Prosecution Insights
Last updated: April 19, 2026
Application No. 18/763,490

METHODS AND COMPOSITIONS FOR MODIFYING A TARGETED LOCUS

Non-Final OA §103
Filed
Jul 03, 2024
Examiner
DACE DENITO, ALEXANDRA GERALDINE
Art Unit
1636
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Regeneron Pharmaceuticals, Inc.
OA Round
4 (Non-Final)
54%
Grant Probability
Moderate
4-5
OA Rounds
3y 0m
To Grant
92%
With Interview

Examiner Intelligence

Grants 54% of resolved cases
54%
Career Allow Rate
23 granted / 43 resolved
-6.5% vs TC avg
Strong +38% interview lift
Without
With
+38.1%
Interview Lift
resolved cases with interview
Typical timeline
3y 0m
Avg Prosecution
50 currently pending
Career history
93
Total Applications
across all art units

Statute-Specific Performance

§101
5.9%
-34.1% vs TC avg
§103
34.1%
-5.9% vs TC avg
§102
17.3%
-22.7% vs TC avg
§112
30.1%
-9.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 43 resolved cases

Office Action

§103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Continued Examination Under 37 CFR 1.114 A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 12/12/2025 has been entered. Priority Applicant’s claims of priority from US Provisional Applications Nos. 62/008,832 filed 06/06/2014 and 62/017,916 filed 06/27/2014 are hereby acknowledged. Election/Restrictions The election of Species without traverse in the reply filed on 12/16/2024 is still proper and in effect. Applicant elected without traverse: Species A-IV, a first Nuclease agent, a Clustered Regularly lnterspaced Short Palindromic Repeats (CRISPR)-associated (Cas) protein and a guide RNA, Species B-IV, a second Nuclease agent, a Clustered Regularly lnterspaced Short Palindromic Repeats (CRISPR)-associated (Cas) protein and a guide RNA, - Species C, a guide RNA of SEQ ID NO: 13. - Species D-III, a Targeting Vector at least about 10kb or is from about 20Kb to about 300Kb. Species E-I, E-IV and E-V, a First polynucleotide of interest comprising a human polynucleotide and the first polynucleotide of interest comprises an exogenous nucleic acid sequence or a nucleic acid sequence that is homologous or orthologous to a nucleic acid sequence in the genome of the cell and the first polynucleotide of interest comprises a polynucleotide encoding a region of a T cell receptor. Species F-I, and F-IV, a rodent cell that is an ES cell. Claims 13, and 24-25 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected Species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 12/16/2024. Application Status Amendments to claims filed 12/12/2025 are hereby acknowledged. Claims 13, and 24-25 are still withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected Species. Claims 4, 10, and 12 are cancelled. Therefore, claims 1-3, 5-9, 11, 13-37 are pending and claims 1-3, 5-9, 11, 14-23 and 26-37 under consideration in this office action. Any objection or rejection not reiterated herein has been overcome by Applicant’s amendments and is therefore withdrawn. New rejections Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or non-obviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1-2, 5-7, 11, 14, 16, 21, 27, 28, 29, and 32-37 are rejected under 35 U.S.C. § 103 as being unpatentable over Collin (Collin, J. et al. “Concise review: Putting a finger on stem cell biology: Zinc Finger Nuclease-driven targeted genetic editing in human pluripotent stem cells”. Stem Cells, Vol. 29 (2011), pp: 1021-1033; previously cited) in view of Zhang (Zhang, F. US Patent No. 8,795,965 B2, published August 5, 2014, benefitting from priority of US Application No. 14/183,486 filed February 18, 2014). Regarding claim 1(a), Collin teaches a method for serial modifications of a target locus in a cell comprising a target locus with a gene which comprises recognition sites for a ZFN for targeted genomic modifications (see title and abstract). Collin teaches that the first nuclease recognition site is located in a coding region of a first selection marker (see Figure 2). Collin teaches ZFN-mediated targeted gene editing (see title, abstract and page 1022, right column, and page 1024, Figure 2B). In Figure 2B, Collin teaches the use of ZFN nuclease to correct a mutation in exon 1 of a gene, i.e. a