Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Copending Applications
Applicants must bring to the attention of the Examiner, or other Office official involved with the examination of a particular application, information within their knowledge as to other copending United States applications, which are "material to patentability" of the application in question. MPEP 2001.06(b). See Dayco Products Inc. v. Total Containment Inc., 66 USPQ2d 1801 (CA FC 2003).
Election/Restrictions
Applicant’s election of the species of a polynucleotide sequence encoding SEQ ID NO: 51 in the reply filed on 06/02/2026 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)).
Claims 1-4, 10-12, and 16-17 are pending in this application.
Claims 1-4, 10-12, and 16-17 , drown to SEQ ID NO: 97 encoding SEQ ID NO: 51 are examined in this application.
Claim objections
Claims 1 and 10 are objected to because of the following informalities:
Claims 1 and 10 are missing a conjunction and punctuation mark between parts i), ii), iii), iv), v), vi) , vii) and viii). It is suggested that ---;--- be inserted after the end of each parts i), ii), iii), iv), v), vi); and ---; and ---, after the end of part vii).
Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1-4, 10-12 and 16-17 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
In claims 1 and 10, the phrase 'and/or' renders the claims indefinite and is not in the proper format of a Markush grouping, see MPEP 21 7305(h). A Markush group must be in the alternative and alternative expressions are permitted if they present no uncertainty or ambiguity with respect to the question of scope or clarity of the claims. A "Markush" claim recites a list of alternatively useable species. In re Harnisch, 631 F.2d 716, 719-20,206 USPQ 300,303-04 (CCPA 1980); Ex parte Markush, 1925 Dec. Comm'r Pat. 126, 127 (1924). A Markush claim is commonly formatted as: "selected from the group consisting of A, B, and C;" however, the phrase "Markush claim" means any claim that recites a list of alternatively useable species regardless of format. Further, the multiple recitation of “and/or” in parts (i) that recites “8 and/or 23”; (ii) that recites position“4, 17 and/or 24”; (iii) that recites “1, 3, 18 and/or 28”; (iv) that recites “9, 12, 13, 15, 19 and/or 24”; (vi) that recites “9, 11, 12 and/or 14” ; and (vii) that recites “5, 13, 15 and/or 16” , renders the claims confusing and the metes and bounds of the claims cannot be determined. Note, the claims require “one or more” of the motifs.
Clarification is required to more clearly determine the metes and bounds of the claims. Dependent claims 2-4, 11-12 and 16-17 are included in the rejection.
Claim 12 is indefinite for being incomplete. There is no description of the compound components. Clarification is required to more clearly determine the metes and bounds of the claim.
Improper Markush Grouping Rejection
Claims 2-3 are rejected on the basis that it contains an improper Markush grouping of alternatives. See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). A Markush grouping is proper if the alternatives defined by the Markush group (i.e., alternatives from which a selection is to be made in the context of a combination or process, or alternative chemical compounds as a whole) share a “single structural similarity” and a common use. A Markush grouping meets these requirements in two situations. First, a Markush grouping is proper if the alternatives are all members of the same recognized physical or chemical class or the same art-recognized class and are disclosed in the specification or known in the art to be functionally equivalent and have a common use. Second, where a Markush grouping describes alternative chemical compounds, whether by words or chemical formulas, and the alternatives do not belong to a recognized class as set forth above, the members of the Markush grouping may be considered to share a “single structural similarity” and common use where the alternatives share both a substantial structural feature and a common use that flows from the substantial structural feature. See MPEP § 2117.
The Markush grouping of the polynucleotide sequences of SEQ ID NO: 84-98 or a homologue, variant or derivative thereof, or polynucleotide sequences encoding SEQ ID NOS: 1-83 is improper because the alternatives defined by the Markush grouping do not share both a single structural similarity and a common use for the following reasons: 1) the sequences do not share any common structural element that is essential to the asserted function of conferring herbicide tolerance. 2) The different sequences are from different plant species and are identified by specific sequence structure (SEQ ID NO:). Therefore, when considering the different polynucleotide/polypeptide sequences that are recited in the alternative in the claims, there does not appear to be any significant common structure related to the function of the sequences as recited in the claims. 3) Motifs 1a-8a recited in the claims does not appear to be defined consensus sequence shared by all polynucleotide sequences because each of the motifs contains multiple variables and in addition requires multiple amino acid substitution at multiple positions within the motif. Therefore, the polynucleotide/polypeptide sequences recited in the claims, plants/parts comprising the sequences and methods which uses it, do not share a single structural similarity and a common use that flows from the structure.
