DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election without traverse of Group II claims 14-23, and the species of claim 18 in the reply filed on October 30, 2025 is acknowledged. Additionally, claims 16-17 and 19-20 are withdrawn because the elected species does not read on claims 16,17,19,20. The restriction is made FINAL.
Claim Status
Claims 1-23, are pending. Claims 1-13, 16-17 and 19-20, are withdrawn. Claims 14-15, 18 and 21-23, are examined in the instant application.
Priority
This application is claiming the benefit of Provisional Application No. 63/523,582 filed June 27, 2023.
Information Disclosure Statement (IDS)
There is no IDS submitted at this time.
Claim objections
In claims 22-23, the recitation of “Spirodella polyrhiza, Arabadopsis thaliana” needs to be italicized for grammatical correctness.
Specification
The disclosure is objected to because of the following:
Applicant is reminded of the proper language and format for an abstract of the disclosure.
The abstract should be in narrative form and generally limited to a single paragraph on a separate sheet within the range of 50 to 150 words in length. Currently the Abstract contains a total of 179 words. It is advised that Applicant amend the abstract with less than 150 words.
The abstract should describe the disclosure sufficiently to assist readers in deciding whether there is a need for consulting the full patent text for details.
The language should be clear and concise and should not repeat information given in the title. It should avoid using phrases which can be implied, such as, “The disclosure concerns,” “The disclosure defined by this invention,” “The disclosure describes,” etc. In addition, the form and legal phraseology often used in patent claims, such as “means” and “said,” should be avoided.
Appropriate correction is required.
Claim Rejections - 35 USC § 112(a)(Written Description)
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 14-15, 18 and 21-23, are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The written description requirement may be satisfied through sufficient description of a representative number of species by disclosing relevant and identifying characteristics such as structural or other physical and/or chemical properties, by disclosing functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the invention as claimed. See Eli Lilly,119 F.3d at 1568, 43 USPQ2d at 1406.
Applicant’s disclosure is as follows.
Applicant describes SpWRI3 (SEQ ID NO: 1) from Spirodella polyrhiza (giant duckweed) plant (see page 11) as SpWRI3 (Sp11g00856) which is a member of the Apetala2/ Ethylene Responsive Element Binding (AP2 / EREB) transcription factor family. Additionally, the specification discloses a sequence alignment comparing Spirodella polyrhiza and Arabidopsis WRI3 (see figure S5).
Furthermore, the specification describes overexpressing SpWRI3 (SEQ ID NO: 1) in Arabidopsis (see figure 11) resulting in conferred tolerance to heavy metal stress to flue gas desulfurization (FGD) wastewater, reduced levels of malondialdehyde (MDA) accumulation and increased GSH levels (see figure 11e-f). Lastly, FGD wastewater induced triacylglycerol (TAG) production (see figure 3).
Claims encompass any SpWRI3 or a SpWRI3 polypeptide having as little as 95% sequence identity to SEQ ID NO: 1 – the specification only describes a SpWRI3 polypeptide having SEQ ID NO: 1 from Spirodella polyrhiza (giant duckweed).
The claimed invention lacks adequate written description for the following reasons. Claims 14-15, 18 and 21-23, are directed to a method of growing a plant or seed transformed with SpWRI3 resulting in a plant that is tolerant to heavy metal stress, salt stress, drought or a combinations thereof, wherein the SpWRI3 is obtained from any source having any amino acid structure.
Additionally, the claims encompass an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 1. Furthermore, the scope of the claims encompasses SpWRI3 amino acids obtained from sources other than Spirodella polyrhiza, or a polypeptide for SpWRI3 so long as they share at least 95% sequence identity to SEQ ID NO: 1.
The only SpWRI3 amino acid disclosed is from Spirodella polyrhiza having SEQ ID NO: 1 having the function of conferring tolerance to FGD wastewater. The specification does not describe the features of SEQ ID NO: 1 which confer functional activity. Therefore, one skilled in the art cannot identify structures that confer functional activity from other plant species.
(1) Applicant’s haven’t described the polypeptide is found in other plant species and has the same function (2) Applicant’s haven’t described the genus of structures (i.e., 95% to SEQ IDNO: 1).