target locus. This mutated exon can be then targeted for repair by Homologous recombination (HDR), using a targeting vector comprising homology arms flanking a cassette comprising a selection marker, i.e. puromycin. See below: PNG media_image1.png 781 499 media_image1.png Greyscale PNG media_image2.png 785 463 media_image2.png Greyscale In Figure 2B, Collin teaches the disruption and knock-out of exon 1 of a gene by inserting a selectable marker, using ZFNs. In Figure 2C, Collin teaches mutagenesis of exon 1 of a gene in a cassette to reproduce a mutated allele and the targeting of the cassette using a secondary targeting cassette comprising a selection marker, also using ZFNs. Collin teaches a polynucleotide comprising the polynucleotide encoding a first nuclease agent that is introduced into the cells. Regarding claim 1(b)(i), Collin teaches the nuclease agent ZFN induces a double-strand break at the first nuclease recognition site (see Figure 1). Regarding claim 1(b)(ii), Collin teaches a targeting vector comprising an insert polynucleotide flanked by an upstream homology arm corresponding to an upstream target site and a downstream homology arm corresponding to a downstream target site located in the target locus (see Figure 2’s legend, on page 1023; see page 1024, left column), wherein the insert polynucleotide encodes a selection marker operably linked to a promoter (see Figure 2B, C and D; see Table 2 and page 1028, left column). Applicant does not disclose the definition of a selection marker, only some embodiments, therefore Examiner interprets “selection marker” as encompassed by the BRI (Broad and Reasonable Interpretation) of the terms, which is any marker allowing distinction and selection between non-modified and modified cells. Regarding claim 1(b)(ii) reciting “wherein the first selection marker and the second selection marker are different”, Collin teaches puromycin or EGFP as selection markers (see Figures 2B, C and D). Collin also teaches using multiple ZFNs. Collin also teaches the targeting of both alleles at a AAVS1 locus using AAVS1-ZFNs and two different donor DNAs, with two promoter-less resistance markers driven by the PPP1R12C promoter and two separate promoter-transcription units (see page 1029, left column, first paragraph). Examiner interprets that the need for multiple ZFNs means that they need to be different. Figure 1 shows that ZFNs work in pairs; Panel A shows a module consisting in four ZFPs (Zinc Finger Proteins) which recognize a composite site of 24 bp. In claim 1(c ), regarding the recitation “identifying a modified cell comprising the insert polynucleotide integrated at the target locus, wherein the modified cell has the activity of the second selection marker but does not have the activity of the first selection marker”, Collin does not teach identifying a modified cell comprising the insert polynucleotide integrated at the target locus, wherein the modified cell has the activity of the second selection marker but does not have the activity of the first selection marker. Although Collin teaches a recognition site within the first selection marker, Collin do not teach the limitation recited in claim (b)(ii): “wherein the insert polynucleotide encodes …a second nuclease recognition site for a second nuclease agent, wherein the second nuclease recognition site is located within a coding region of the second selection marker”. However, Zhang teaches serial modifications, i.e. “sequential introduction of mutations” by CRISPR-mediated genome editing (see column 14, lines 21-45 and Figure 34A-D). Regarding claim (b)(ii): “wherein the insert polynucleotide encodes …a second nuclease recognition site for a second nuclease agent, wherein the second nuclease recognition site is located within a coding region of the second selection marker”, Zhang teaches the introduction of mutation or deletion of sequences within a gene marker and using the CRISPR- Cas system, for example introduction of amino acid substitutions R>A and NE>AA mutations into β-galactosidase (bgaA) (see Figure 25c and column 13, lines 11-13) and deletion of 6664bp within bga A ORF (see figures 25c and 25f; column 13, lines 14-16). Therefore, Zhang teaches