Prosecution Insights
Last updated: September 26, 2026
Application No. 18/730,790

TRUNCATED FORMS OF IGA PROTEASE, FUSION PROTEINS COMPRISING A TRUNCATED FORM OF IGA PROTEASE AND USES THEREOF

Non-Final OA §103§112
Filed
Jul 22, 2024
Priority
Jan 29, 2022 — CN 202210112254.7 +2 more
Examiner
ROBINSON, HOPE A
Art Unit
Tech Center
Assignee
Shanghai Alezyme Pharmaceuticals Ltd.
OA Round
1 (Non-Final)
68%
Grant Probability
Favorable
1-2
OA Rounds
1y 1m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 68% — above average
68%
Career Allowance Rate
714 granted / 1055 resolved
+7.7% vs TC avg
Strong +43% interview lift
Without
With
+43.1%
Interview Lift
resolved cases with interview
Typical timeline
3y 3m
Avg Prosecution
61 currently pending
Career history
1122
Total Applications
across all art units

Statute-Specific Performance

§101
6.7%
-33.3% vs TC avg
§103
19.7%
-20.3% vs TC avg
§102
17.0%
-23.0% vs TC avg
§112
50.0%
+10.0% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1055 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status 1. The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . 2. The Preliminary Amendment filed on October 24, 2024, December 9, 2025 and June 18, 2026, have been received and entered. Restriction Requirement 3. Applicant’s election of Group I without traverse, on June 18, 2026, is acknowledged. Claim Disposition 4. Claims 2-4, 6, 9-14, 16-23, 25-51, 53, 56-60, 64-66 and 68 are canceled. Claims 1, 5, 7-8, 15, 24, 52, 54-55, 61-63, 67 and 69-75 are pending. Claims 1, 5, 7-8, 15, 24, 61 and 69-75 and are under examination. Claims 52, 54-55, 62-63 and 67 are withdrawn from further consideration pursuant to 37 CFR1.12(b), as being drawn to a non-elected invention, there being no allowable generic or linking claim. Claim 61 is only being examined to the extent that it pertains to the elected subject matter. Information Disclosure Statement 5. The Information Disclosure Statements filed on March 26, 2025, December 2, 2024, July 22, 2024 and March 26, 2026, have been received and entered. The references cited on the PTO-1449 Form have been considered by the examiner and a copy is attached to the instant Office action. Note that a few references have been lined through based on a missing date or improper citation of the date. Drawing 6. The Drawings filed on July 22, 2024, are accepted by the examiner. Abstract Objection 7. The abstract is objected to for the following informalities: “The present disclosure relates to a truncated form of IgA protease, a fusion protein comprising a truncated form of IgA protease ([[e.g.]] for example, a fusion protein comprising a truncated form of IgA protease and Fc) and uses thereof in treating diseases associated with IgA deposition ([[e.g.]] for example, IgA nephropathy) ". Specification Objection 8. The specification is objected to for the following informalities: The title of the invention is not descriptive. A new title is required that is clearly indicative of the invention to which the claims are directed. The following is suggested: "Truncated Forms of IgA Protease and Methods of using the same". The specification is objected to for the following at paragraph [0004], “…..Clostridium ramosum or having at least 70% sequence identity to the non-natural truncated fragment”, because no structure is provided for said comparison (see page 1). The specification is objected to because trademarks are disclosed and they are capitalized but don’t all have generic terminology. The use of the trademark such as FLAG, has been noted in this application (see page 6, for example). It should be capitalized wherever it appears and be accompanied by the generic terminology. Although the use of trademarks is permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner, which might adversely