Applicant does not describe common structures or motifs for SpWRI3 functionality that is shared by Spirodella polyrhiza plants or from any other duckweed plant having the same tolerance. Therefore, the lack of such identifying characteristics is not sufficient to show the applicant was in possession of the invention as claimed.
The specification fails to describe that variants with at least 95% sequence identity to SEQ ID NO: 1 will confer tolerance to heavy metal stress, salt stress, drought or combination thereof across different plants rendering it unknown if the variants will retain functional activity and confer tolerance to heavy metal, salt, drought or combination thereof. This is because the specification does not describe functional domains or motifs such that one would have no idea if the variants possess the necessary structures to be functionally active and confer resistance.
Furthermore, claims 14-15, 18, and 21-23 encompass amino acid sequences having at least 95% identity to SEQ ID NO: 1. This requires the specification to describe amino acid sequences encoding such proteins.
However, the specification does not describe a SpWRI3 polypeptide with at least 95% identity to SEQ ID NO: 1, which leads to a functional SpWRI3 polypeptide.
A polypeptide with at least 95% identity to SEQ ID NO: 1 would have 8 amino acid substitutions relative to SEQ ID NO: 3.
These polypeptides would encompass 198 distinct protein variants. In the absence of describing where in the sequence of SEQ ID NO: 1 such variations can be sustained, one of skill in the art would not be led to believe that Applicant possesses this vast genus of amino acid sequences that retain functional activity, or to the make the polypeptide which would retain the activity of SEQ ID NO: 1, and lead to confer tolerance to heavy metal stress, salt stress, drought or combination thereof.
Therefore, while the example only describes that SpWRI3 SEQ ID NO: 1 can confer tolerance to heavy metal stress, salt stress, drought or combination thereof, the specification fails to provide adequate description on the motifs, catalytic domains, etc. in these sequences that confers the specifically claimed function of tolerance.
Applicant has shown one structure/sequence which is not deemed to be a representative number of structures/sequences from the genus of sequences having 95% sequence identity to SEQ ID NO: 1 that retain function and thus confer tolerance.
For example, a blast search of the top ten results shows proteins as unnamed and hypothetical genes:
PNG
media_image1.png
359
1220
media_image1.png
Greyscale
(1) here are the alignments none of which have high sequence similarity (2) these search results do not describe structures that confer functionality. Therefore, based on the state of the art the skilled artisan would not know the structures found within sequence having as little as 95% sequence identity to SEQ ID NO: 1 that confer tolerance of heavy metals, salt, drought, or combination thereof.
Because of the lack of a description of a representative number of structures/sequences, the absence of information in the art on conserved regions required for activity, and the impact of 5% variation of SEQ ID NO: 1, one skilled in the art would not know the structures that confer the various traits.
Accordingly, there is lack of adequate description to inform a skilled artisan that Applicant was in possession of the claimed invention at the time of filing. See Written Description guidelines published in Federal Register/ Vol.66, No. 4/ Friday, January 5, 2001/ Notices; p. 1099-1111
Claim Rejections - 35 USC § 112(a)(Enablement)
Claims 14-15, 18 and 21-23, are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for overexpressing SpWRI3 (SEQ ID NO: 1) in Arabidopsis resulting in conferring tolerance to FGD wastewater, does not reasonably provide enablement for any species of plant comprising a protein having as little as 95% sequence identity to SEQ ID NO: 1 and confer tolerance of heavy metals, salt, drought, or combination thereof. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention commensurate in scope with these claims.
“The first paragraph of 35 U.S.C. § 112 requires, inter alia, that the specification of a patent enable any person skilled in the art to which it pertains to make and use the claimed invention. Although the statute does not say so, enablement requires that the specification teach those in the art to make and use the invention without ‘undue experimentation.’ In re Wands, 858 F.2d 731, 737 (Fed. Cir. 1988).
