DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
Applicant’s remarks and amendments to the claims filed September 11, 2026 are acknowledged. Claims 1, 5, 9, 16, 18, 26, 29, 33, 74-76 were amended, claims 2, 7-8, 17, 23, 27-28, 30, 32, 34, 39, 44, 51, 57, 68, 70, and 73 were cancelled, and claims 77-93 were introduced. Claims 1, 5, 9, 16, 18, 26, 29, 33, 35, 38, and 74-93 are pending.
Restriction/Election
New claims 77-93 are drawn to the invention of Group I. Applicant’s election without traverse of Group I (claims 1, 5, 9, 16, 18, 26, 29, 33, 35, 38, and 74-93) in the reply filed on September 11, 2026 is acknowledged. All claims to non-elected inventions have been cancelled, and therefore, no claims are presently withdrawn. Claims 1, 5, 9, 16, 18, 26, 29, 33, 35, 38, and 74-93 are under consideration hereinafter, accordingly.
Priority
Applicant’s priority claims to Application Nos. PCT/CN2022/073415 and PCT/CN2023/073456 are acknowledged. The certified copy of Application No. PCT/CN2022/073415 has been received. The disclosure of PCT/CN2022/073415 has been reviewed. Claims 1, 5, 9, 16, 18, 26, 29, 33, 35, 38, and 74-93 find support in Application No. PCT/CN2022/073415. The effective filing date of the claims under examination is January 24, 2022.
Nucleotide and/or Amino Acid Sequence Disclosures
Summary of Requirements for Patent Applications Filed On Or After July 1, 2022, That Have Sequence Disclosures
37 CFR 1.831(a) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.831(b) must contain a “Sequence Listing XML”, as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.831-1.835. This “Sequence Listing XML” part of the disclosure may be submitted:
1. In accordance with 37 CFR 1.831(a) using the symbols and format requirements of 37 CFR 1.832 through 1.834 via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter “Legal Framework”) in XML format, together with an incorporation by reference statement of the material in the XML file in a separate paragraph of the specification (an incorporation by reference paragraph) as required by 37 CFR 1.835(a)(2) or 1.835(b)(2) identifying:
a. the name of the XML file
b. the date of creation; and
c. the size of the XML file in bytes; or
2. In accordance with 37 CFR 1.831(a) using the symbols and format requirements of 37 CFR 1.832 through 1.834 on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation by reference statement of the material in the XML format according to 37 CFR 1.52(e)(8) and 37 CFR 1.835(a)(2) or 1.835(b)(2) in a separate paragraph of the specification identifying:
a. the name of the XML file;
b. the date of creation; and
c. the size of the XML file in bytes.
SPECIFIC DEFICIENCIES AND THE REQUIRED RESPONSE TO THIS NOTICE ARE AS FOLLOWS:
Specific deficiency - The incorporation by reference paragraph required by 37 CFR 1.834(c)(1), 1.835(a)(2), or 1.835(b)(2) is defective. USPTO records indicate that the title of the sequence listing filed March 6, 2025 is “PAT059637-WO-PCT02_SL.xml.”
Required response - Applicant must provide a substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3), and 1.125 inserting the required incorporation by reference paragraph, consisting of:
• A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
• A copy of the amended specification without markings (clean version); and
• A statement that the substitute specification contains no new matter.
Specification
The specification is objected to because of the following informalities:
The use of terms which are trade names or marks used in commerce has been noted in this application, e.g., “psiCHECK2” (at least pg. 135, line 29), and “Lipofectamine” (at least pg. 136, line 1). Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. The terms, including the exemplary terms above, should be accompanied by the generic terminology. Furthermore, the terms should be capitalized wherever they appear or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 33, 74, and 77 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claims 33 and 74 recite an “isomannitol residue.” Neither the claims nor specification set forth an explicit definition of an “isomannitol residue,” e.g., by chemical name or structure. The specification provides structures of “exemplary isomannitol residues (imann)” (pg. 78), but does not clearly set forth the required structural features of an “isomannitol residue.” The search did not uncover any art-recognized substances in SciFinder for the term “isomannitol.” The specification also uses the abbreviation “imann” to refer to “isosorbide” (pg. 135, line 21). As shown in Fig. A below, the structures of the specification’s “exemplary isomannitol residues (imann)” appear to correspond to conjugated derivatives of a specific structure (“1,4:3,6-Dianhydro-L-mannitol”), which differs from “isosorbide.” The art provides many additional substances comprising structures similar to the “exemplary isomannitol residues” and isosorbide, e.g., “isomannide.” It is not clear what substances are encompassed by the claim term “isomannitol residue,” e.g., the specific “exemplary isomannitol residues,” isosorbide, and/or one or more of the substances in Fig. A below, which renders the claims indefinite.