affect their validity as trademarks. The specification is objected to for the typographical error that appears on page 132 of [[SEQ ID NO: 61`76]], which should be “SEQ ID NOs: 61-76”. See also paragraph [0186] o page 131 (among others like temperature ranges throughout the specification). Appropriate correction is required. Sequence Compliance 9. This application contains sequence disclosures that are encompassed by the definitions for nucleotide and/or amino acid sequences set forth in 37 CFR 1.821(a)(1) and (a)(2). However, this application fails to comply with the requirements of 37 CFR1.821 through 1.825; applicant's attention is directed to the final rule making notice published at 55 FR 18230 (May 1, 1990), and 1114 OG 29 (May 15, 1990). To be in compliance, applicant is required to identify all amino acid sequences of at least 4 L-amino acids and at least 10 nucleotides by a sequence identifier, i.e., "SEQ ID NO:". The specification discloses sequences that have not been identified by a sequence identifier, see for example, ‘GGGGS’ on page 125, paragraphs [0153] and [0154]. If these sequences have not been disclosed in the computer readable form of the sequence listing and the paper copy thereof, applicant must provide a computer readable form of the "Sequence Listing" including these sequences, a paper copy of the "Sequence Listing", as well as an amendment directing its entry into the specification, and a statement that the content of the paper and computer readable form copies are the same and, where applicable, include no new matter as required by 37 CFR 1.821(e) or 1.821(f) or 1.821(g) or 1.821(b) or 1.825(d). See the attached Notice to Comply with the sequence rules. Claim objection 10. Claims 1, 5, 7-8, 15, 24, 61 and 69-75 are objected to for the following informalities: For clarity and precision of claim language it is suggested that claim 1 is amended to recite “An isolated truncated form of IgA protease, comprising a non-natural truncated fragment of a wild-type IgA protease obtained from [[or derived]] from Clostridium ramosum or having at least [[70]] 90% sequence identity to [[the non-natural truncated fragment]] SEQ ID NO: 1”. The dependent claims hereto are also included, especially claims 7 and 24 with similar language. For clarity it is suggested that claim 8 is amended to recite, “……wherein [[an amino acid sequence of]] the wild-type IgA protease…..is [[as]] set forth in SEQ ID NO:1….”. Claim 61 is objected to for the recitation of non-elected subject matter. For clarity it is suggested that claim 61 is amended to read, “A pharmaceutical composition comprising the truncated form of IgA of claim 1, a fusion protein comprising the truncated form of IgA protease, [[ a nucleic acid comprising a nucleotide sequence encoding the truncated form of IgA protease, a vector comprising the nucleic acid, or a cell comprising the nucleic acid]], and a pharmaceutically acceptable carrier”. Appropriate correction is required. Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. 11. Claims 1, 5, 7-8, 15, 24, 61 and 69-75 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AlA), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. The claimed invention is directed to “an isolated truncated form of IgA protease, comprising a non-natural truncated fragment of a wild-type IgA protease obtained from or derived from C. ramosum or having at least 70% sequence identity to the non-natural truncated fragment”, the claimed invention is devoid of any structural limitations. The claimed invention encompasses a large variable genus of truncated IgA protease and any structure that is at least 70% identical to any structure since no reference structure is provided, thus not adequately described. The claimed invention is overly broad and not commensurate