That some experimentation may be required is not fatal; the issue is whether the amount of experimentation required is ‘undue.’” In re Vaeck, 947 F.2d 488, 495 (Fed. Cir. 1991) (emphasis in original); see also In re Wright, 999 F.2d 1557, 1561 (Fed. Cir. 1993) (“[T]o be enabling, the specification of a patent must teach those skilled in the art how to make and use the full scope of the claimed invention without ‘undue experimentation.’”) “Whether undue experimentation is needed is not a single, simple factual determination, but rather is a conclusion reached by weighing many factual considerations.” Wands, supra.
Some experimentation, even a considerable amount, is not “undue” if, e.g., it is merely routine, or if the specification provides a reasonable amount of guidance as to the direction in which the experimentation should proceed. Factors to consider include “(1) the quantity of experimentation necessary, (2) the amount of direction or guidance presented, (3) the presence or absence of working examples, (4) the nature of the invention, (5) the state of the prior art, (6) the relative skill of those in the art, (7) the predictability or unpredictability of the art, and (8) the breadth of the claims.” Id.
Applicant’s disclosure is as set forth above. The claimed invention is not enabled for the following reasons. To comply with 35 USC 112(a) enablement, one skilled in the art must be able to make and use the claimed invention.
(A) The breadth of the claims
The breadth of the claims encompasses any plant comprising any SPWRI3, or SpWRI3 having any structure within 95% sequence identity to SEQ ID NO: 1 providing tolerance of heavy metals, salt, drought, or combination thereof. However, the specification has only taught overexpressing SEQ ID NO: 1 in Arabidopsis confers tolerance to FGD wastewater.
(B) The nature of the invention.
The nature of the claimed invention is directed to any plant comprising the SpWRI3 having at least 95% sequence identity to SEQ ID NOs: 1, achieved introducing an expression cassette encoding spWRI3, to provide tolerance to FGD wastewater .
(C) The state of the prior art
The state of the prior art does not teach the SpWRI3 polypeptide or the structures that confer function for said polypeptide. Additionally, the art does not teach conserved regions or alignments of said protein.
(E) The level of predictability in the art; (F) The amount of direction provided by the inventor; (G) The existence of working examples; and (H) The quantity of experimentation needed to make or use the invention based on the content of the disclosure.
The claimed invention lacks adequate enabling guidance for the following reasons. Claims 14-15, 18 and 21-23, are directed to a method of growing a plant or seed transformed with SpWRI3 resulting in a plant that is tolerant to heavy metal stress, salt stress, drought or combination thereof, wherein the SpWRI3 is obtained from any source having any amino acid structure.
Additionally, the claims encompass an amino acid sequence having at least 95% sequence identity to SEQ ID NO: 1. Furthermore, the scope of the claims encompasses SpWRI3 obtained from sources other than S. polyrhiza so long as they share at least 95% sequence identity to SEQ ID NO: 1.
The only SpWRI3 taught is from S. polyrhiza being SEQ ID NO: 1 having the function of conferring tolerance to FGD wastewater. The specification does not provide the adequate amount of direction or guidance on the features of SEQ ID NO: 1 which confer functional activity. From the disclosure of SEQ ID NO: 1, one skilled in the art cannot predict the structures of other Wrinkled transcription factor 3 (WRI3) from other plant species.
(1) Applicant’s haven’t provided guidance that the polypeptide is found in other plant species and has the same function (2) Applicant’s haven’t taught the genus of structures (i.e., 90% to SEQ ID NO: 1).
Applicant does not teach common structures or motifs for SpWRI3 shared by all duckweed plant or any other plant that would allow one skilled in the art to predict structures of SpWRI3 or from any other duckweed plant having the same tolerance.
The specification fails to TEACH, or fails to provide GUIDANCE for making variants with at least 95% sequence identity will have the same tolerance. The lack or guidance and the lack of working examples means one skilled in the cannot make and use a polypeptide having as little as 95% sequence identity to SEQ ID NO: 1.
Furthermore, claims 14-15, 18, and 21-23 encompass a SpWRI3 polypeptide having an amino acid sequence with at least 95% identity to SEQ ID NO: 1. This requires the specification to teach amino acid sequences encoding such polypeptides.
