibited for improving a growth characteristic of a plant. XX SQ Sequence 4759 BP; 1285 A; 996 C; 1085 G; 1393 T; 0 U; 0 Other; Query Match 100.0%; Score 4759; Length 4759; Best Local Similarity 100.0%; Matches 4759; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 TTCATTCATCATCTTCCTCCTCTCTCTCTTCTCTGTATCACCCAACTAAATCCTCACGGG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 TTCATTCATCATCTTCCTCCTCTCTCTCTTCTCTGTATCACCCAACTAAATCCTCACGGG 60 Qy 61 ATTAGATCCAAAGTCTCAAACTTTGATCCAAAAACACAAACTTTGTTCAAAAGACATAAA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 ATTAGATCCAAAGTCTCAAACTTTGATCCAAAAACACAAACTTTGTTCAAAAGACATAAA 120 Qy 121 CTTTGAGCCAAAGTCACAAGCTTTCTTGGTGAACGATGGATTACAATCCAAATCTTCCTC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 CTTTGAGCCAAAGTCACAAGCTTTCTTGGTGAACGATGGATTACAATCCAAATCTTCCTC 180 Qy 181 CTTTAGGAGGAGGTGGTGTTAGTATGAGAAGAAGCATAAGTCGAAGTGTAAGCAGAGCAA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 CTTTAGGAGGAGGTGGTGTTAGTATGAGAAGAAGCATAAGTCGAAGTGTAAGCAGAGCAA 240 Qy 241 GTAGGAACATTGAAGATATCTTCTCATCTGGTTCAAGAAGAACACAATCAGTCAACGACG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 GTAGGAACATTGAAGATATCTTCTCATCTGGTTCAAGAAGAACACAATCAGTCAACGACG 300 Qy 301 ATGAAGAAGCTCTTAAATGGGCTGCCATTGAGAAGCTACCAACTTACAGTCGTCTCCGAA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 ATGAAGAAGCTCTTAAATGGGCTGCCATTGAGAAGCTACCAACTTACAGTCGTCTCCGAA 360 Qy 361 CCACTCTCATGAACGCTGTAGTCGAAGACGATGTTTACGGTAACCAGCTCATGAGCAAGG 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 CCACTCTCATGAACGCTGTAGTCGAAGACGATGTTTACGGTAACCAGCTCATGAGCAAGG 420 Qy 421 AGGTTGATGTAACCAAGCTTGATGGTGAAGATCGTCAGAAGTTTATTGACATGGTTTTCA 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 AGGTTGATGTAACCAAGCTTGATGGTGAAGATCGTCAGAAGTTTATTGACATGGTTTTCA 480 Qy 481 AAGTAGCTGAGCAAGATAATGAAAGGATCTTGACTAAGCTAAGAAACAGGATCGATAGAG 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 AAGTAGCTGAGCAAGATAATGAAAGGATCTTGACTAAGCTAAGAAACAGGATCGATAGAG 540 Qy 541 TTGGTATCAAACTTCCAACTGTTGAAGTCAGGTACGAGCATTTGACGATTAAAGCTGATT 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 TTGGTATCAAACTTCCAACTGTTGAAGTCAGGTACGAGCATTTGACGATTAAAGCTGATT 600 Qy 601 GTTACACTGGTAATAGATCTCTTCCTACACTTTTGAATGTTGTGAGGAACATGGGAGAGT 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 GTTACACTGGTAATAGATCTCTTCCTACACTTTTGAATGTTGTGAGGAACATGGGAGAGT 660 Qy 661 CTGCTTTAGGTATGATTGGTATTCAATTTGCTAAGAAAGCTCAGCTTACGATTCTTAAAG 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 CTGCTTTAGGTATGATTGGTATTCAATTTGCTAAGAAAGCTCAGCTTACGATTCTTAAAG 720 Qy 721 ATATCTCTGGGGTTATTAAACCTGGAAGGATGACACTTTTGTTGGGTCCTCCTTCTTCTG 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 ATATCTCTGGGGTTATTAAACCTGGAAGGATGACACTTTTGTTGGGTCCTCCTTCTTCTG 780 Qy 781 GTAAGACCACTCTTTTGTTGGCTTTAGCTGGGAAACTTGATAAATCTCTACAAGTCAGTG 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 GTAAGACCACTCTTTTGTTGGCTTTAGCTGGGAAACTTGATAAATCTCTACAAGTCAGTG 