FIGURE A
PNG
media_image1.png
316
614
media_image1.png
Greyscale
Claim 77 is rejected for depending from claim 74 and failing to remedy the indefiniteness.
Claim Rejections - 35 USC § 112(d)
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claims 77 and 88 are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Claim 77 recites “The dsRNA agent of claim 74… wherein each nucleotide of SEQ ID NO: 117 has a 2’-O-methyl modification or a 2’-fluoro modification.” Claim 5, from which claim 74 depends, requires “SEQ ID NO: 117.” Based on the sequence listing, SEQ ID NO: 117 sets forth an unmodified RNA sequence. Claim 77, therefore, substitutes an unmodified RNA sequence, for a sequence with modifications (“a 2’-O-methyl modification or a 2’-fluoro modification”). The claim fails to include all the limitations of the claims upon which it depends.
Claim 88 recites “The dsRNA agent of claim 83… wherein each nucleotide of SEQ ID NO: 244 has a 2’-O-methyl modification or a 2’-fluoro modification.” Claim 83 requires “SEQ ID NO: 244.” Based on the sequence listing, SEQ ID NO: 244 sets forth an unmodified RNA sequence. Claim 77, therefore, substitutes an unmodified RNA sequence, for a sequence with modifications (“a 2’-O-methyl modification or a 2’-fluoro modification”). The claim fails to include all the limitations of the claim upon which it depends.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Notice to Joint Inventors
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim Rejections - 35 USC § 103 - Brunner in view of Ui-Tei
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 1, 5, 9, 16, 18, 26, 33, 35, 38, 76, and 78-81 are rejected under 35 U.S.C. 103 as being unpatentable over Brunner (Brunner et al., WO 2022/079221 A1, published 21 April 2022, effectively filed 15 October 2021) in view of Ui-Tei (Ui-Tei et al., 2004, Nucleic Acids Research, Vol. 32, No. 3, pg. 936-948).
It is noted that SEQ ID NOs: 893 and SEQ ID NO: 244 consist of the same nucleobase sequence, and SEQ ID NOs: 889 and 117 consist of the same nucleobase sequence.
Regarding claims 1 and 5, Brunner teaches a dsRNA agent for inhibiting apolipoprotein (a) (LPA) gene expression (“Sequences of LPA siRNA constructs”), wherein the dsRNA agent comprises a sense strand and antisense strand, each no more than 23 nucleotides in length, wherein the sense strand comprises the nucleotide sequence “AGAGUUAUCGAGGCACAUA,” (“SEQ 62”) and the antisense strand comprises the nucleotide sequence “UAUGUGCCUCGAUAACUCU” (“SEQ 361”)(“CNS T# 0062,” Table 1, pg. 18). Brunner teaches the sequence of the LPA mRNA targeted by the dsRNA agent (“The start (ST) and end (ED) nucleotide positions in NM_005577.2 (SEQ ID NO: 1632) are indicated,” [0065]; “ST 563,” “ED 581,” “CNS T# 0062,” Table 1, pg. 18). As shown in Fig. B below, the sense and antisense strands of Brunner’s dsRNA agent are 19 nucleotides in length, fully complementary to one another, and fully complementary or identical to the target LPA mRNA. With respect to the nucleobase sequences required of instant claims 1 and 5, the sense and antisense strands of Brunner’s dsRNA agent are 100% identical to nucleobases 2-20 of instant SEQ ID NOs: 893/244, and 889/117, respectively.
FIGURE B
GACAGAGTTATCGAGGCACATACTC nts 560-584 SEQ ID NO: 1632, Brunner
antisense strand
UAUGUGCCUCGAUAACUCU SEQ ID NO: 361, Brunner
TTATGTGCCTCGATAACTCTC SEQ ID NO: 893/244
sense strand
AGAGUUAUCGAGGCACAUA SEQ ID NO: 62, Brunner
GAGAGTTATCGAGGCACATAA SEQ ID NO: 889/117
Brunner does not teach a dsRNA comprising the nucleobase sequences of instant SEQ ID NOs: 893/244 and 889/117, because as shown in Fig. B above, the sense and antisense strand of Brunner’s dsRNA agent do not comprise the 5’-most and 3’-most nucleobases of instant SEQ ID NOs: 893/244 and 889/117, respectively.