To overcome this rejection, Applicant may set forth each alternative (or grouping of patentably indistinct alternatives) within an improper Markush grouping in a series of independent or dependent claims and/or present convincing arguments that the group members recited in the alternative within a single claim in fact share a single structural similarity as well as a common use.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-4, 10-12, and 16-17 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The claims are broadly drawn to a plant or plant part comprising a polynucleotide encoding a mutated cellulose synthase (CESA) polypeptide, a variant thereof, the expression of said polynucleotide confers to the plant or plant part tolerance to CESA-inhibiting herbicides, wherein the variant comprises on or more of motifs with multiple of amino acid substitutions; said plant wherein the polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 97, or a homologue, variant or derivative thereof; wherein the mutated CESA polypeptide is a functional variant having at least 60% identity to SEQ ID NO: 51, an orthologue, paralogue or homologue thereof, wherein the amino acid sequence differs from the wild type sequence at a position corresponding to 1066 of SEQ ID NO: 51. The claims are also drawn to a method of controlling weed at a plant growth locus comprising applying a composition comprising CESA-inhibiting herbicides to the locus, and planting a seed at the locus, wherein the seed is capable of producing a plant that comprises in at least some of its cells a polynucleotide operably linked to a promoter operable in plant cells and capable of expressing a mutated CESA polypeptide encoded by the polynucleotide, the expression confers tolerance to CESA-inhibiting herbicides, wherein the mutated CESA polypeptide comprises one or more of the motifs listed in the claims; said method wherein the herbicide composition is applied to the weeds and to the plant produced by the seed, and wherein the CESA-inhibiting herbicide comprises a compound having the formula as shown in claim 12. The claims are further drawn to a method of producing a plant product by processing the plant or plant part of claim 1; said plant product is a fodder, seed meal, oil or seed-treatment-coated seeds.
The claimed plant and methods require an extremely large genus comprising unknown species corresponding to mutated CESA polypeptides including a genus of mutants of SEQ ID NO: 51 with unknown function/activity. The scope of the claims also encompasses a homologue, variant or derivative of SEQ ID NO: 97 as well as functional variants having at least 60% identity to SEQ ID NO: 51, an orthologue, paralogue or homologue of SEQ ID NO: 51 for controlling the weed.
In contrast, the instant specification describes selection of Arabidopsis thaliana lines for improved resistance to azine herbicides from EMS mutagenized seed populations of Arabidopsis thaliana plants. Table 1 of the specification shows amino acid sequences (SEQ ID NO: 1-83) encoded by the polynucleotide sequences of SEQ ID NO: 84-98 from several plant species. Tables 2A-2C provide positions that can be chosen to be substituted in said amino acid sequences by any other amino acid using SEQ ID NO: 1 or 3 as references. Table E10-1 shows variants/mutations in SEQ ID NO: 51 (A1066T, S827N, V923I, T952I), wherein the mutation at position 1066 is identified as wild type with 10% crop injury at 20-36 days after foliar application of the herbicide to the M3-M4 generation. While the specification refers to the amino acid sequences of SEQ ID NO: 1-83 as orthologues and homologues, the specification fails to describe the homologues and orthologues by sequence identity to the reference sequence of SEQ ID NO: 1 or 3. The specification broadly defines “variant” and “functional variants” as to include a polypeptide or nucleic acid sequence having at least 30% or 40% to any of the sequences of SEQ ID NO: 1-98 (see pages 20 and 22); and “derivatives” and “homologues” to encompass as “peptides, oligopeptides, polypeptides, proteins and enzymes having amino acid substitutions, deletions and/or insertions relative to SEQ ID NO: 1 or 3 and having similar biological and functional activity as the unmodified protein from which they are derived” (pages 22-23). The specification also describes evaluation of herbicide tolerance of transgenic soybean, corn, rice, sunflower and Brassica napus plants expressing cellulose synthase sequences or mutated sequences thereof (Example 11).