However, the specification does not teach or provide guidance for making a polynucleotide encoding a SpWRI3 polypeptide with at least 95% identity to SEQ ID NO: 1, which leads to a functional SpWRI3 polypeptide.
A polypeptide with at least 95% identity to SEQ ID NO: 1 would have 8 amino acid substitutions relative to SEQ ID NO: 1. These polypeptides would encompass 198 distinct protein variants, respectively. In the absence of guidance indicating where in the sequence of SEQ ID NO: 1 such variations can be sustained, undue trial and error experimentation would be required to make the claimed polypeptide which would retain the activity of SEQ ID NO: 1, and lead to conferring tolerance heavy metal stress, salt stress, drought or combination thereof.
Therefore, while the examples teach SpWRI3 SEQ ID NO: 1 can confer tolerance with Arabidopsis, the specification fails to teach motifs, catalytic domains, etc. in these sequences that confers the specifically claimed function of tolerance. Applicant has not shown one structure/sequence having 95% sequence identity that retain function and thus confer tolerance.
For example, a blast search of the top ten results shows proteins as unnamed and hypothetical and thus does not describe other SpWRI3 genes or polypeptides.
PNG
media_image1.png
359
1220
media_image1.png
Greyscale
Therefore, because the art fails to teach the structures required for SpWRI3 functional activity, a person skilled in the art would be unable to predictably make, and thus use, the claimed amino and nucleic acid sequences as the specification fails to teach the critical domains and motifs that are required for functional activity.
Because of the lack of representative sequences, that lack of information on conserved regions required for activity, and the impact of 5% variation of SEQ ID NO: 1, the specification fails to provide enough guidance to predictably make and/or use the claimed sequences to predictably produce plants with tolerance to heavy metal, salt, drought, or combination thereof.
The claimed invention lacks adequate enabling guidance with regard to the genus of plants that comprise SpWRI3 whereby tolerance to heavy metal, salt, drought, or combination thereof is obtained. The scope of the claims encompass any species of plant. However, Applicant’s working example is overexpressing SEQ ID NO: 1 in Arabidopsis conferring tolerance of FGD wastewater. Applicant has not taught overexpressing SEQ ID NO: 1 in other plant types confers said phenotype.
Given the breadth of the claims, the lack of sufficient guidance, the absence of working examples regarding the structure of SPWRI3 having at least 95% sequence identity to SEQ ID NO:1 which confer functional activity, the state of the prior art, and unpredictability in the art, one skilled in the art cannot make and use the claimed invention as commensurate in scope with the claims without excessive burden and undue experimentation.
For at least this reason, the Specification does not teach a person with skill in the art how to make and/or use the subject matter within the full scope of these Claims.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 14, 18 and 21-23, are rejected under 35 U.S.C. 103 as being unpatentable over To et al. (WRINKLED transcription factors orchestrate tissue-specific regulation of fatty acid biosynthesis in Arabidopsis. 2012. The Plant cell vol. 24,12: 5007-23. doi:10.1105/tpc.112.106120 (U)) and Sanjaya et al. (Developing Cost Effective Biological Removal Technology for Selenium and Nitrate from Flue Gas Desulfurization Wastewater from an Existing Power Facility. 2021, January 25. OSTI.GOV | U.S. Department of Energy Office of Scientific and Technical Information. https://www.osti.gov/ (V)).
In regard to claims 14, 18 and 22, To et al. teaches that Wrinkled transcription factor (WRI) are responsible for fatty acid bio-synthesis, specifically triacylglycerol (TAG) (see Abstract and figures 4-5). Specifically, To et al. teaches WRI3 being responsible for producing TAG’s in flowers and stems (see figures 3P and 4-5). Additionally, To et al. teaches inserting WRI in another organism (see 5021). Overall, To et al. teaches that WRI’s are master regulators for TAG’s.
In regard to claims 14, 18 and 22, To et al. does not teach SpWRI3.
In regard to claims 14, 18 and 22, Sanjaya et al. teaches that “[m]etal and metalloids like selenium, mercury, and arsenic are major contaminants known to be present in coal mine soil and FGD wastewater” (see page 20 1st sentence). Sanjaya et al. teaches that “We have also observed a similar phenomenon in duckweed and a concomitant reduction in the levels of heavy metals in FGD wastewater due to biological treatment.”