in scope with the disclosure in the specification. The invention also claims a fusion protein having a wild-type structure that is not provided and truncated fragments; and a pharmaceutical composition with the same truncated form that is not clearly defined. The pharmaceutical composition with a pharmaceutically acceptable carrier implies a therapeutic or medicament, however, the claimed invention as set forth in claim 61 does not inform the ordinary skilled worker of the fusion comprising the truncated form of IgA protease since no reference structure is provided for the components singly or in combination; no indicia of a disease to be treated or a treatment regimen. The invention additionally involves modifications such as pegylation, amino-terminal modification etc. with no defined structure or alteration. Thus the claimed invention is not adequately described. The specification fails to provide a representative number of species for the claimed genus to show that applicant was in possession of the claimed genus. A representative number of species means that the species, which are adequately described, are representative of the entire genus. The written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, disclosure of drawings, or by disclosure of relevant identifying characteristics, for example, structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. Vas-Cath Inc. v. Mahurkar, 935 F.2d 1555, 1563-64, 19 USPQ2d 1111, 1117 (Fed. Cir. 1991), states that "applicant must convey with reasonable clarity to those skilled in the art that, as of the filing date sought, he or she was in possession of the invention. The invention is, for purposes of the ‘written description’ inquiry, whatever is now claimed" (See page 1117). The specification does not "clearly allow persons of ordinary skill in the art to recognize that [he or she] invented what is claimed" (See Vas-Cath at page 1116). The skilled artisan cannot envision the detailed chemical structure of the encompassed genus, and therefore, conception is not achieved until reduction to practice has occurred, regardless of the complexity or simplicity of the method of isolation. Adequate written description requires more than a mere statement that it is part of the invention and reference to a potential method of isolating it. The compound itself is required. See Fiers v. Revel, 25 USPQ2d 1601 at 1606 (CAFC 1993). Therefore, for all these reasons the specification lacks adequate written description, and one of skill in the art cannot reasonably conclude that the applicant had possession of the claimed invention at the time the instant application was filed. The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. 12. Claims 1, 5, 7-8, 15, 24, 61 and 69-75 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 1 and the dependent claims hereto are indefinite for the recitation of percentage sequence identity with no reference structure. The sequence identity language is a comparison of one structure to another but no comparison can be made without having a reference sequence and the target sequence to compare. Thus claim language lacks clarity. Claim 15 is indefinite for the recitation of “substitution at one or more sites compared to the amino acid sequence of the polypeptide fragment and no structure is provided as a reference point (see also claim 7 that position 335 without a sequence to find it in). In addition, see claims 71-74 with no structure to demonstrate the claimed embodiments. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. 13. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. 