The specification, however, does not describe a representative number of species of the genus of polynucleotide sequences encoding a genus of mutated CESA polypeptides including a genus of mutants of SEQ ID NO: 51 with unknown function/activity; a representative number of species of homologues, variants or derivative of SEQ ID NO: 97 as well as functional variants having at least 60% identity to SEQ ID NO: 51, an orthologue, paralogue or homologue of SEQ ID NO: 51. The motifs 1a, 2a, 3a,4a, 5a, 6a, 7a and 8a (1a to 8a) as listed in claims 1 and 10 does not define a definite “consensus sequence” shared by the all CESA polypeptides because of the multiple amino acid substitutions in the motifs combined with the indefinite term “and/or”. Claims 1 and 10 require “the mutated CESA polypeptide comprises one or more of the motifs of SEQ ID NO: 99 with the amino acid at position 23 within the motif of the corresponding wildtype sequence is substituted by any other amino acid; SEQ ID NO: 102 with the amino acid at position 4, 17, and/or 24 within the motif of the corresponding wildtype sequence is substituted by any other amino acid; SEQ ID NO: 105 with the amino acid at position 1, 3, 18 and/or 28 within the motif of the corresponding wildtype sequence is substituted by any other amino acid; SEQ ID NO: 108 with the amino acid at position 9, 12, 13, 15, 19, and/or 24 within the motif of the corresponding wildtype sequence is substituted by any other amino acid; SEQ ID NO: 114 with the amino acid at position 9, 11, 12, and/or 14 within the motif of the corresponding wildtype sequence is substituted by any other amino acid; SEQ ID NO: 117 with the amino acid at position 5, 13, 15 and/or 16 within the motif of the corresponding wildtype sequence is substituted by any other amino acid; and SEQ ID NO: 120 with the amino acid at position 10 within the motif of the corresponding wildtype sequence is substituted by any other amino acid; and wherein the CESA-inhibiting herbicide comprises a compound having the formula as shown in claim 3”.
Further, the search results of the motifs of SEQ ID NO: 99, 102, 105, 108, 114, 117 and 120 did not retrieve SEQ ID NO: 51 or any of the other CESA sequences described in the specification. Neither the specification nor the prior art shows specific function/activity by any of the motifs 1a (SEQ ID NO: 99), 2a (SEQ ID NO: 102), 3a (SEQ ID NO: 105), 4a (SEQ ID NO: 108) , 5a (SEQ ID NO: 111), 6a (SEQ ID NO: 114), 7a (SEQ ID NO: 117), and 8a (SEQ ID NO: 120). In addition, each of the motifs contains multiple variables and in addition requires multiple amino acid substitution at multiple positions within the motif.
The purpose of the written description is to ensure that the inventor had possession at the time the invention was made, of the specific subject claimed. For a broad generic claim, the specification must provide adequate written description to identify the genus of the claim.
“The test for sufficiency is whether the disclosure of the application relied upon reasonably conveys to skilled in the art that the inventor had possession of the claimed subject matter as of the filing date.” Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1351 (Fed. Cir. 2010). To satisfy the written description requirement, a patent specification must describe the claimed invention in sufficient detail that one skilled in the art can reasonably conclude that the inventor had possession of the claimed invention. Lockwood v. Amer. Airlines, Inc., 107 F.3d 1565, 1572, 41 USPQ2d 1961, 1966 (Fed. Cir. 1997). “An applicant shows possession of the claimed invention by describing the claimed invention with all of its limitations. Lockwood, 107 F.3d at 1572, 41 USPQ2d at 1966”. While the written description requirement does not demand either examples or an actual reduction, actual “possession” or reduction to practice outside of the specification is not enough. Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1352 (Fed. Cir. 2010). Rather, it is the specification itself that must demonstrate possession. Id.
The Federal Circuit has recently clarified the application of the written description requirement to inventions in the field of biotechnology. See University of California v. Eli Lilly and Co., 119 F.3d 1559, 1568, 43 USPQ2d 1398; 1406 (Fed. Cir. 1997). In summary, the court stated that a written description of an invention requires a precise definition, one that defines the structural features of the chemical genus that distinguishes it from other chemical structures.
Therefore, since specification fails to provide sufficient written description for the genus comprising unknown species corresponding to mutants of any CESA including SEQ ID NO: 51 and 97 with unknown function/activity, plants or plant parts comprising it, and methods that employ said mutants are similarly not described.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1-3 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by La Rosa TJ (US 2006236419-A1).
The claims are drawn to a plant or plant part comprising a polynucleotide encoding a mutated cellulose synthase (CESA) polypeptide, a variant thereof, the expression of said polynucleotide confers to the plant or plant part tolerance to CESA-inhibiting herbicides, wherein the variant comprises on or more of motifs with multiple of amino acid substitutions; said plant wherein the polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 97, or a homologue, variant or derivative thereof; wherein the mutated CESA polypeptide is a functional variant having at least 60% identity to SEQ ID NO: 51, an orthologue, paralogue or homologue thereof.