840 Qy 841 GTGATATTACTTACAATGGTTACCAACTCGATGAGTTTGTTCCGAGAAAGACCTCTGCTT 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 GTGATATTACTTACAATGGTTACCAACTCGATGAGTTTGTTCCGAGAAAGACCTCTGCTT 900 Qy 901 ACATTAGTCAGAACGATCTTCATGTTGGTATCATGACTGTTAAGGAGACTCTTGACTTCT 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 ACATTAGTCAGAACGATCTTCATGTTGGTATCATGACTGTTAAGGAGACTCTTGACTTCT 960 Qy 961 CTGCTAGGTGTCAAGGTGTTGGTACTCGTTATGATCTGTTGAATGAGCTTGCGAGGAGAG 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 CTGCTAGGTGTCAAGGTGTTGGTACTCGTTATGATCTGTTGAATGAGCTTGCGAGGAGAG 1020 Qy 1021 AAAAGGACGCTGGTATATTCCCGGAAGCCGATGTTGATCTCTTCATGAAAGCTTCTGCTG 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1021 AAAAGGACGCTGGTATATTCCCGGAAGCCGATGTTGATCTCTTCATGAAAGCTTCTGCTG 1080 Qy 1081 CTCAAGGTGTTAAGAACAGTCTCGTCACTGATTATACTCTCAAAATTTTGGGGCTTGACA 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1081 CTCAAGGTGTTAAGAACAGTCTCGTCACTGATTATACTCTCAAAATTTTGGGGCTTGACA 1140 Qy 1141 TTTGCAAAGACACAATAGTTGGAGATGACATGATGAGAGGTATATCTGGAGGTCAGAAGA 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1141 TTTGCAAAGACACAATAGTTGGAGATGACATGATGAGAGGTATATCTGGAGGTCAGAAGA 1200 Qy 1201 AACGTGTCACAACTGGTGAGATGATTGTTGGACCTACTAAGACACTCTTCATGGACGAAA 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1201 AACGTGTCACAACTGGTGAGATGATTGTTGGACCTACTAAGACACTCTTCATGGACGAAA 1260 Qy 1261 TATCCACTGGTCTTGACAGTTCCACTACTTTCCAAATCGTCAAGTGTCTGCAACAAATCG 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1261 TATCCACTGGTCTTGACAGTTCCACTACTTTCCAAATCGTCAAGTGTCTGCAACAAATCG 1320 Qy 1321 TTCACCTCAATGAAGCCACGGTGCTCATGTCTCTCCTCCAGCCTGCTCCTGAGACTTTTG 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1321 TTCACCTCAATGAAGCCACGGTGCTCATGTCTCTCCTCCAGCCTGCTCCTGAGACTTTTG 1380 Qy 1381 ATTTATTCGATGATATCATCTTGGTGTCGGAAGGTCAGATCGTGTACCAAGGACCGAGAG 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1381 ATTTATTCGATGATATCATCTTGGTGTCGGAAGGTCAGATCGTGTACCAAGGACCGAGAG 1440 Qy 1441 ACAACATTCTTGAGTTCTTTGAGAGCTTTGGGTTCAAGTGTCCTGAGAGAAAAGGAACAG 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1441 ACAACATTCTTGAGTTCTTTGAGAGCTTTGGGTTCAAGTGTCCTGAGAGAAAAGGAACAG 1500 Qy 1501 CTGATTTCCTGCAAGAGGTTACTTCCAAGAAAGATCAAGAACAGTACTGGGTGAACCCGA 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1501 CTGATTTCCTGCAAGAGGTTACTTCCAAGAAAGATCAAGAACAGTACTGGGTGAACCCGA 1560 Qy 1561 ACAGACCTTATCACTACATTCCGGTTTCAGAGTTTGCCAGTAGATACAAGAGTTTCCATG 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1561 ACAGACCTTATCACTACATTCCGGTTTCAGAGTTTGCCAGTAGATACAAGAGTTTCCATG 1620 Qy 1621 TTGGGACGAAGATGTCTAACGAACTTGCAGTACCGTTCGATAAGTCTCGCGGCCACAAAG 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1621 TTGGGACGAAGATGTCTAACGAACTTGCAGTACCGTTCGATAAGTCTCGCGGCCACAAAG 1680 Qy 1681 CAGCTCTTGTGTTCGATAAGTACTCTGTCTCAAAGAGGGAGCTTCTCAAGAGCTGTTGGG 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1681 