Sanjaya et al. teaches Spirodella polyrhiza being “photosynthetically active under 72 hr FGD wastewater treatment” compared to the control (i.e. tolerant under heavy metal, and salt stress) (see page 8 last sentence). This shows that S. polyrhiza is valuable for bioremediation.
Furthermore, Sanjaya et al. teaches that “[t]he elevated levels of primary metabolites such as TAG and carbohydrates indicate stress response to FGD wastewater by the duckweed.” (see page 21 and figure 1). This suggests that high levels of TAG serve as a defense mechanism that aids the plant in surviving abiotic stress. Lastly Sanjaya et al., teaches producing transgenic plants to “increase sequestration of selenium and nitrates in biomass for agricultural productivity” (see page 13).
d. Given that To et al. teaches that WRI3 acts as a master regulator for TAG synthesis, along with Sanjaya et al. teaching S. polyrhiza naturally accumulates high TAG levels to survive heavy metal stress, a person killed in the art would have found it obvious to combine these teachings. Specifically, one would express WRI3 within S. polyrhiza in order to increase TAG production, because Sanjaya teaches that elevated TAG levels are in response to stress allowing the plant to survive and thrive during bioremediation treatment.
Therefore, prior to the effective filing date it would have been prima facie obvious to one of ordinary skill in the art to modify the teachings of To et al. in view of Sanjaya et al. because one skilled in the art would readily combine prior art elements according to known methods to yield a predictable result.
One would have a reasonable expectation of success in this approach because To et al. teaches WRI3 being a master regulator for TAG synthesis, while Sanjaya et al. teaches S. polyrhiza being used in bioremediation and having high abiotic stress tolerance from TAG. Consequently, based on the teachings of To et al. in view of Sanjaya et al., one would reasonably expect to arrive at a method to produce a plant with the claimed phenotypes.
In regard to claim 21, To et al. teaches WRI3 being a master regulator for TAG synthesis.
In regard to claim 21, To et al. does not teach Spirodella polyrhiza having salt stress.
In regard to claim 21, Sanjaya et al. teaches “[t]he overall biomass growth and total biomass weight, and photosynthetic efficiency were reduced in cultures treated with FGD wastewater due to toxic substances and high salt concentrations” (see page 21 second sentence).
Given that To et al. teaches WRI3 being a regulator of TAG synthesis, along with Sanjaya et al. teaching that S. polyrhiza is tolerant in high stress conditions, one skilled in the art would combine both teachings knowing that S. polyrhiza produces high levels of TAG during abiotic stress. Therefore, one skilled in the art would predictably and successfully produce a plant generated in salt stress.
In regard to claim 23, To et al. teaches WRI3 being a master regulator for Tag synthesis in Arabidopsis.
In regard to claim 23, To et al. does not teach on growing S. polyrhiza and Arabidopsis hydroponically.
In regard to claim 23, Sanjaya et al. teaches using “hydroponics system to test the effects of individual chemicals present in FGD wastewater.” (see page 6, 1st sentence).
Given that To et al. teaches WRI3 being a regulator of TAG synthesis in Arabidopsis, along with Sanjaya et al. teaching growing S. polyrhiza in hydroponic FGD water, one skilled in the art would combine both teachings knowing that S. polyrhiza is able to grow in hydroponic FGD water. Therefore, one skilled in the art would predictably and successfully grow S. polyrhiza and Arabidopsis hydroponically.
Subject matter free of prior art
Instant claim 15 appears to be free of the prior art. The closest prior art is Michael et al. (Comprehensive definition of genome features in Spirodella polyrhiza by high-depth physical mapping and short-read DNA sequencing strategies. 2017. The Plant journal : for cell and molecular biology vol. 89,3: 617-635. doi:10.1111/tpj.13400 (X)) which teaches LOCUS CP019102 having 74% sequence identity to SEQ ID NO: 1 as shown below.
RESULT 1
CP019102
LOCUS CP019102 6603776 bp DNA linear PLN 17-JAN-2017
DEFINITION Spirodela polyrhiza strain 9509 chromosome 10, partial sequence.