However, Brunner teaches dsRNA agents in which the sense and antisense strands are each 21 nucleotides in length (“the sense strand may have 21, 22, 23, or 24 nucleotides… while the antisense strand may have 21 nucleotides,” [0044]). Brunner teaches dsRNA agents which are fully complementary to one another, and comprise a mismatch relative to the LPA target RNA at the 5’-most and 3’-most nucleotide of the antisense strand (“the sense and antisense sequences are substantially or fully complementary to each other,” [0035]; the antisense sequence of the LPA mRNA-targeting dsRNA comprises one or more mismatches to the target sequence… the one or more mismatches are not located in the center region of complementarity… the one or more mismatches are located within… one nucleotide of the 5’ and/or 3’ ends of the region of complementarity,” [0064]). As shown in Fig. C below, the sense and antisense strands of SEQ ID NOs: 893/244 and 889/117, while fully complementary to one another, are mismatched relative to the target LPA mRNA at the 5’-most and 3’-most nucleotide of each strand (see bolded nucleotides).
FIGURE C
GACAGAGTTATCGAGGCACATACTC nts 560-584 SEQ ID NO: 1632, Brunner
5’AGAGUUAUCGAGGCACAUA 3’ SEQ ID NO: 62, Brunner
3’UCUCAAUAGCUCCGUGUAU 5’ SEQ ID NO: 361, Brunner (reverse)
5’GAGAGTTATCGAGGCACATAA 3’ SEQ ID NO: 889/117
3’CTCTCAATAGCTCCGTGTATT 5’ SEQ ID NO: 893/244 (reverse)
Brunner teaches the parameters which would result in a dsRNA comprising the nucleobase sequences of instant SEQ ID NOs: 893/244 and 889/117, but does not appear to provide motivation to modify the dsRNA so as to arrive at the instantly claimed dsRNA.
However, Ui-Tei teaches four design “rules” to prepare a dsRNA agent “capable of inducing highly effective gene silencing in mammalian cells” (Abstract). The rules are I) an A/U base pair at the 5’ end of the antisense strand, II) G/C base pair at the 5’ end of the sense strand, III) at least five A/U residues in the 5’ terminal one-third of the antisense strand, and IV) the absence of any GC stretch more than 9-nts in length (Abstract, pg. 936, right col.; Fig. 2). Ui-Tei teaches that dsRNA agents opposite in features with respect to the first three conditions “bring about little or no gene silencing” (pg. 944-945). As shown in Fig. C above, SEQ ID NOs: 893/244 and 889/117 meet each of Ui-Tei’s design rules, including the inclusion of a G/C base pair at the 5’ end of the dsRNA agent with respect to the sense strand, and an A/U base pair at the 5’ end of the agent with respect to the antisense strand.
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the dsRNA agent of Brunner using the design rules of Ui-Tei, so as to arrive at a dsRNA comprising the nucleobase sequences of instant SEQ ID NOs: 893/244 and 889/117. It would have amounted to preparing a dsRNA agent using known design principles, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success in preparing the dsRNA because as evidenced by Brunner and Ui-Tei, design principles for preparing dsRNA agents were known in the art, including designs which comprise mismatched ends relative to the target mRNA, a G/C base pair at the 5’ end relative to the sense strand, and an A/U base pair at the 5’ end of the agent with respect to the antisense strand. The skilled artisan would have had a reasonable expectation that the resulting dsRNA agent would be effective for use in inhibiting LPA gene expression because Brunner describes an effective dsRNA agent (“0059,” Table 1, pg. 18; “siLPA#0059,” Table 5, pg. 107) which overlaps the target region of the dsRNA agent, and because Ui-Tei teaches that dsRNA agents which follow the four design rules are “capable of inducing highly effective gene silencing in mammalian cells.” The skilled artisan would have been motivated to design additional dsRNA agents using the known design principles of Brunner and Ui-Tei in an effort to develop inhibitors of LPA expression for use in diseases associated with elevated Lp(a) and atherosclerosis-promoting lipids as described by Brunner ([0008]).
Neither Brunner nor Ui-Tei teach a dsRNA comprising an antisense strand with the 2’-OMe, 2’-fluoro, or phosphorothioate modifications set forth in SEQ ID NO: 893.