14. Claim(s) 1, 5, 7-8, 15, 24, 61 and 69-75 is/are rejected under 35 U.S.C. 103 as being unpatentable over Tufts Medical Center Inc. (WO 2010/123885, of record in the application) in view of Kosowska et al. (J. Biol. Chem., 2002, of record in the application) and WO2016049932 (April, 2016, see below alignment). The claimed invention recites specific residues or recites truncations at N or C terminus or point mutations, however no specific structure or wild-type structure for comparison is recited in these claims. Thus, the claims are being given the broadest reasonable interpretation and the disclosure in the art of the same protease from the same organism is construed as the structure would be an inherent feature (see claim 1 with percent language and claim 7 with positions with no reference structure). Tufts Medical Center Inc., discloses polypeptide agents useful in the treatment of IgA1 deposition diseases and methods of using such polypeptide agents. Methods of screening for inhibitors of IgA1 proteases and agents that inhibit IgA1 proteases are also disclosed. The primary reference teaches IgA protease from Clostridium ramosum and fragments (see abstract, and paragraphs [0029] and [0081]). A pharmaceutical composition is disclosed in the primary reference (see paragraphs [0157-0159]). The primary reference also discloses a fusion protein (see paragraphs [0200] and [0203] )and pegylation (see paragraph [0069]). In addition, the primary reference teaches truncated forms of IgA protease from Haemophilus influenzae or Bacillus megaterium. The difference between the instant invention and the primary reference is the nature of the IgA protease. The effect of the invention of the present application and the invention of the primary reference is an IgA protease activity. In view of the primary reference, and the breath of the claims the art teaching can be construed as a further IgA protease activity. The present claims are directed to a fragment 31-791 of IgA protease from Clostridium ramosum. Since the primary reference teaches a truncated IgA proteases from Haemophilus influenzae or Bacillus Megaterium, and additionally discloses that the IgA protease can be from Clostridium ramosum, renders the claimed invention as obvious. Moreover the secondary reference discloses the IgA protease from Clostridium ramosum as well as a truncated form of said IgA protease without the signal sequence (amino-acid 1-31) and a Fc-IgA protease fusion protein (see abstract and the entire document). The skilled person has therefore a strong incentive to obtain shorter active fragments of IgA protease from Clositridium ramosun and has the technical means to arrive at the present invention with routine optimization. Further, the recitation of at least 70% is met by the below alignment with 79.8% similarity and query match of 73.9% to SEQ ID NO:1 (see tertiary reference and alignment). Moreover, the recitation of ‘an amino acid sequence of the wildtype…..set forth in SEQ ID NO:1 is also met since “an” can be construed as any structure in SEQ ID NO:1 (see claims 1 and 8). Therefore, it would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to arrive at the claimed invention as a whole because the combined teaching of the references render the claimed invention as obvious. One of ordinary skill in the art would be motivated to combine the references because they are analogous art. Moreover, the Supreme Court pointed out in KSR, “a patent composed of several elements is not proved obvious merely by demonstrating that each of its elements was, independently, known in the prior art.” KSR, 127 S. Ct. at 1741. The Court thus reasoned that the analysis under 35 U.S.C. 103 "need not seek out precise teachings directed to the specific subject matter of the challenged claim, for a court can take account of the “inferences and creative steps that a person of ordinary skill in the art would employ.” Id. at 1741. The Court further advised that “[a] person of ordinary