La Rosa et al teach transgenic plants a polynucleotide sequence encoding a polypeptide having modified agronomic properties including herbicide tolerance, and a method of producing said transgenic plants by transforming the plants with said polynucleotide sequence under the control of a plant promoter. The claimed plant is indistinguishable from the prior art plant because the prior art polynucleotide encodes a polypeptide that is 99.9% identical to SEQ ID NO: 51 of the instant claims. See alignment of sequences shown below. Therefore, La Rosa et al anticipate the claimed invention, absence evidence to the contrary.
RESULT 6
AEL35750
DT 18-OCT-2007 (first entry)
Oryza sativa hardiness-related protein coding sequence - SEQ ID 3482.
transgenic plant; crop improvement; cold tolerance; drought resistance; heat tolerance; herbicide resistance; crop plant pathogen; seed oil; transgenic plant; gene; ds.
US2006236419-A1.
La Rosa TJ, Kovalic DK, Zhou Y, Cao Y;
New recombinant DNA construct, useful for producing transgenic plants having improved properties, e.g. improved cold tolerance, increased
resistance to plant disease, or improved plant growth and development
under stress condition.
Claim 1; SEQ ID NO 3482; 16pp; English.
The DNA and protein sequences of the invention are useful for producing
CC transgenic plants having improved properties, such as improved cold
CC tolerance, drought tolerance, heat tolerance, or tolerance to herbicide.
NOTE: The sequences of the invention are not shown in
CC the specification, but are obtained from the USPTO website -
CC seqdata.uspto.gov/?pageRequest=docDetail&DocID=US200606236419A1.
XX
SQ Sequence 3788 BP; 966 A; 830 C; 953 G; 1039 T; 0 U; 0 Other;
Length: 3788
Score: 5757.00 Matches: 1075
Percent Similarity: 100.0% Conservative: 1
Best Local Similarity: 99.9% Mismatches: 0
Query Match: 99.9% Indels: 0
Gaps: 0
US-18-752-373A-51 (1-1076) x AEL35750 (1-3788)
Qy 1 MetAlaAlaAsnAlaGlyMetValAlaGlySerArgAsnArgAsnGluPheValMetIle 20
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 90 ATGGCGGCGAACGCGGGGATGGTGGCGGGATCCCGCAACCGGAACGAGTTCGTCATGATC 149
Qy 21 ArgProAspGlyAspAlaProProProAlaLysProGlyLysSerValAsnGlyGlnVal 40
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 150 CGCCCCGACGGCGACGCGCCACCGCCGGCTAAGCCAGGGAAGAGTGTGAATGGTCAGGTC 209
Qy 41 CysGlnIleCysGlyAspThrValGlyValSerAlaThrGlyAspValPheValAlaCys 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 210 TGCCAGATTTGTGGCGACACTGTTGGCGTCTCGGCCACCGGCGACGTCTTTGTTGCCTGC 269
Qy 61 AsnGluCysAlaPheProValCysArgProCysTyrGluTyrGluArgLysGluGlyAsn 80
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 270 AATGAGTGCGCCTTCCCGGTCTGCCGCCCTTGCTACGAGTACGAGCGCAAGGAAGGGAAC 329
Qy 81 GlnCysCysProGlnCysLysThrArgTyrLysArgHisLysGlySerProArgValGln 100
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 330 CAGTGCTGCCCCCAGTGCAAGACTAGATACAAGAGGCACAAAGGTAGCCCTAGAGTTCAG 389
Qy 101 GlyAspGluGluGluGluAspValAspAspLeuAspAsnGluPheAsnTyrLysHisGly 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 390 GGCGATGAGGAGGAGGAAGATGTTGATGACCTGGACAATGAATTCAATTATAAGCATGGC 449
Qy 121 AsnGlyLysGlyProGluTrpGlnIleGlnArgGlnGlyGluAspValAspLeuSerSer 140