Regarding the phosphorothioate linkages of the instantly claimed antisense strand, Brunner teaches antisense strands comprising two phosphorothioate linkages at the 5’ terminus, and two phosphorothioate linkages at the 3’ terminus (see “Antisense strand sequence (5’-3’),” “PS,” in Table 3). Thus, Brunner teaches the positions of the phosphorothioate linkages in SEQ ID NOs: 893.
Regarding the combinations of 2’-fluoro and 2’-OMe modified nucleotides in the antisense strand set forth in SEQ ID NO: 893, Brunner teaches dsRNA agents comprising sense and antisense strands comprising an alternating pattern of 2’-fluoro and 2’-OMe modified nucleotides (“the sense and antisense sequence of the dsRNA comprise alternating 2’-O-methyl ribonucleotides and 2’-deoxy-2’-fluoro ribonucleotides,” [0085]; “These LPA siRNA sequences comprise a fixed pattern of 2’-O-methyl and 2’-fluoro modified nucleotides (Table 1),” [0169]; “Table 3 below lists the sequences of exemplary modified GalNAc-siRNA constructs derived from selected siRNA constructs listed in Table 2,” [0110]; Table 3; “Table 4 lists the sequences of optimized GalNAc-siRNA constructs derived from selected LPA GalNAc-siRNA constructs listed in Table 3,” [0111]; Table 4). Brunner demonstrates that the dsRNA agents comprising sense and antisense strands comprising alternating 2’-fluoro and 2’-OMe patterns are effective in inhibiting LPA expression (see at least Examples 1-3, pg. 101-109). As shown in Fig. C below, the modification pattern of SEQ ID NOs: 893 and 889 alternates between 2’-OMe and 2’-fluoro modified nucleotides.
FIGURE C
5’ gagaguuaUcGaGgcacauaa 3’ sense (SEQ ID NO: 889)
3’ cucucAaUaGcuccGuguaUu 5’ antisense (SEQ ID NO: 893)
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have applied an alternating 2’-OMe and 2’-fluoro modification pattern, and terminal phosphorothioate linkage design as taught by Brunner to the dsRNA agent rendered obvious above, in order to arrive at the 2’-OMe, 2’-fluoro, and phosphorothioate modifications set forth in SEQ ID NOs: 893, and a sense strand comprising an alternating 2’-fluoro and 2’-OMe pattern. It would have amounted to applying known design principles to an obvious dsRNA agent, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success in preparing an effective dsRNA agent with an alternating 2’-OMe and 2’-fluoro modification pattern in the antisense and sense strands, and terminal phosphorothioate modifications in the antisense strand, because Brunner teaches examples of effective dsRNA agents with alternating 2’-OMe and 2’-fluoro modification patterns, and terminal phosphorothioate linkages in the antisense strand, and means to prepare such agents was well-known in the art as evidenced by Brunner. In an effort to develop inhibitors of LPA expression for use in diseases associated with elevated Lp(a) and atherosclerosis-promoting lipids as described by Brunner ([0008]), the skilled artisan would have been motivated to prepare the dsRNA agent rendered obvious above with an alternating 2’-OMe and 2’-fluoro modification pattern and terminal phosphorothioate linkages in the antisense strand, because effective dsRNA agents of Brunner have such a pattern.
Regarding claim 9, the sense strand rendered obvious above comprises at least one modified oligonucleotide, wherein the at least one modified oligonucleotide is a 2’-O-methyl nucleotide.
Regarding claim 16, Brunner teaches sense strands comprising 2 or 4 phosphorothioate linkages (Tables 3-4).
Regarding claim 18, all nucleotides of the sense strand rendered obvious above are modified nucleotides.
Regarding claim 26, Brunner teaches one or more targeting groups comprising a GalNAc conjugated to the sense strand ([0120]; [0217]).
Regarding claim 33, Brunner teaches a reverse abasic nucleotide at the 3’-end and/or 5’-end of the sense strand (“End modifications may include, for example, 5’ end modifications (e.g.,… inverted linkages) and 3’ end modifications (e.g.,… inverted linkages). Base modifications may include e.g.,… removal of bases (abasic modifications of nucleotides,” [0082]; “the dsRNA comprises an inverted 2’-deoxyribonucletoide at the 3’ end of its sense or antisense strand,” [0084]).