ACCESSION CP019102
VERSION CP019102.1
DBLINK BioProject: PRJNA308109
BioSample: SAMN04386762
KEYWORDS .
SOURCE Spirodela polyrhiza (great duckweed)
ORGANISM Spirodela polyrhiza
Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta;
Spermatophyta; Magnoliopsida; Liliopsida; Araceae; Lemnoideae;
Spirodela.
REFERENCE 1 (bases 1 to 6603776)
AUTHORS Michael,T.P., Bryant,D., Gutierrez,R., Borisjuk,N., Chu,P.,
Zhang,H., Xia,J., Zhou,J., Peng,H., El Baidouri,M., Ten Hallers,B.,
Hastie,A.R., Liang,T., Acosta,K., Gilbert,S., McEntee,C.,
Jackson,S.A., Mockler,T.C., Zhang,W. and Lam,E.
TITLE Comprehensive Definition of Genome Features in Spirodela polyrhiza
by High-Depth Physical Mapping and Short-Read DNA Sequencing
Strategies
JOURNAL Plant J. (2016) In press
PUBMED 27754575
REMARK Publication Status: Available-Online prior to print
REFERENCE 2 (bases 1 to 6603776)
AUTHORS Bryant,D., Michael,T.P. and Lam,E.
TITLE Direct Submission
JOURNAL Submitted (06-JAN-2017) Mockler Lab, Donald Danforth Plant Science
Center, 975 North Warson Road, Saint Louis, MO 63132, USA
Length: 6603776
Score: 637.50 Matches: 163
Percent Similarity: 36.1% Conservative: 0
Best Local Similarity: 36.1% Mismatches: 1
Query Match: 74.6% Indels: 288
Gaps: 3
US-18-757-072-1 (1-164) x CP019102 (1-6603776)
Qy 1 MetGlyLysAlaArgLysAspLeuAlaSerSerGlyAsnCysGlyAspAspAspGluSer 20
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 6042463 ATGGGGAAGGCCCGGAAGGACCTGGCCAGCAGCGGCAACTGCGGCGATGATGATGAATCC 6042522
Qy 21 AlaGluGlySerGlyArgSerPheAsnAsnLeuLysArgLysArgSerArgThrSerAla 40
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 6042523 GCTGAGGGCAGCGGCAGGAGCTTCAACAATCTGAAGAGGAAGAGGAGCAGGACGAGCGCC 6042582
Qy 41 ValArgGluSerProAlaSerArgSerSerValTyrArg--------------------- 53
|||||||||||||||||||||||||||||||||||||||
Db 6042583 GTCAGGGAGTCGCCGGCGTCGCGCAGCTCTGTCTACCGAGGTGTTACGAGGTCAGAGAAA 6042642
Qy 53 ------------------------------------------------------------ 53
Db 6042643 AAAAGAAGATGATGAAGAAGAGGAGACTCCATTCATCTCTCTTTCCTCAGTTTCTCTTTC 6042702
Qy 53 ------------------------------------------------------------ 53
Db 6042703 TTCTAACCTTCGATTTGCATGCACCATTCTCTCTCTCTCTCTCTCTCTCTCCCTCTTCCA 6042762
Qy 53 ------------------------------------------------------------ 53
Db 6042763 TATAAGAGATTGCTGCATTAATGGTGGTTTTGGTGGATGTAGGCACCGGTGGACAGGCAG 6042822
Qy 53 ------------------------------------------------------------ 53
Db 6042823 GTTCGAGGCCCATCTCTGGGACAGAAACTGGAACGATTCCCGCACCAAGAAAGGAAGACA 6042882
Qy 53 ------------------------------------------------------------ 53
Db 6042883 AGGCACGTTCCTCTCCCTGCTGTTGCTGCTGCTGCTGCTCTCTCTCTCTCTCTCTCTCTC 6042942
Qy 53 ------------------------------------------------------------ 53
Db 6042943 TCCCTCTCTCTCTCTATCACTTCAACTAATGGCTGTTTGCTTTTGTTTCGTCTCTTCCGT 6043002