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 450 AATGGCAAAGGTCCAGAGTGGCAGATACAGAGACAGGGGGAAGATGTTGACCTGTCTTCA 509
Qy 141 SerSerArgHisGluGlnHisArgIleProArgLeuThrSerGlyGlnGlnIleSerGly 160
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 510 TCTTCTCGCCACGAACAACATCGGATTCCCCGTCTGACAAGTGGGCAACAGATCTCAGGA 569
Qy 161 GluIleProAspAlaSerProAspArgHisSerIleArgSerGlyThrSerSerTyrVal 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 570 GAGATCCCTGATGCTTCCCCCGATCGCCATTCTATCCGCAGCGGAACATCAAGCTATGTT 629
Qy 181 AspProSerValProValProValArgIleValAspProSerLysAspLeuAsnSerTyr 200
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 630 GATCCAAGTGTTCCAGTTCCTGTGAGGATTGTGGACCCCTCCAAGGACTTGAATTCCTAT 689
Qy 201 GlyIleAsnSerValAspTrpGlnGluArgValAlaSerTrpArgAsnLysGlnAspLys 220
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 690 GGGATTAACAGTGTTGACTGGCAAGAAAGAGTTGCCAGCTGGAGGAACAAGCAGGACAAA 749
Qy 221 AsnMetMetGlnValAlaAsnLysTyrProGluAlaArgGlyGlyAspMetGluGlyThr 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 750 AATATGATGCAGGTAGCTAATAAATATCCAGAGGCAAGAGGGGGAGACATGGAAGGGACT 809
Qy 241 GlySerAsnGlyGluAspMetGlnMetValAspAspAlaArgLeuProLeuSerArgIle 260
||||||||||||||||||:::|||||||||||||||||||||||||||||||||||||||
Db 810 GGTTCAAATGGTGAAGATATCCAAATGGTTGATGATGCACGTCTACCTCTGAGCCGCATA 869
Qy 261 ValProIleProSerAsnGlnLeuAsnLeuTyrArgIleValIleIleLeuArgLeuIle 280
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 870 GTGCCTATCCCTTCAAACCAGCTCAACCTTTACCGGATTGTTATCATTCTCCGTCTTATC 929
Qy 281 IleLeuMetPhePhePheGlnTyrArgValThrHisProValArgAspAlaTyrGlyLeu 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 930 ATCCTGATGTTCTTCTTCCAATATCGTGTCACTCATCCAGTGCGGGATGCTTATGGATTG 989
Qy 301 TrpLeuValSerValIleCysGluIleTrpPheAlaLeuSerTrpLeuLeuAspGlnPhe 320
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 990 TGGCTAGTATCTGTTATCTGTGAAATTTGGTTTGCCTTATCCTGGCTCCTAGATCAATTC 1049
Qy 321 ProLysTrpTyrProIleAsnArgGluThrTyrLeuAspArgLeuAlaLeuArgTyrAsp 340
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1050 CCAAAGTGGTACCCGATAAACCGTGAAACATACCTTGACAGGCTTGCATTGAGATATGAT 1109
Qy 341 ArgGluGlyGluProSerGlnLeuAlaProIleAspValPheValSerThrValAspPro 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1110 AGGGAGGGAGAGCCATCACAGCTTGCTCCCATTGATGTCTTTGTCAGTACGGTGGATCCA 1169
Qy 361 LeuLysGluProProLeuIleThrAlaAsnThrValLeuSerIleLeuAlaValAspTyr 380
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1170 CTAAAGGAACCTCCTCTGATCACAGCAAACACTGTTTTGTCCATTCTGGCTGTGGATTAC 1229
Qy 381 ProValAspLysValSerCysTyrValSerAspAspGlySerAlaMetLeuThrPheGlu 400
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1230 CCTGTTGACAAAGTGTCATGCTATGTTTCTGACGATGGTTCAGCTATGTTAACTTTTGAG 1289
Qy 401 AlaLeuSerGluThrAlaGluPheAlaArgLysTrpValProPheCysLysLysHisAsn 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1290 GCTCTGTCAGAAACTGCAGAATTTGCTAGGAAGTGGGTTCCGTTTTGCAAGAAGCACAAT 1349
Qy 421 IleGluProArgAlaProGluPheTyrPheAlaGlnLysIleAspTyrLeuLysAspLys 440
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1350 ATTGAACCACGAGCTCCAGAGTTTTACTTTGCTCAAAAAATAGATTACCTGAAGGACAAA 1409
Qy 441 IleGlnProSerPheValLysGluArgArgAlaMetLysArgGluTyrGluGluPheLys 460
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1410 ATCCAACCTTCCTTTGTTAAAGAAAGGCGGGCAATGAAGAGAGAGTATGAAGAATTCAAG 1469