Regarding claim 35, Brunner teaches the sense and/or antisense strand comprise a 3’ overhang of at least 1-2 nucleotides ([0051], [0053]).
Regarding claims 38 and 81, Brunner teaches a composition comprising the dsRNA agent and a pharmaceutically acceptable carrier, wherein the carrier comprises a sodium salt (“The present dsRNAs can be formulated with a pharmaceutically acceptable excipient… saline solution… sodium acetate… sodium lauryl sulfate,” [0126]-[0127]).
Regarding claim 76, the sense strand rendered obvious above comprises one or more phosphorothioate linkages, one or more 2’-O-methyl nucleotides, and one or more 2’-fluoro nucleotides. As stated above, Brunner teaches sense strands comprising 2 or 4 phosphorothioate linkages (Tables 3-4).
Regarding claim 78, Brunner teaches dsRNA with two blunt ends ([0052]), such that an antisense strand consisting of SEQ ID NO: 893 is also obvious for the reasons described above.
Regarding claim 79, Brunner teaches compositions packaged in a container ([0162]).
Regarding claim 80, Brunner teaches compositions formulated for subcutaneous administration ([0153]).
Claim Rejections - 35 USC § 103 – Brunner and Ui-Tei in further view of Li
Claims 29 and 75 are rejected under 35 U.S.C. 103 as being unpatentable over Brunner (Brunner et al., WO 2022/079221 A1, published 21 April 2022, effectively filed 15 October 2021) in view of Ui-Tei (Ui-Tei et al., 2004, Nucleic Acids Research, Vol. 32, No. 3, pg. 936-948) as applied to claims 1, 5, 9, 16, 18, 26, 33, 35, 38, 76, and 78-81, in further view of Li (Li et al., WO 2018/044350 A1, 18 March 2018).
The teachings of Brunner and Ui-Tei are described above and applied as to claims 1, 5, 9, 16, 18, 26, 33, 35, 38, 76, and 78-81 therein. Brunner also teaches that the dsRNA agents may be conjugated to a targeting group, wherein the targeting group comprises three GalNAc derivatives connected via a trivalent branched linker (0120). Brunner teaches the GalNAc derivatives may be attached to the 5’ end of the sense strand ([0120]; [0217]).
Neither Brunner nor Ui-Tei teach the targeting group structure “GLS-15” recited in claims 29 and 75.
However, Li teaches a trivalent GalNAc targeting group (“(NAG37)s”), the structure of which is provided in Fig. D below (pg. 174). Li teaches attaching the targeting group to the 5’ end of a sense strand via a phosphorothioate linkage (“a targeting ligand is linked to a double-stranded RNAi agent via a… phosphorothioate… linking group, at the 5’ end of the terminal nucleoside of the sense strand of the double-stranded RNAi agent,” pg. 36; “the linker is linked to a phosphorothioate,” pg. 37). Li teaches the targeting group follows the structural formula of “Formula II” (pg. 34). Using the terminology of Formula II, (NAG37)s is a trivalent GalNAc-comprising targeting group, that comprises identical “targeting moieties” (solid boxes), “tethers” (dashed boxes), and a similar “linker” (circles) to the instantly claimed targeting group, GLS-15. (NAG37)s and GLS-15 comprise different “branch points” and “linker” moieties (pg. 34). See Fig. E which highlights these differences (dashed circles).
FIGURE D
PNG
media_image2.png
720
960
media_image2.png
Greyscale
FIGURE E
PNG
media_image3.png
720
960
media_image3.png
Greyscale
Li also teaches additional linker groups, having the following structure, in which “V” consists of “piperidine” (pg. 41, lines 11-21). Piperidine is a six-membered ring consisting of five methylene bridges (-CH2-) and one amine bridge (-NH-). The structure below, in which V is piperidine, is substantially identical to the linker of GLS-15.
PNG
media_image4.png
146
262
media_image4.png
Greyscale
Li teaches additional branch points, including branch points which are substantially identical to that of GLS-15 (pg. 43-49; Structures 201-208). The branch point structure of GLS-15 comprises two nitrogen, separated by three methylene, wherein one nitrogen (bottom in Fig. F above) is connected to two tethers, and the other nitrogen (top in Fig. F above) is connected to a tether and the linker. (NAG27)s branch point structure comprises two carbons, separated by an amide and two methylene, wherein one carbon is attached to two tethers, and the other carbon is attached to a tether and the linker. As another example, the branch point structure of Li’s Structure 1010a (pg. 72) comprises a nitrogen and a carbon separated by a carbonyl and two methylene, in which the nitrogen is attached to two tethers, and the carbon is attached to a tether and an amide-containing linker. Taken together, Li teaches GalNAc-comprising targeting groups which, with the exception of the exact branch point and linker structure, meet the structural elements of GLS-15.