mutating a selection marker (see Figure 25e, Editing template 2) and selection with Kanamycin (see Figure 25e). Regarding claim 1(c ) reciting “identifying a modified cell comprising the insert polynucleotide integrated at the target locus, wherein the modified cell has the activity of the second selection marker but does not have the activity of the first selection marker”, Zhang teaches (see Figures 34 A-D) that “First R6 is engineered to generate crR6Rk” (see column 14, line 24). Zhang teaches that R6 is the name of the Streptococcus pneumoniae strain used (see ref# 39, column 140); crR6 is a strain where IS1167 element of S. pneumoniae is replaced by the CRISPR01 locus of S. pyogenes SF370 strain using a first targeting vector; then crR6M is further engineered to contain a minimal functional CRISPR system without cas1, cas2 and Csn2 (see column 12, lines 46-55); crR6Rk is engineered from crR6M to contain tracrRNA , Cas9 and only one repeat of the CRISPR array followed by Kanamycin resistance marker (aphA-3) after another targeting and recombination event (see column 13, lines 39-42). Zhang teaches that crR6Rk is then co-transformed with a srt.4-targeting construct fused to CAT for chloramphenicol selection of edited cells, along with an editing construct for a ΔsrtA in-frame deletion (column 14, lines 29-32). Zhang teaches that srtA is a sortase allowing proteins to remain anchored on cell surface, located in srt.4 locus; srtA gene was engineered to incorporate a protospacer from streptococcal bacteriophage; deleting srtA in the engineered strain crR6 results in release of β-galactosidase in the cell medium (column 14, lines 36-42). Zhang teaches that strain crR6 ΔsrtA is generated by selection on chloramphenicol. Subsequently, the ΔsrtA strain is co-transformed with a bgaA-targeting construct fused to aphA-3 for kanamycin selection of edited cells, and an editing construct containing a ΔbgaA in-frame deletion.” (see column 14, lines 21-32 and Figure 34A-D). [ bgaA is β-galactosidase gene (column 13, line 13).] Zhang teaches that “such a sequential selection can be iterated as many times as required to generate multiple mutations”. (see column 90, lines 4-18). Regarding claim 1(c ) and claim 5, Zhang teaches isolating individual clone cells , then expanding the cells for genotype analysis using PCR to detect the presence or absence of deleted sequences (see column 17, lines 31-34, and lines 42-45). Zhang teaches that the cells can be isolated, their nuclei further isolated for detection using assays such as DNA cleavage or mutation at the target sequence, or assay for altered gene expression activity as compared to control (column 28, lines 10-21). Therefore, Zhang teaches CRISPR-Cas system with guide RNA and targeting constructs transfected in stable transformants selected a first time with a first selection marker flanked by two sgRNAs recognition sites (see Figs.34A-D). Zhang teaches replacement of a first selection marker with a second selection marker and selected cells using the second selection marker (Figs. 34A-D and column 14, lines 21-45). In conclusion, Zhang teaches that “The understanding of gene function depend in the possibility of altering DNA sequences within the cell in a controlled fashion. Site-specific mutagenesis in eukaryotes is achieved by the use of sequence-specific nucleases that promotes homologous recombination of a template DNA containing the mutation of interest. Zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs) and homing meganucleases can be programmed to cleave genomes in specific locations, but these approaches require engineering of new enzymes for each target sequence. In prokaryotic organism, mutagenesis methods either introduce a selection marker in the edited locus or require a two-step process that includes a counter-selection system….Therefore, new technologies that are affordable, easy to use and efficient are still in need for the genetic engineering of both eukaryotic and prokaryotic organisms” (see Example 5 “RNA-guided editing of Bacterial genomes using CRISPR-Cas systems”, column 86, lines 41-63). It would have been obvious to one with ordinary skills before the effective filing date of the