CAGCTCTTGTGTTCGATAAGTACTCTGTCTCAAAGAGGGAGCTTCTCAAGAGCTGTTGGG 1740 Qy 1741 ACAAAGAGTGGCTGCTTATGCAGCGAAACGCGTTCTTCTATGTTTTCAAGACTGTCCAGA 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1741 ACAAAGAGTGGCTGCTTATGCAGCGAAACGCGTTCTTCTATGTTTTCAAGACTGTCCAGA 1800 Qy 1801 TCGTCATCATTGCTGCAATCACGTCTACACTCTTCCTGAGAACCGAAATGAACACAAGAA 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1801 TCGTCATCATTGCTGCAATCACGTCTACACTCTTCCTGAGAACCGAAATGAACACAAGAA 1860 Qy 1861 ACGAGGGTGATGCTAATCTCTACATAGGAGCATTGCTATTTGGAATGATCATCAACATGT 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1861 ACGAGGGTGATGCTAATCTCTACATAGGAGCATTGCTATTTGGAATGATCATCAACATGT 1920 Qy 1921 TTAATGGGTTTGCGGAGATGGCTATGATGGTTTCAAGACTCCCTGTGTTCTACAAACAGA 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1921 TTAATGGGTTTGCGGAGATGGCTATGATGGTTTCAAGACTCCCTGTGTTCTACAAACAGA 1980 Qy 1981 GGGATCTCTTGTTTTATCCATCCTGGACCTTCTCACTTCCCACTTTCTTGCTTGGGATTC 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1981 GGGATCTCTTGTTTTATCCATCCTGGACCTTCTCACTTCCCACTTTCTTGCTTGGGATTC 2040 Qy 2041 CAAGCTCAATATTAGAATCGACGGCTTGGATGGTGGTGACTTATTACTCCATTGGTTTTG 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2041 CAAGCTCAATATTAGAATCGACGGCTTGGATGGTGGTGACTTATTACTCCATTGGTTTTG 2100 Qy 2101 CACCTGACGCCAGCCGCTTCTTCAAGCAGTTTCTTCTGGTGTTTCTGATTCAACAAATGG 2160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2101 CACCTGACGCCAGCCGCTTCTTCAAGCAGTTTCTTCTGGTGTTTCTGATTCAACAAATGG 2160 Qy 2161 CTGCATCCCTCTTTAGGTTGATTGCTTCTGTGTGCAGAACCATGATGATTGCTAATACTG 2220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2161 CTGCATCCCTCTTTAGGTTGATTGCTTCTGTGTGCAGAACCATGATGATTGCTAATACTG 2220 Qy 2221 GTGGTGCTCTCACTCTACTTCTTGTGTTCTTGCTCGGAGGCTTCCTTCTTCCGAAAGGCA 2280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2221 GTGGTGCTCTCACTCTACTTCTTGTGTTCTTGCTCGGAGGCTTCCTTCTTCCGAAAGGCA 2280 Qy 2281 AGATTCCTGACTGGTGGGGTTGGGCTTACTGGGTATCTCCTCTCACCTATGCTTTCAACG 2340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2281 AGATTCCTGACTGGTGGGGTTGGGCTTACTGGGTATCTCCTCTCACCTATGCTTTCAACG 2340 Qy 2341 GTCTAGTAGTCAATGAAATGTTTGCTCCCAGATGGATGAACAAAATGGCTTCTTCTAACA 2400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2341 GTCTAGTAGTCAATGAAATGTTTGCTCCCAGATGGATGAACAAAATGGCTTCTTCTAACA 2400 Qy 2401 GCACAATAAAGCTTGGAACTATGGTGCTTAATACTTGGGATGTCTACCATCAAAAGAACT 2460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2401 GCACAATAAAGCTTGGAACTATGGTGCTTAATACTTGGGATGTCTACCATCAAAAGAACT 2460 Qy 2461 GGTACTGGATTTCAGTTGGAGCCTTGCTTTGTTTCACAGCCCTCTTCAACATTCTATTCA 2520 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2461 GGTACTGGATTTCAGTTGGAGCCTTGCTTTGTTTCACAGCCCTCTTCAACATTCTATTCA 2520 Qy 2521 CCTTGGCACTTACCTATCTCAACCCTCTTGGGAAGAAGGCAGGTTTACTTCCAGAAGAAG 2580 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2521 CCTTGGCACTTACCTATCTCAACCCTCTTGGGAAGAAGGCAGGTTTACTTCCAGAAGAAG 2580 Qy 2581 AAAATGAAGACGCTGATCAGGGGAAAGATCCAATGCGTAGATCTTTGTCTACTGCAGATG 2640 