skill is…a person of ordinary creativity, not an automation.” Id. at 1742. Therefore, the claimed invention was obvious to make and use at the time the invention was made and was prima facie obvious. Alignment RESULT 6 BCO72975 ID BCO72975 standard; DNA; 3420 BP. XX AC BCO72975; XX DT 30-JUN-2016 (first entry) XX DE Roseburia intestinalis genomic marker (mlg_id:2245) DNA SEQ: 48371. XX KW biomarker; diagnostic test; ds; genetic marker; metagenomics; obesity; KW prognosis. XX OS Roseburia intestinalis. XX CC PN WO2016049932-A1. XX CC PD 07-APR-2016. XX CC PF 30-SEP-2014; 2014WO-CN088062. XX PR 30-SEP-2014; 2014WO-CN088062. XX CC PA (BGIS-) BGI SHENZHEN CO LTD. CC PA (BGIS-) BGI SHENZHEN. XX CC PI Feng Q, Zhang D, Tang L, Wang J; XX DR WPI; 2016-20734S/39. XX CC PT New biomarker set consisting of gut biomarkers, useful for predicting CC PT obesity or related disease. XX CC PS Claim 1; SEQ ID NO 48371; 53pp; English. XX CC The invention relates to a novel biomarker set useful for predicting a CC disease related to microbiota in a subject. The disease herein is obesity CC or related disorder. The biomarker set contains biomarkers comprising CC nucleotide sequences selected from SEQ ID NOs: 1-48497 (BCO24605- CC BCO73101). The invention also provides a metagenome-wide association CC study (MGWAS) of obesity-associated gut microbes. The invention further CC claims: (a) a kit used for determining the gene marker set, comprising CC PCR amplification primers or probes; (b) use of the gene marker set for CC predicting the risk of obesity or related disorder in a subject; and (c) CC a method for diagnosing whether a subject has an abnormal condition CC related to microbiota or is at the risk of developing an abnormal CC condition related to microbiota. The biomarkers of the invention are more CC specific and sensitive as compared with conventional markers. The present CC sequence represents an obesity associated metagenomic linkage group (MLG) CC marker nucleotide sequence used in predicting obesity in a subject. XX SQ Sequence 3420 BP; 1115 A; 694 C; 717 G; 894 T; 0 U; 0 Other; Alignment Scores: Length: 3420 Score: 4900.50 Matches: 964 Percent Similarity: 82.4% Conservative: 31 Best Local Similarity: 79.8% Mismatches: 110 Query Match: 73.9% Indels: 103 Gaps: 15 US-18-730-790-1 (1-1234) x BCO72975 (1-3420) Qy 6 MetThrLysLysIleThrAlaIlePheLeuAlaLeuTyrMetAlaIleSerValLeuPro 25 |||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| Db 1 ATGACGAAAAAAATAACCGCAATATTCTTGGCATTGTGCATGGCAATCTCCGTTTGGCCG 60 Qy 26 MetThrIleGlnAlaAlaSerLysProAspIleLysValGlyAspTyrValLysMetGly 45 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 ATGACCATTCAGGCGGCATCAAAGCCCGATATTAAAGTTGGCGACTATGTTAAAATGGGC 120 Qy 46 ValTyrAsnAsnAlaSerIleLeuTrpArgCysValSerIleAspAsnAsnGlyProLeu 65 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 GCGTATAACAATGCCTCAATTCTTTGGCGATGTGTAAGCATTGACAATAACGGACCGCTT 180 Qy 66 MetLeuAlaAspLysIleValAspThrLeuAlaTyrAspAlaLysThrAsnAspAsnSer 85 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 ATGCTTGCAGACAAAATTGTTGACACCCTTGCATATGATGCCAAAACAAATGACAACAGC 240 Qy 86 AsnSerLysSerHisSerArgSerTyrLysArgAspAspTyrGlySerAsnTyrTrpLys 105 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 AATTCAAAATCACACAGCAGAAGCTATAAGCGTGATGATTACGGTTCTAACTATTGGAAA 300 Qy 106 AspSerAsnMetArgSerTrpLeuAsnSerThrAlaAlaGluGlyLysValAspTrpLeu 125 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 GACAGCAATATGCGTTCTTGGTTAAATTCGACCGCAGCTGAAGGCAAAGTCGATTGGCTT 360 Qy 126 CysGlyAsnProProLysAspGlyTyrValSerGlyValGlyAlaTyrAsnGluLysAla 145 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 TGCGGCAACCCTCCGAAAGACGGATATGTAAGCGGTGTGGGAGCGTACAACGAAAAAGCG 420 Qy 146 GlyPheLeuAsnAlaPheSerLysSerGluIleAlaAlaMetLysThrValThrGlnArg 165 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 