claimed invention, to have combined the teachings of Collin and Zhang, and performed serial modifications as taught by Collin, and using the CRISPR-Cas system and selection markers taught by Zhang. One with ordinary skill in the art could have performed this modification replacing the ZFNs taught by Collin with a CRISPR-Cas system taught by Zhang, since using the most recent engineering advances leads to more specificity and precision. One with ordinary skills in the art, could have inserted the sgRNA recognition sequence within a selectable marker coding sequence, and deactivated the marker as taught by Collin and Zhang, and using the CRISPR-Cas system taught by Zhang. One motivated in serial modification of a target locus, and motivated in practical and affordable methods, and in increasing efficiency and specificity in homologous recombination to engineer specific alterations, could have use the system taught by Zhang and performed this modification with a reasonable expectation of success and arrived at the claimed invention. Collin also teaches limitations in dependent claims: Regarding claim 2, Collin teaches a method, using, wherein a polynucleotide encoding a selection marker is flanked by upstream target site and downstream target site (see Figure 2B, C and D). Regarding claims 6 and 7, Collin teaches a selection marker that can be an antibiotic (i.e. puromycin) (see Figure 2B and C). Regarding claim 32, Collin teaches loss of the first selection marker’s activity after ZFN-induced double strand break (see Figure 2). Regarding claim 33, Collin teaches inserting an insert polynucleotide within a first gene, that can be a selectable marker and introducing a second selectable marker in a cassette (see figure 2B). Regarding claims 34-37, Collin teaches eukaryotic cells, mammalian cells (mammalian cells: human embryonic stem cells; see Table 2) and ES cells from mice (see page 1021, right column, first paragraph; page 1024, right paragraph). Zhang also teaches limitations in dependent claims: Regarding claim 11 (III), Zhang teaches an expression construct comprising a DNA sequence encoding the Cas9, wherein the DNA sequence encoding the Cas9 is operably linked to a promoter active in the cell (see column 3, lines 21-35; column 4, line 65 to column 5, line 6). Zhang also teaches an expression construct comprising a DNA sequence encoding the gRNA, wherein the DNA sequence encoding the gRNA is operably linked to a promoter active in the cell (see column 5, lines 30-60). Regarding claim 14, Zhang teaches a CRISPR-Cas protein and a guide RNA that can be used as first and second nuclease agents in sequential mutagenesis (see column 14, lines 21-45, column 90, lines 17-18 and Figure 34A-D). Zhang discloses PAM sequence (See Figure 24 B) and CRISPR target site and the design of gRNA sequence comprising CRISPR RNA and tracrRNA (see column 24, lines 4-15; Figures 31, 34A-D, 36). Regarding claim 16, Zhang teaches a first and a second gRNA that are different ( see column 25, lines 39-53). Regarding claim 21, Zhang teaches a polynucleotide of interest comprises an exogenous nucleic acid sequence, in the form of a Cas9 expressing cassette (see Figure 34A-D) or a nucleic acid sequence that is homologous to a nucleic acid sequence in the genome of the cell (see column 7, lines 11-30 and column 30 line 60 to column 31, line 14). Regarding claim 28, Zhang teaches the replacement of the IS1167 element of S. pneumoniae R6 with the CRISPR01 locus of S. pyogenes SF370 to generate crR6 strain (see Figures 28A-B and column 12, lines 47-51). Zhang also states that “To introduce specific changes in the genome, one must use an editing template carrying mutations that abolish Cas9-mediated cleavage therefore preventing cell death. This is easy to achieve when the deletion of the target or its replacement by another sequence (gene insertion) is sought” (see column 88, lines 13-17). Regarding claim 27, Zhang teaches gene swap, point mutation, Knock-out or knock-in using integration of the insert polynucleotide ( see column 55, lines 1-4; see column 119, lines 44-49; see column 88, lines 13-17). Regarding claim 29, Zhang teaches that reporter gene integrated within the mouse genome (see page 2, “Introduction” section, third paragraph). Therefore, the target locus is in the genome of the cell. The obviousness of combining the references Collin and Zhang is described above; Both references teach elements of claims 2, 6-7, 11, 14, 16, 21, 27-28 and 32-37 as described above. Therefore, the combination of references also renders the said claims obvious, and the claims 2, 6-7, 11, 14, 16, 21, 27-28 and 32-37 are rejected as well. Claims 8, 19, 20 and 26 are rejected under 35 U.S.C. § 103 as being unpatentable over Collin (Collin, J. et al. “Concise review: Putting a finger on stem cell biology: Zinc Finger Nuclease-driven targeted genetic editing in human pluripotent stem cells”. Stem Cells, Vol. 29 (2011), pp: 1021-1033; previously cited), in view of Zhang (Zhang, F. US Patent No. 8,795,965 B2, published August 5, 2014, benefitting from priority of US Application No. 14/183,486 filed February 18, 2014) , as applied to claims 1 and 6 above, and in further view of Hall (Hall, B. et al. “Overview: generation of gene knockout mice”. Current Protocol in Cell Biology, Vol. 44 (2009), pp: 19.12.1-19.12.17; previously cited). Regarding claims 1 and 6, their rejections have been described above. The elements of claims 1 and 6 are rendered obvious by the combination of Collin and Zhang. Zhang’s teachings further suggest elements of claim 20, without teaching them directly: Regarding claim 20 (iv), Zhang also teaches that one can take advantage of highly evolved processes for targeting a virus to specific cells in the body, as gene transfer system, since retroviral vectors are comprised of cis-acting long terminal repeats with packaging capacity for up to 6-10 Kb of foreign sequence (see column 32, lines 49-57). However, the combination of references fails to disclose the elements claimed in claims 8, 19, 20 and 26. Hall reviews the technique for obtaining a knock-out mice (see title). Hall teaches that the initial step for the generation of a mouse with a targeted mutation is the construction of an efficient targeting vector that will be introduced into the murine embryonic stem (ES) cells (see abstract). Regarding claim 8, Hall teaches that a negative selection marker can be used (HSV-tk), placed adjacent to one of the targeting arms (see Figure 19.12.1). Hall also teaches hypoxanthine-guanosine phosphoribosyl transferase (HPRT) enzyme gene as a selection marker. Hall teaches that a mutant HPRT gene could be corrected through homologous recombination in ES cells and selected with addition of hypoxanthine/aminopterin/thymidine (HAT) medium (see page 19.12.1, right column, last paragraph; page 19.12.2, right column, first paragraph). Regarding claims 19 and 20, Hall teaches strategies wherein the upstream and downstream homology arms can range from 1-2 kb to up to 110 kb (see page 19.12.11, right column, second paragraph). Hall teaches that 2kb of sequence homology is usually required for designing a targeting vector for recombination to occur at all in a cell. However, 6 to 14 kb of sequence homology is typical usually for targeting vectors (see page 19.12.3; right column, last paragraph). It would have been obvious to one of ordinary skills in the art, before the effective filing date of the claimed invention, to have substituted one selection marker for another, and used a mutant HPRT gene as marker instead of Kanamycin within the cassette taught by Zhang. Both markers have the same function and are therefore equivalent in the end-result of selecting for a product that comprises a modified and corrected gene. One with ordinary skills in the art could have performed this modification with a reasonable expectation of success and arrived at the claimed invention. It also would have been obvious to one of ordinary skills in the art, before the effective filing date, of the claimed invention to have designed a targeting vector as taught by Collin and Zhang, and added at least 6 kb of homolog sequence for the homology arms flanking the target site in the cassettes taught by Zhang. One with ordinary skills in the art motivated in optimizing and ensuring recombination in a cell, could have performed this modification with a reasonable expectation