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2581 AAAATGAAGACGCTGATCAGGGGAAAGATCCAATGCGTAGATCTTTGTCTACTGCAGATG 2640 Qy 2641 GGAACAGAAGAGGAGAGGTCGCAATGGGGAGAATGAGTAGGGACTCTGCGGCTGAAGCAT 2700 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2641 GGAACAGAAGAGGAGAGGTCGCAATGGGGAGAATGAGTAGGGACTCTGCGGCTGAAGCAT 2700 Qy 2701 CAGGTGGTGCAGGCAATAAGAAAGGAATGGTTCTTCCTTTCACTCCTTTAGCTATGTCCT 2760 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2701 CAGGTGGTGCAGGCAATAAGAAAGGAATGGTTCTTCCTTTCACTCCTTTAGCTATGTCCT 2760 Qy 2761 TTGACGACGTCAAATACTTTGTTGACATGCCTGGGGAAATGAGAGACCAAGGAGTTACAG 2820 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2761 TTGACGACGTCAAATACTTTGTTGACATGCCTGGGGAAATGAGAGACCAAGGAGTTACAG 2820 Qy 2821 AAACAAGACTCCAACTGCTTAAAGGTGTGACTGGTGCATTTAGGCCAGGAGTTTTGACTG 2880 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2821 AAACAAGACTCCAACTGCTTAAAGGTGTGACTGGTGCATTTAGGCCAGGAGTTTTGACTG 2880 Qy 2881 CGCTTATGGGAGTGAGTGGTGCCGGTAAGACTACGCTTATGGACGTTTTGGCCGGAAGGA 2940 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2881 CGCTTATGGGAGTGAGTGGTGCCGGTAAGACTACGCTTATGGACGTTTTGGCCGGAAGGA 2940 Qy 2941 AAACAGGTGGATACATTGAAGGAGATGTGAGAATATCAGGATTCCCAAAGGTTCAAGAAA 3000 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2941 AAACAGGTGGATACATTGAAGGAGATGTGAGAATATCAGGATTCCCAAAGGTTCAAGAAA 3000 Qy 3001 CATTTGCTAGAATCTCAGGATATTGTGAGCAGACCGATATTCACTCCCCGCAAGTAACAG 3060 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3001 CATTTGCTAGAATCTCAGGATATTGTGAGCAGACCGATATTCACTCCCCGCAAGTAACAG 3060 Qy 3061 TCAGAGAATCTCTGATTTTCTCTGCTTTCCTTCGTCTTCCTAAAGAAGTCGGCAAAGATG 3120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3061 TCAGAGAATCTCTGATTTTCTCTGCTTTCCTTCGTCTTCCTAAAGAAGTCGGCAAAGATG 3120 Qy 3121 AAAAAATGATGTTTGTGGATCAAGTGATGGAATTGGTAGAGCTGGACAGTCTTAGGGACT 3180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3121 AAAAAATGATGTTTGTGGATCAAGTGATGGAATTGGTAGAGCTGGACAGTCTTAGGGACT 3180 Qy 3181 CCATTGTTGGTTTACCGGGTGTCACGGGGCTTTCCACGGAGCAGAGAAAGAGACTGACAA 3240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3181 CCATTGTTGGTTTACCGGGTGTCACGGGGCTTTCCACGGAGCAGAGAAAGAGACTGACAA 3240 Qy 3241 TCGCGGTGGAGCTTGTAGCCAACCCTTCCATCATCTTTATGGATGAGCCAACTTCAGGGC 3300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3241 TCGCGGTGGAGCTTGTAGCCAACCCTTCCATCATCTTTATGGATGAGCCAACTTCAGGGC 3300 Qy 3301 TAGACGCTAGAGCAGCGGCTATTGTGATGAGGGCGGTAAGGAACACAGTGGACACTGGAA 3360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3301 TAGACGCTAGAGCAGCGGCTATTGTGATGAGGGCGGTAAGGAACACAGTGGACACTGGAA 3360 Qy 3361 GAACCGTGGTCTGCACCATTCATCAGCCTAGCATTGATATCTTTGAAGCATTTGATGAAT 3420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3361 GAACCGTGGTCTGCACCATTCATCAGCCTAGCATTGATATCTTTGAAGCATTTGATGAAT 3420 Qy 3421 TGATGCTGATGAAGAGAGGAGGACAAGTGATTTACGCGGGTCCATTGGGTCAAAACTCTC 3480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3421 TGATGCTGATGAAGAGAGGAGGACAAGTGATTTACGCGGGTCCATTGGGTCAAAACTCTC 