GGTTTTCTCAACGCTTTTTCAAAATCTGAAATTGCGGCAATGAAAACCGTTACCCAGCGT 480 Qy 166 SerLeuValSerHisProGluTyrAsnLysGlyIleValAspGlyAspAlaAsnSerAsp 185 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 TCTCTCGTTTCTCATCCCGAATACAACAAGGGCATAGTTGATGGAGACGCAAATTCGGAT 540 Qy 186 LeuLeuTyrTyrThrAspIleSerGluAlaValAlaAsnTyrAspSerSerTyrPheGlu 205 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 TTGTTATACTACACCGATATTTCGGAAGCGGTGGCAAACTACGACAGTTCATATTTTGAA 600 Qy 206 ThrThrThrGluLysValPheLeuLeuAspValLysGlnAlaAsnAlaValTrpLysAsn 225 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 ACTACAACCGAAAAGGTTTTTCTTCTTGATGTAAAGCAGGCTAATGCCGTGTGGAAAAAT 660 Qy 226 LeuLysGlyTyrTyrValAlaTyrAsnAsnAspGlyMetAlaTrpProTyrTrpLeuArg 245 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 CTCAAAGGTTATTATGTTGCGTATAATAATGACGGTATGGCTTGGCCTTATTGGCTTCGC 720 Qy 246 ThrProValThrAspCysAsnHisAspMetArgTyrIleSerSerSerGlyGlnValGly 265 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 ACTCCTGTTACCGATTGCAATCACGATATGCGTTATATCAGTTCATCGGGTCAGGTCGGT 780 Qy 266 ArgTyrAlaProTrpTyrSerAspLeuGlyValArgProAlaPheTyrLeuAspSerGlu 285 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 CGTTATGCTCCGTGGTATTCCGATTTGGGCGTAAGACCTGCATTTTATCTCGATTCCGAA 840 Qy 286 TyrPheValThrThrSerGlySerGlySerGlnSerSerProTyrIleGlySerAlaPro 305 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 TATTTTGTTACAACTTCCGGCAGCGGCTCACAAAGCAGTCCTTATATCGGCTCTGCTCCA 900 Qy 306 AsnLysGlnGluAspAspTyrThrIleSerGluProAlaGluAspAlaAsnProAspTrp 325 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 AATAAGCAAGAGGATGATTATACAATTTCGGAACCTGCCGAGGACGCAAATCCCGATTGG 960 Qy 326 AsnValSerThrGluGlnSerIleGlnLeuThrLeuGlyProTrpTyrSerAsnAspGly 345 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 AATGTCAGCACCGAGCAAAGCATTCAGCTCACCCTCGGCCCGTGGTATTCAAATGACGGA 1020 Qy 346 LysTyrSerAsnProThrIleProValTyrThrIleGlnLysThrArgSerAspThrGlu 365 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1021 AAATATTCTAATCCTACCATCCCTGTTTATACCATCCAAAAAACACGCAGCGACACGGAA 1080 Qy 366 AsnMetValValValValCysGlyGluGlyTyrThrLysSerGlnGlnGlyLysPheIle 385 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1081 AATATGGTTGTTGTCGTTTGCGGCGAGGGATACACAAAAAGTCAGCAGGGCAAATTCATC 1140 Qy 386 AsnAspValLysArgLeuTrpGlnAspAlaMetLysTyrGluProTyrArgSerTyrAla 405 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1141 AATGATGTCAAACGACTTTGGCAGGACGCTATGAAATATGAACCGTATCGCAGTTATGCC 1200 Qy 406 AspArgPheAsnValTyrAlaLeuCysThrAlaSerGluSerThrPheAspAsnGlyGly 425 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1201 GACAGATTCAATGTTTACGCTCTTTGCACAGCTTCCGAATCGACTTTTGACAATGGTGGA 1260 Qy 426 SerThrPhePheAspValIleValAspLysTyrAsnSerProValIleSerAsnAsnLeu 445 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1261 AGCACCTTCTTTGATGTTATAGTCGACAAATATAATTCGCCTGTTATTTCTAATAATCTC 1320 Qy 446 HisGlySerGlnTrpLysAsnHisIlePheGluArgCysIleGlyProGluPheIleGlu 465 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1321 CACGGAAGTCAGTGGAAAAATCATATTTTTGAGAGATGTATCGGTCCTGAATTTATCGAG 1380 Qy 466 LysIleHisAspAlaHisIleLysLysLysCysAspProAsnThrIleProSerGlySer 485 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1381 AAAATTCACGATGCTCATATCAAAAAAAAGTGTGATCCAAACACAATTCCGTCCGGTTCG 1440 Qy 486 GluTyrGluProTyrTyrTyrValHisAspTyrIleAlaGlnPheAlaMetValValAsn 505 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1441 GAATATGAGCCTTATTATTATGTTCACGATTATATTGCTCAGTTCGCTATGGTTGTAAAC 1500 Qy 506 ThrLysSerAspPheGlyGlyAlaTyrAsnAsnArgGluTyrGlyPheHisTyrPheIle 525 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Db 1501 ACAAAATCAGATTTCTGCGGTGCTTATAATAACCGTGAATACGGCTTCCATTATTTCATT 1560 Qy 526 SerProSerAspSerTyrArgAlaSerLysThrPheAlaHisGluPheGlyHisGlyLeu 545 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1561 TCGCCATCAGACAGTTATCGTGCGTCAAAAACTTTTGCACACGAGTTTGGACACGGTTTG 1620 Qy 546 LeuGlyLeuGlyAspGluTyrSerAsnGlyTyrLeuLeuAspAspLysGluLeuLysSer 565 