MPEP 2144.09(I) states that “A prima facie case of obviousness may be made when chemical compounds have very close structural similarities and similar utilities. “An obviousness rejection based on similarity in chemical structure and function entails the motivation of one skilled in the art to make a claimed compound, in the expectation that compounds similar in structure will have similar properties.” In re Payne, 606 F.2d 303, 313, 203 USPQ 245, 254 (CCPA 1979).”
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the linker and branch point structures of the targeting group disclosed by Li to make the targeting group “GLS-15,” and attached the resulting group to the 5’ end of the sense strand of the dsRNA agent via a phosphorothioate linkage. GLS-15 has very close structural similarities to the GalNAc-containing targeting groups of Li, including identical targeting moieties and tethers, and as described immediately above, highly similar branch point and linker moieties. GLS-15 also has a substantially identical utility to the targeting groups of Li, i.e., targeting of a dsRNA agent to a desired tissue. As evidenced by Li, it was well within the purview of the skilled artisan to design and synthesize GalNAc-containing targeting groups comprising different, but structurally similar, branch point and linker moieties, and to attach GalNAc targeting groups to the 5’ end of the sense strand via a phosphorothioate linkage. Based on the many branch point and linker examples of Li, the skilled artisan would have predicted that structurally similar branch points and linkers, e.g., those of instant GLS-15, would function similarly (i.e., provide a junction for the tethers and linker, and link the targeting group to the dsRNA agent), and result in a functional GalNAc targeting group for attachment to the dsRNA agent. In an effort to develop inhibitors of LPA expression for use in diseases associated with elevated Lp(a) and atherosclerosis-promoting lipids as described by Brunner ([0008]), the skilled artisan would have been motivated to make additional, structurally and functionally similar GalNAc-containing targeting groups to those of Li, and to attach them to the 5’ end of the sense strand of the dsRNA agent as taught by Li.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Application No. 19/196,722
Claims 1, 5, 9, 16, 18, 26, 29, 33, 35, 38, and 74-93 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 82, 87-89, and 104-109 of co-pending Application No. 19/196,722 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other for the reasons that follow. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Co-pending claims 82 and 105 are directed to species of the dsRNA claimed in instant claims 1, 5, 9, 16, 18, 26, 29, 33, 35, 74-78, and 82-89. Instant claims 1, 5, 9, 16, 18, 26, 29, 33, 35, 74-78, and 82-89 are, therefore, anticipated by the co-pending claims. Co-pending claims 87-89, 104, and 106-109 anticipate instant claims 38, 79-81, and 90-93.
Allowable Subject Matter
A thorough search of the prior art failed to uncover any teaching or suggestion of a dsRNA agent comprising a sense and antisense strand, wherein the sense strand comprises or consists of SEQ ID NO: 889, and the antisense strand comprises or consists of SEQ ID NO: 893. Specifically, as described above, the prior art renders obvious the nucleobase sequences of SEQ ID NOs: 889 and 893 (which are identical to the nucleobase sequences of SEQ ID NOs: 117 and 244), and some chemical modifications applied thereto as set forth in the sequence listing (i.e., 2’-OMe, 2’-F, phosphorothioate linkages, GLS-15). However, the prior art does not appear to teach or suggest including “isomannitol” or “Imann” structures in a dsRNA agent, wherein the “isomannitol” or “Imann” structures are interpreted as recited in instant claims 82 and 89. The dsRNA agents comprising the sequence set forth in SEQ ID NO: 889, which comprises an Imann structure at its 3’ end and at the 5’ end between the GLS-15 and the 5’ most nucleotide, or a sense strand comprising SEQ ID NO: 117 wherein the 3’ end of the sense strand comprises an Imann structure, are free of the prior art considered during examination.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JENNA L PERSONS whose telephone number is (703)756-1334. The examiner can normally be reached M-F: 9-5pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, JENNIFER A DUNSTON can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JENNA L PERSONS/Examiner, Art Unit 1637
/Soren Harward/Primary Examiner, TC 1600