Qy 461 ValArgIleAsnAlaLeuValAlaLysAlaGlnLysValProGluGluGlyTrpThrMet 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1470 GTACGGATCAATGCTCTTGTTGCGAAGGCACAAAAAGTACCTGAAGAGGGGTGGACCATG 1529
Qy 481 AlaAspGlyThrAlaTrpProGlyAsnAsnProArgAspHisProGlyMetIleGlnVal 500
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1530 GCTGATGGCACTGCTTGGCCTGGGAATAACCCAAGGGATCACCCTGGCATGATTCAGGTG 1589
Qy 501 PheLeuGlyHisSerGlyGlyLeuAspThrAspGlyAsnGluLeuProArgLeuValTyr 520
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1590 TTCTTGGGGCACAGTGGTGGGCTTGACACTGATGGTAACGAGTTGCCACGGCTTGTCTAC 1649
Qy 521 ValSerArgGluLysArgProGlyPheGlnHisHisLysLysAlaGlyAlaMetAsnAla 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1650 GTCTCTCGTGAAAAGAGGCCAGGATTCCAGCATCACAAGAAGGCTGGTGCAATGAATGCA 1709
Qy 541 LeuIleArgValSerAlaValLeuThrAsnGlyAlaTyrLeuLeuAsnValAspCysAsp 560
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1710 TTGATTCGTGTATCTGCTGTGCTGACAAATGGTGCCTATCTTCTCAATGTGGATTGTGAT 1769
Qy 561 HisTyrPheAsnSerSerLysAlaLeuArgGluAlaMetCysPheMetMetAspProAla 580
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1770 CACTACTTCAACAGTAGCAAAGCTCTTAGAGAAGCAATGTGCTTCATGATGGATCCCGCA 1829
Qy 581 LeuGlyArgLysThrCysTyrValGlnPheProGlnArgPheAspGlyIleAspLeuHis 600
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1830 CTAGGAAGGAAAACTTGTTATGTTCAGTTCCCACAAAGATTTGATGGCATTGACTTGCAC 1889
Qy 601 AspArgTyrAlaAsnArgAsnIleValPhePheAspIleAsnMetLysGlyLeuAspGly 620
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1890 GATCGATACGCTAATCGCAACATAGTCTTCTTTGATATTAACATGAAAGGTTTAGATGGC 1949
Qy 621 IleGlnGlyProValTyrValGlyThrGlyCysCysPheAsnArgGlnAlaLeuTyrGly 640
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1950 ATTCAGGGTCCAGTTTATGTGGGAACAGGTTGCTGCTTCAATAGGCAGGCCTTGTATGGC 2009
Qy 641 TyrAspProValLeuThrGluAlaAspLeuGluProAsnIleValValLysSerCysCys 660
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2010 TATGATCCTGTACTAACTGAGGCTGATTTGGAACCTAACATTGTTGTTAAGAGCTGCTGT 2069
Qy 661 GlyGlyArgLysLysLysSerLysSerTyrMetAspSerLysAsnArgMetMetLysArg 680
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2070 GGTGGCAGAAAGAAAAAGAGCAAGAGCTACATGGATAGCAAAAACCGTATGATGAAGAGA 2129
Qy 681 ThrGluSerSerAlaProIlePheAsnMetGluAspIleGluGluGlyIleGluGlyTyr 700
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2130 ACAGAGTCTTCAGCTCCTATCTTTAACATGGAAGATATAGAAGAGGGCATTGAAGGTTAT 2189
Qy 701 GluAspGluArgSerValLeuMetSerGlnLysArgLeuGluLysArgPheGlyGlnSer 720
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2190 GAAGATGAAAGGTCAGTGCTGATGTCCCAGAAGAGATTAGAGAAACGTTTTGGTCAATCG 2249
Qy 721 ProIlePheIleAlaSerThrPheMetThrGlnGlyGlyIleProProSerThrAsnPro 740
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2250 CCAATTTTTATTGCGTCCACCTTCATGACTCAAGGAGGCATACCACCCTCAACGAACCCA 2309
Qy 741 AlaSerLeuLeuLysGluAlaIleHisValIleSerCysGlyTyrGluAspLysThrGlu 760
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2310 GCATCTCTACTGAAGGAAGCCATCCATGTTATCAGTTGTGGATATGAGGACAAAACTGAA 2369
Qy 761 TrpGlyLysGluIleGlyTrpIleTyrGlySerValThrGluAspIleLeuThrGlyPhe 780
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2370 TGGGGAAAAGAGATTGGCTGGATCTATGGTTCAGTTACTGAGGATATTCTGACTGGATTT 2429