Qy 53 ------------------------------------------------------------ 53
Db 6043003 ATTTGATCTTCGCGGCCGCTGGAACTCGAATGTGCGGCAGTCTACCTCGGTGAGCTTGAA 6043062
Qy 53 ------------------------------------------------------------ 53
Db 6043063 AATCCGGAGAACTAAACACACCAATCTCATGTGCTTCCCTGTTGATATCATCTTCCGACT 6043122
Qy 54 -------------------------------------------------GlyAlaTyrGl 57
|||||||||||
Db 6043123 GATTGTTGATGGATCAAGCTTCCTTTTTCTTCTCCTGCTCGATCATCCAGGAGCCTACGA 6043182
Qy 57 uGluGluGluAlaAlaAlaArgAlaTyrAspLeuAlaAlaLeuLysPheTrpGlyHisAs 77
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 6043183 AGAGGAGGAAGCCGCCGCTCGTGCTTATGATCTTGCCGCGTTGAAGTTCTGGGGGCATGA 6043242
Qy 77 pThrLeuLeuAsnPhe-Pro---------------------------------------- 83
|||||||||||||||| |||
Db 6043243 CACCCTTCTGAACTTCCCCGTAAGACTCTCTCTCTCTCTCTCTATCTCTCCCGGTGGCTC 6043302
Qy 84 -----------------------------------------LeuSerThrTyrGlnGlyG 90
|||||||||||||||||||
Db 6043303 TCTCTCTCTCTCTCTCTCTCTGATTGCGGGTAAATGAACAGCTGTCGACATACCAAGGAG 6043362
Qy 90 luMetGluGluMetGluGlyLeuSerArgGluGluTyrIleSerPheIleArg------- 107
||||||||||||||||||||||||||||||||||||||||||||||||||
Db 6043363 AGATGGAGGAGATGGAAGGGCTTAGCAGGGAAGAATATATAAGCTTCATAAG-AAGGTAA 6043421
Qy 107 ------------------------------------------------------------ 107
Db 6043422 CCTCTGAGTAGAGAAGGTCACATGTTATTAGCTCTTCTGATTCTCTCACAGCCATTATTT 6043481
Qy 107 ------------------------------------------------------------ 107
Db 6043482 CCATGACTCCACTAGAAAGAGCAGCGGGTTCTCTCGAGGCGTTTCCAAGTACAGAGGCGT 6043541
Qy 107 ------------------------------------------------------------ 107
Db 6043542 AGCCAGGTAACTGGGGGTCTTCCTGCGTCATTTAACTTTCTCTCTCTACCCCTCTCTCTC 6043601
Qy 108 --------------------------------------ArgHisHisLysAsnGlyLysT 115
||||||||||||||||||||||
Db 6043602 TCTCTCTCTCTCTCTCTCTCTTAGTGCATACTGCATGCAGGCACCATAAGAATGGAAAGT 6043661
Qy 115 rpGluAlaArgIleGlyArgValPheGlyAsnLysTyrLeuTyrLeuGlyIleTyrGlyA 135
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 6043662 GGGAAGCCAGGATTGGCAGAGTCTTCGGCAACAAGTATCTCTACCTGGGAATCTACGGTG 6043721
Qy 135 spLeuSerLeuSerLeuTyrGluLysSerIleLysAlaGlyArgValSerTrpGlyGlyL 155
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 6043722 ATCTCTCTCTCTCTCTCTATGAAAAGTCCATCAAAGCCGGCCGGGTTAGTTGGGGAGGGA 6043781
Qy 155 ysGlySerLeuAspTyrPheLeuLeuLeu 164
|||||||||||||||||||||||||||||
Db 6043782 AGGGGAGCCTTGACTACTTCTTGCTTCTC 6043810
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to CHRISTIAN JOSE ORDAZ whose telephone number is (703)756-1967. The examiner can normally be reached 8:30 am-5:00 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, Applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad A Abraham can be reached on (571) 270-7058. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/C.J.O./Examiner, Art Unit 1663 /JASON DEVEAU ROSEN/Primary Examiner, Art Unit 1662