3480 Qy 3481 ACAAGGTGGTTGAGTACTTTGAATCTTTCCCCGGAGTGTCCAAGATTCCAGAAAAGTATA 3540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3481 ACAAGGTGGTTGAGTACTTTGAATCTTTCCCCGGAGTGTCCAAGATTCCAGAAAAGTATA 3540 Qy 3541 ACCCGGCCACTTGGATGCTCGAAGCTAGCTCACTCGCCGCTGAGCTAAAGCTTAGTGTTG 3600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3541 ACCCGGCCACTTGGATGCTCGAAGCTAGCTCACTCGCCGCTGAGCTAAAGCTTAGTGTTG 3600 Qy 3601 ACTTTGCTGAGTTATACAATCAATCAGCATTGCACCAGCGAAACAAAGCGTTGGTAAAAG 3660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3601 ACTTTGCTGAGTTATACAATCAATCAGCATTGCACCAGCGAAACAAAGCGTTGGTAAAAG 3660 Qy 3661 AACTAAGTGTACCACCAGCAGGAGCATCAGATCTTTACTTTGCTACACAATTCTCACAAA 3720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3661 AACTAAGTGTACCACCAGCAGGAGCATCAGATCTTTACTTTGCTACACAATTCTCACAAA 3720 Qy 3721 ACACATGGGGACAGTTCAAATCATGCTTATGGAAACAATGGTGGACGTATTGGAGATCTC 3780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3721 ACACATGGGGACAGTTCAAATCATGCTTATGGAAACAATGGTGGACGTATTGGAGATCTC 3780 Qy 3781 CAGACTACAATCTTGTCCGTTTCATCTTCACATTGGCAACATCTCTCTTGATTGGTACAG 3840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3781 CAGACTACAATCTTGTCCGTTTCATCTTCACATTGGCAACATCTCTCTTGATTGGTACAG 3840 Qy 3841 TCTTCTGGCAAATCGGAGGTAACAGGTCGAACGCAGGGGATCTAACAATGGTGATAGGAG 3900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3841 TCTTCTGGCAAATCGGAGGTAACAGGTCGAACGCAGGGGATCTAACAATGGTGATAGGAG 3900 Qy 3901 CATTGTATGCCGCGATTATCTTCGTGGGAATCAACAACTGTTCAACAGTACAACCGATGG 3960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3901 CATTGTATGCCGCGATTATCTTCGTGGGAATCAACAACTGTTCAACAGTACAACCGATGG 3960 Qy 3961 TTGCAGTGGAAAGAACAGTGTTCTACAGAGAAAGAGCAGCAGGAATGTACTCAGCCATGC 4020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3961 TTGCAGTGGAAAGAACAGTGTTCTACAGAGAAAGAGCAGCAGGAATGTACTCAGCCATGC 4020 Qy 4021 CATATGCCATCTCTCAAGTCACTTGTGAGCTTCCCTATGTCCTTATTCAAACCGTTTACT 4080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4021 CATATGCCATCTCTCAAGTCACTTGTGAGCTTCCCTATGTCCTTATTCAAACCGTTTACT 4080 Qy 4081 ACTCACTCATCGTCTACGCCATGGTTGGTTTCGAATGGAAAGCCGAAAAGTTCTTCTGGT 4140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4081 ACTCACTCATCGTCTACGCCATGGTTGGTTTCGAATGGAAAGCCGAAAAGTTCTTCTGGT 4140 Qy 4141 TCGTCTTCGTTAGCTACTTCTCATTCCTCTACTGGACTTACTACGGCATGATGACTGTTT 4200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4141 TCGTCTTCGTTAGCTACTTCTCATTCCTCTACTGGACTTACTACGGCATGATGACTGTTT 4200 Qy 4201 CCCTCACACCAAACCAACAAGTCGCTTCGATTTTCGCCTCAGCGTTTTACGGTATTTTCA 4260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4201 CCCTCACACCAAACCAACAAGTCGCTTCGATTTTCGCCTCAGCGTTTTACGGTATTTTCA 4260 Qy 4261 ACCTCTTCTCTGGTTTCTTCATTCCAAGACCCAAAATCCCAAAATGGTGGATTTGGTACT 4320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4261 ACCTCTTCTCTGGTTTCTTCATTCCAAGACCCAAAATCCCAAAATGGTGGATTTGGTACT 4320 Qy 4321 ACTGGATCTGCCCTGTTGCATGGACCGTGTATGGATTGATAGTGTCGCAGTACGGTGATG 