Qy 781 LysMetHisAlaArgGlyTrpIleSerIleTyrCysMetProProArgProCysPheLys 800
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2430 AAAATGCACGCAAGAGGTTGGATATCAATCTATTGCATGCCACCACGGCCATGCTTCAAG 2489
Qy 801 GlySerAlaProIleAsnLeuSerAspArgLeuAsnGlnValLeuArgTrpAlaLeuGly 820
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2490 GGTTCTGCGCCAATCAATCTGTCTGATCGTCTTAACCAAGTGCTACGTTGGGCTCTTGGG 2549
Qy 821 SerValGluIleLeuLeuSerArgHisCysProIleTrpTyrGlyTyrAsnGlyArgLeu 840
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2550 TCTGTTGAGATTCTGCTTAGCAGACATTGTCCTATCTGGTATGGTTACAATGGGCGTTTG 2609
Qy 841 LysLeuLeuGluArgLeuAlaTyrIleAsnThrIleValTyrProIleThrSerIlePro 860
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2610 AAACTTCTGGAGAGGCTGGCTTACATTAACACCATTGTTTATCCAATTACATCCATTCCA 2669
Qy 861 LeuIleAlaTyrCysValLeuProAlaIleCysLeuLeuThrAsnLysPheIleIlePro 880
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2670 CTTATCGCCTATTGTGTGCTTCCTGCTATCTGTCTCCTCACCAACAAATTTATCATTCCT 2729
Qy 881 GluIleSerAsnTyrAlaGlyMetPhePheIleLeuLeuPheAlaSerIlePheAlaThr 900
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2730 GAGATTAGCAATTATGCTGGGATGTTCTTTATTCTGCTTTTCGCCTCCATTTTCGCAACT 2789
Qy 901 GlyIleLeuGluLeuArgTrpSerGlyValGlyIleGluAspTrpTrpArgAsnGluGln 920
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2790 GGTATTCTGGAGCTCCGATGGAGTGGTGTTGGTATCGAGGACTGGTGGAGAAATGAACAG 2849
Qy 921 PheTrpValIleGlyGlyThrSerAlaHisLeuPheAlaValPheGlnGlyLeuLeuLys 940
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2850 TTCTGGGTCATTGGTGGCACATCTGCCCATCTCTTCGCTGTGTTCCAGGGTCTTCTGAAA 2909
Qy 941 ValLeuAlaGlyIleAspThrAsnPheThrValThrSerLysAlaSerAspGluAspGly 960
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2910 GTGTTAGCAGGAATTGATACCAACTTCACTGTTACCTCAAAGGCGTCCGATGAGGATGGT 2969
Qy 961 AspPheAlaGluLeuTyrValPheLysTrpThrSerLeuLeuIleProProThrThrVal 980
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2970 GACTTTGCTGAGCTATACGTGTTCAAGTGGACCAGTCTCCTCATTCCCCCGACCACCGTG 3029
Qy 981 LeuValIleAsnLeuValGlyMetValAlaGlyIleSerTyrAlaIleAsnSerGlyTyr 1000
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 3030 CTTGTCATCAACCTGGTGGGCATGGTGGCGGGTATATCATATGCCATTAACAGCGGTTAC 3089
Qy 1001 GlnSerTrpGlyProLeuPheGlyLysLeuPhePheSerIleTrpValIleLeuHisLeu 1020
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 3090 CAATCATGGGGTCCTCTCTTTGGAAAGCTCTTCTTCTCCATCTGGGTGATCCTCCATCTC 3149
Qy 1021 TyrProPheLeuLysGlyLeuMetGlyArgGlnAsnArgThrProThrIleValIleVal 1040
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 3150 TACCCCTTCCTCAAGGGTCTCATGGGCAGGCAGAACCGCACTCCGACCATCGTCATCGTC 3209
Qy 1041 TrpSerIleLeuLeuAlaSerIlePheSerLeuLeuTrpValLysIleAspProPheIle 1060
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 3210 TGGTCGATCCTCCTCGCGTCGATCTTCTCCCTTCTGTGGGTCAAGATCGATCCTTTCATT 3269
Qy 1061 SerProThrGlnLysAlaValAlaLeuGlyGlnCysGlyValAsnCys 1076
||||||||||||||||||||||||||||||||||||||||||||||||
Db 3270 TCGCCTACTCAGAAAGCCGTCGCCTTGGGGCAATGCGGTGTGAACTGC 3317
Claims 1-4, 10-12 and 16-17 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Desprez et al (Plant Physiology (2002), 128(2):482-490; Applicant’s IDS) in light of Scheible (PNAS (2001), 98(18): 10079-10084; Applicant’s IDS).