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1621 CTCGGTCTCGGTGATGAATACAGTAACGGATATTTGCTTGACGATAAGGAACTTAAATCA 1680 Qy 566 LeuAsnLeuSerSerValGluAspProGluLysIleLysTrpArgGlnLeuLeuGlyPhe 585 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1681 CTCAATCTTTCCTCGGTTGAAGACCCGGAAAAGATAAAATGGCGACAGCTTTTAGGTTTT 1740 Qy 586 ArgAsnThrTyrThrCysArgAsnAlaTyrGlySerLysMetLeuValSerSerTyrGlu 605 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1741 AGAAACACATATACCTGCCGCAATGCTTACGGCTCAAAAATGCTTGTTTCAAGTTATGAG 1800 Qy 606 CysIleMetArgAspThrAsnTyrGlnPheCysGluValCysArgLeuGlnGlyPheLys 625 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1801 TGCATAATGAGAGACACAAACTATCAATTCTGTGAGGTTTGCCGTTTGCAGGGCTTCAAG 1860 Qy 626 ArgMetSerGlnLeuValLysAspValAspLeuTyrValAlaThrProGluValLysGlu 645 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1861 CGAATGTCTCAGCTTGTTAAGGATGTAGACCTTTATGTTGCAACTCCCGAGGTTAAGGAA 1920 Qy 646 TyrThrGlyAlaTyrSerLysProSerAspPheThrAspLeuGluThrSerSerTyrTyr 665 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1921 TATACGGGCGCTTATTCAAAGCCGTCTGATTTTACCGACCTTGAAACAAGTTCATATTAT 1980 Qy 666 AsnTyrThrTyrAsnArgAsnAspArgLeuLeuSerGlyAsnSerLysSerArgPheAsn 685 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1981 AATTACACATATAATCGCAATGACCGACTTTTGAGCGGCAACAGCAAAAGCAGATTTAAT 2040 Qy 686 ThrAsnMetAsnGlyLysLysIleGluLeuArgThrValIleGlnAsnIleSerAspLys 705 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2041 ACTAATATGAACGGTAAAAAAATCGAGCTTAGAACTGTTATTCAAAACATTTCAGATAAA 2100 Qy 706 AsnAlaArgGlnLeuLysPheLysMetTrpIleLysHisSerAspGlySerValAlaThr 725 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2101 AATGCACGACAATTAAAATTCAAAATGTGGATTAAGCACTCCGACGGAAGCGTTGCGACC 2160 Qy 726 AspSerSerGlyAsnProLeuGlnThrValGlnThrPheAspIleProValTrpAsnAsp 745 ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Db 2161 GATTCATCGGGGAATCCGCTTCAAACAGTACAAACCTTTGACATTCATGTTTGGAATGAT 2220 Qy 746 LysAlaAsnPheTrpProLeuGlyAlaLeuAspHisIleLysSerAspPheAsnSerGly 765 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2221 AAGGCAAATTTCTGGCCGCTCGGTGCTTTGGATCACATCAAAAGCGACTTTAATTCAGGC 2280 Qy 766 LeuLysSerCysSerLeuIleTyrGlnIleProSerAspAlaGlnLeuLysSerGlyAsp 785 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2281 TTAAAGAGTTGCTCGCTTATTTATCAAATTCCGTCTGATGCACAGCTTAAGAGCGGCGAT 2340 Qy 786 ThrValAlaPheGlnValLeuAspGluAsnGlyAsnValLeuAlaAspAspAsnThrGlu 805 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2341 ACCGTGGCATTTCAGGTGCTCGATGAAAACGGAAATGTGCTTGCAGACGACAATACGGAA 2400 Qy 806 ThrGlnArgTyrThrThrValSerIleGlnTyrLysPheGluAspGlySerGluIlePro 825 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2401 ACACAGCGCTACACAACCGTTTCAATTCAGTATAAATTTGAGGACGGCTCTGAAATTCCA 2460 Qy 826 AsnThrAlaGlyGlyThrPheThrValProTyrGlyThrLysLeuAspLeuThrProAla 845 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2461 AACACTGCCGGCGGAACATTTACCGTGCCATACGGCACAAAGCTTGATTTAACACCGGCA 2520 Qy 846 LysThrLeuTyrAspTyrGluPheIleLysValAspGlyLeuAsnLysProIleValSer 865 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2521 AAAACACTTTATGATTATGAATTTATAAAGGTTGACGGCTTGAATAAGCCTATTGTTTCG 2580 Qy 866 AspGlyThrValValThrTyrTyrTyrLysAsnLysAsnGluGluHisThrHisAsnLeu 885 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2581 GACGGAACGGTTGTTACATATTATTACAAAAATAAAAACGAAGAACACACTCACAATCTG 2640 Qy 886 ThrLeuValAlaAlaLysAlaAlaThrCysThrThrAlaGlyAsnSerAlaTyrTyrThr 905 ||||||||||||||||||||||||||||||||| ||| ||||||||| Db 2641 ACTTTGGTTGCTGCGAAAGCTGCCACCTGCACAGAGGGCGGTAAGGAAGCATACTACAAG 2700 Qy 906 CysAspGlyCysAspLysTrpPheAlaAspAlaThrGlySerValGluIleThrAspLys 925 |||:::|||||| |||:::::: ||| |||::: |||||||||||| Db 2701 TGCGAAGGTTGTGGCAAGTTCTATGAAGATGTACTCGGTACAAAGGAAATAACCGACCTT 2760 Qy 926 ThrSerValLysIleProAlaProGlyHisThrAlaGlyThrGluTrpLysSerAspAsp 945 ||| ||| ::: Db 2761 GCATCT---------------------------------------TGGGGCAAT------ 2775 Qy 946 