4380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4321 ACTGGATCTGCCCTGTTGCATGGACCGTGTATGGATTGATAGTGTCGCAGTACGGTGATG 4380 Qy 4381 TGGAGACACGTATCCAAGTCCTTGGTGGTGCTCCTGACTTAACCGTCAAGCAATACATTG 4440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4381 TGGAGACACGTATCCAAGTCCTTGGTGGTGCTCCTGACTTAACCGTCAAGCAATACATTG 4440 Qy 4441 AGGACCATTATGGTTTCCAATCTGACTTTATGGGACCAGTGGCGGCTGTACTCATCGCTT 4500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4441 AGGACCATTATGGTTTCCAATCTGACTTTATGGGACCAGTGGCGGCTGTACTCATCGCTT 4500 Qy 4501 TCACCGTCTTCTTCGCCTTCATCTTCGCCTTCTGCATCAGAACTCTCAACTTCCAGACCA 4560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4501 TCACCGTCTTCTTCGCCTTCATCTTCGCCTTCTGCATCAGAACTCTCAACTTCCAGACCA 4560 Qy 4561 GATAAAACCATCTCTCAAACAACAAAGTCTCTTTCTTTTTTTGTATCCTCTGTGTTGTTT 4620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4561 GATAAAACCATCTCTCAAACAACAAAGTCTCTTTCTTTTTTTGTATCCTCTGTGTTGTTT 4620 Qy 4621 ATATGCACTATAAGCTTTGTATGTTCTAAATATGTATTGTAGTGTCATAACGAAATTTTT 4680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4621 ATATGCACTATAAGCTTTGTATGTTCTAAATATGTATTGTAGTGTCATAACGAAATTTTT 4680 Qy 4681 TTGAATATTTTTATTTATTGTCTTATAGATGATGACGAATCGGAATCATGTAATATAATT 4740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4681 TTGAATATTTTTATTTATTGTCTTATAGATGATGACGAATCGGAATCATGTAATATAATT 4740 Qy 4741 CCACTTTTTTTTGTGTTTA 4759 ||||||||||||||||||| Db 4741 CCACTTTTTTTTGTGTTTA 4759 Conclusion No claim is allowed. Contact information Any inquiry concerning this communication or earlier communications from the examiner should be directed to WAYNE ZHONG whose telephone number is (571)270-0311. The examiner can normally be reached 8:30am to 5:00pm EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic, can be reached on 571-270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /Wayne Zhong/ Primary Examiner, Art Unit 1662
Read full office action

Prosecution Timeline

Jul 18, 2024
Application Filed
Jun 16, 2026
Non-Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12660775
WHEAT VARIETY 6PAZF90B
2y 5m to grant Granted Jun 23, 2026
Patent 12653122
TRITICALE CULTIVAR APT1415420
3y 9m to grant Granted Jun 16, 2026
Patent 12655440
GENETICALLY MODIFIED PLANTS THAT EXHIBIT AN INCREASE IN SEED YIELD COMPRISING A FIRST BIOTIN ATTACHMENT DOMAIN-CONTAINING (BADC) GENE HOMOZYGOUS FOR A WILD-TYPE ALLELE, A SECOND BADC GENE HOMOZYGOUS FOR A MUTANT ALLELE, AND HOMOLOGS OF THE FIRST AND SECOND BADC GENES
3y 5m to grant Granted Jun 16, 2026
Patent 12644127
HAPLOID MAIZE TRANSFORMATION
11y 1m to grant Granted Jun 02, 2026
Patent 12642235
SOYBEAN CULTIVAR 29120104
2y 3m to grant Granted Jun 02, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
72%
Grant Probability
94%
With Interview (+21.6%)
2y 11m (~11m remaining)
Median Time to Grant
Low
PTA Risk
Based on 536 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month