The claims are drawn to a plant or plant part comprising a polynucleotide encoding a mutated cellulose synthase (CESA) polypeptide, a variant thereof, the expression of said polynucleotide confers to the plant or plant part tolerance to CESA-inhibiting herbicides, wherein the variant comprises on or more of motifs with multiple of amino acid substitutions; said plant wherein the polynucleotide comprises the nucleic acid sequence of SEQ ID NO: 97, or a homologue, variant or derivative thereof; wherein the mutated CESA polypeptide is a functional variant having at least 60% identity to SEQ ID NO: 51, an orthologue, paralogue or homologue thereof, a method of controlling weed using said mutant CESA polypeptide/polynucleotide, wherein the herbicide composition is applied to the plant, and wherein the herbicide comprises a compound having the formula (I).
Desprez et al teach a transgenic plant or plant part comprising a polynucleotide encoding a mutated Cesa polypeptide under the control of a plant promoter, wherein the expression of the mutated CesA polypeptide in the plant results in enhanced resistance of the plant against isoxaben herbicide, which inhibits cellulose biosynthesis in plants (see the whole document). Scheible et al is cited (see 2nd column on page 483) in Desprez et al. Scheible et al teach that modifications of cellulose synthase confer tolerance to isoxaben and thiazolidinone herbicide in Arabidopsis thaliana cellulose synthase mutants. Schelble et al show two mutant alleles that contain point mutations at positions 998 and 942 near the carboxyl terminus of At-Cesa1 and that confer tolerance to herbicides; said mutated CESA polypeptide comprises at least one of the motifs of claims 1 and 10. Scheible et al also teach a compound comprising formula (I) of the claims (see the whole document). Given the 112(b) rejection to the claims regarding the metes and bounds of the mutant CESA polypeptide of the claims, the claimed invention is indistinguishable from the prior art plant and method, absent evidence to the contrary.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1, 10-12 and 16-17 rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-13 of U.S. Patent No. 12,018, 267. Although the claims at issue are not identical, they are not patentably distinct from each other because the claims of both the application and the issued patent require plant comprising a polynucleotide encoding mutated CESA comprising one or more of the motifs 1a (SEQ ID NO: 99), 2a (SEQ ID NO: 102), 3a (SEQ ID NO: 105), 4a (SEQ ID NO: 108) , 5a (SEQ ID NO: 111), 6a (SEQ ID NO: 114), 7a (SEQ ID NO: 117), and 8a (SEQ ID NO: 120), with multiple of variables; and a method of controlling weeds by applying an herbicide composition comprising CESA-inhibiting herbicides to the growth locus of a plant, and planting seed at the locus, wherein the plant grown from seed comprises a polynucleotide encoding mutated CESA polypeptide comprising one or more of the motifs 1a (SEQ ID NO: 99), 2a (SEQ ID NO: 102), 3a (SEQ ID NO: 105), 4a (SEQ ID NO: 108) , 5a (SEQ ID NO: 111), 6a (SEQ ID NO: 114), 7a (SEQ ID NO: 117), and 8a (SEQ ID NO: 120), with multiple of variables.
The claims of the instant application is broader in scope than the issued patent claims because claims 1 and 10 require a plant comprising a polynucleotide encoding any mutated CESA polypeptide comprising one or more of the motifs 1a (SEQ ID NO: 99), 2a (SEQ ID NO: 102), 3a (SEQ ID NO: 105), 4a (SEQ ID NO: 108) , 5a (SEQ ID NO: 111), 6a (SEQ ID NO: 114), 7a (SEQ ID NO: 117), and 8a (SEQ ID NO: 120), with multiple of variables that are identical to the issued patent claims. Further, the plant of claim 1 of the instant application is obvious over the method that employs with said plant for weed control of the issued patent claims. Therefore, the invention claimed in the instant application defines a genus encompasses the claims of the issued claims.
Conclusion
No claim is allowed
Contact Information
Any inquiry concerning this communication or earlier communications from the examiner should be directed to MEDINA AHMED IBRAHIM whose telephone number is (571)272-0797. The examiner can normally be reached Monday-Friday, 9:00 - 6:00.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, BRATISLAV STANKOVIC can be reached at 571-270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
MEDINA AHMED. IBRAHIM
Primary Examiner
Art Unit 1662
/MEDINA A IBRAHIM/Primary Examiner, Art Unit 1662
Prosecution Insights