ThrAsnHisTrpHisGluCysThrValAlaGlyCysGlyValIleIleGluSerThrLys 965 ||| Db 2776 ---------------------------------------------------ATTGCTAAG 2784 Qy 966 SerAlaHisThrAlaGlyGluTrpIleValAspThrProAlaThrAlaThrThrAlaGly 985 ||||||||| ::: ::: ||| |||||| ||| ||| Db 2785 ATTGCCCACACCACAAAGCAAACCGTA------ACAAAGGCAACCCCAACAGCAAACGGC 2838 Qy 986 ThrLysHisLysGluCysThrValCysHisArgValLeuGluThrGlnProIleProSer 1005 |||:::|||||| ::: ||| ||| |||||| Db 2839 AAGATAGTAAATTACTGTTCGGTATGTAAGAAAACTCTTTCAACGACAGTAATTCCAAAG 2898 Qy 1006 Thr------------------GlyThrGluLeu--------------------------- 1010 ||| ||| Db 2899 GCATCAAGCATAAAGCTTAAAGCAACATCATTAACATATAACGGAAAGGTTAGAACACCT 2958 Qy 1011 LysIleIleAlaGlyAspAsnGlnIleTyrAsnLysAlaSerGlySerAspValThrIle 1030 |||:::||| ||| :::||| |||::: Db 2959 AAGGTTATTGTTAAGGACAGAACAGGAAAGACACTTGTTAAGAATACTGACTATACTGTG 3018 Qy 1031 ThrCysAsnGlyAspPheAlaLysPheThrGlyIleLysValAspGlySerValValAsp 1050 ::: :::|||||| ||| ||| ||| Db 3019 TCT------------TATGCAAAA------GGCAGAAAGTATGTTGGCAAGTAC------ 3054 Qy 1051 SerSerAsnTyrThrAlaValSerGlySerThrValLeuThrLeuLysAlaSerTyrLeu 1070 ::: :::||| ||| ||| Db 3055 ---------------------------GCAGTAAAGATTACCTTTAAGGGTAAATACAGC 3087 Qy 1071 GlyThrLeuThrAspGlySerHisThrIleThrPheValTyrThrAspGlyGluAlaAsn 1090 |||||| ||| :::||| Db 3088 GGAACAAAG---------------------ACGCTTTATTTCACAATCAAGCCAAAGGCA 3126 Qy 1091 AlaAsnLeuThrValArgThrAlaGlySerGlyHisIleHisAspTyrGlyThrGluTrp 1110 ::::::::: ||||||||| ::: :::||| Db 3127 ACAAGTATTTCCTCACTTAAAGCAGGTTCA---------AAGAAGTTTACAGTAAAGTGG 3177 Qy 1111 LysSerAsnAla---------AspAsnHisTrpHisGluCysAsnCysGlyAspLysLys 1127 ||| ||| ::: ::: ::: ||| Db 3178 AAGAAGCAGGCTACACAGACAACAGGCTATCAGGTACAGTACAGTGCCTCAAGTAAATTC 3237 Qy 1128 AspGluAlaAlaHisSerPheLysTrpVal---ValAspLysGluAlaThrAlaThrLys 1146 :::||| ||| ||| ||| ||| ||| :::||| Db 3238 AGCAAGGCT------------AAGACCGTAACAGTAGGCAAGAATACAACAGTATCAAAG 3285 Qy 1147 LysGlySerLysHisGluGluCysLysIleCysGlyTyrLysArgSerAlaValGluIle 1166 ||| ||| |||::: ||| |||::: ||| ::: Db 3286 AAAATTTCA---------------AAGCTTTCGGGCAAGAAAAAGTATTATGTAAGAGTT 3330 Qy 1167 ProAla------------------------------------------ThrGlyThrSer 1172 :::||| ||| Db 3331 CGCACCTATAAGACAGTTAAGATTAACGGCAAATCCATAAGGATTTATTCAGGCTGGTCA 3390 Qy 1173 ThrAlaProThrAspThrThrLys 1180 ||| ||| ||||||||| Db 3391 AAAGCTAAGACTGTTACAACAAAG 3414 Conclusion 15. No claims are presently allowable. Any inquiry concerning this communication or earlier communications from the examiner should be directed to HOPE A ROBINSON whose telephone number is (571) 272-0957. The examiner can normally be reached 9-5pm on Monday to Friday. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Robert Mondesi can be reached on (408) 918-7584. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /HOPE A ROBINSON/Primary Examiner, Art Unit 1652
Read full office action

Prosecution Timeline

Jul 22, 2024
Application Filed
Dec 09, 2025
Response after Non-Final Action
Aug 17, 2026
Non-Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12723241
CHIMERIC THERMOSTABLE AMINOACYL-TRNA SYNTHETASE FOR ENHANCED UNNATURAL AMINO ACID INCORPORATION
4y 4m to grant Granted Sep 01, 2026
Patent 12715898
MOLECULAR PEPTIDE MUTANT
3y 2m to grant Granted Aug 25, 2026
Patent 12703859
NOVEL BRANCHED-CHAIN AMINO ACID AMINOTRANSFERASE VARIANT AND METHOD FOR PRODUCING ISOLEUCINE USING THE SAME
3y 2m to grant Granted Aug 11, 2026
Patent 12679862
Hemp Seed Protein Pickering Particles as well as Preparation Method and Application Thereof
2y 10m to grant Granted Jul 14, 2026
Patent 12644108
METHOD OF PRODUCING COLLAGENASE
3y 3m to grant Granted Jun 02, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
68%
Grant Probability
99%
With Interview (+43.1%)
3y 3m (~1y 1m remaining)
Median Time to Grant
Low
PTA Risk
Based on 1055 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month