of success, since Zhang teaches the packaging capacity of a viral-like particle to reach 10Kb, and arrived at the claimed invention. Regarding claim 26, Hall teaches that up to 15kb of sequence was deleted with a replacement vector to generate the T cell-receptor knock-out mouse (see page 19.12.12, left column, “Designing a knockout targeting construct (replacement vector)” section, lines 19-22). The obviousness of combining the references is described above. Claim 3 is rejected under 35 U.S.C. § 103 as being unpatentable over Collin (Collin, J. et al. “Concise review: Putting a finger on stem cell biology: Zinc Finger Nuclease-driven targeted genetic editing in human pluripotent stem cells”. Stem Cells, Vol. 29 (2011), pp: 1021-1033; previously cited), in view of Zhang (Zhang, F. US Patent No. 8,795,965 B2, published August 5, 2014, benefitting from priority of US Application No. 14/183,486 filed February 18, 2014), as applied to claim 1 above, and in further view of Bӧttcher (Bӧttcher, R. et al. Nucleic acids Research, Vol. 42 (April 19, 2014), p: e89; previously cited). The rejection of claim 1 is described above. The combination of references Collin and Zhang renders obvious elements of claim 1. However, regarding claim 3, The combination of Collin and Zhang does not render obvious elements of claim 3. The combination does not teach an identifying step carried out via a modification of allele (MOA) assay. Bӧttcher teaches a first nuclease recognition site, i.e. homing nuclease SCe-1 recognition site, and modification to add a second recognition site, i.e. PAM sequence for gRNA, for a second nuclease, i.e. Cas9 effector protein. Bӧttcher teaches a targeting vector for site-specific integration and homologous recombination (see “Abstract, and page 8, left column), containing a polynucleotide comprising an insert (PGK gene and tag) and a selection marker, i.e. Blasticidin resistance gene that is flanked by Cas9-gRNA recognition sites, i.e. an upstream target site and a downstream target site, and flanked by an upstream and a downstream homology arms (see figure 3A). Bӧttcher also teaches a myc-Cas9 transgene in plasmid pRB14 derived from pKF257 which has an operably linked α-tub84 promoter (see page 2, right column, lines 10-24). Bӧttcher teaches the modification of a construct / a targeting vector comprising GFP and a I-Sce I recognition site by adding nucleotide at the 3’ end of the site to allow recognition by CRISPR RNA (PAM site) (see Figure 2A). Bӧttcher teaches that cleavage by the nuclease occurs once the cells are also modified by transfecting a myc-Cas9 encoding plasmid vector (see page 2, right column, lines 13-24). Bӧttcher teaches inducing cleavage using the CRISPR-Cas9 system (see figure 1C, and page 7, right column, lines 8-17). Regarding claim 3, Bӧttcher teaches a specific assessment method to calculate the targeting efficiency measuring the percentage of GFP-positive cells according to the amount of targeting product transfected (see Figure 3B). Therefore, it would have been obvious to one with ordinary skills in the art, before the effective filing date of the claimed invention, to have considered the teachings of Bӧttcher. One with ordinary skills in the art interested in precision and specificity in homologous recombination, would consider the teachings of Bӧttcher using a CRISPR-Cas system for precise and specific homologous recombination. After serial modifications as taught by Collin, with a CRISPR-Cas system taught by Zhang, one with ordinary skills in the art motivated in assessing the efficiency of the method could have performed a MOA assay and added it to the method of identifying, as taught by Bӧttcher. One with ordinary skills in the art could have performed this modification with a reasonable expectation of success and arrived at the claimed invention. Claim 9 is rejected under 35 U.S.C. §103 as being unpatentable over Collin (Collin, J. et al. “Concise review: Putting a finger on stem cell biology: Zinc Finger Nuclease-driven targeted genetic editing in human pluripotent stem cells”. Stem Cells, Vol. 29 (2011), pp: 1021-1033; previously cited), in view of Zhang (Zhang, F. US Patent No. 8,795,965 B2, published August 5, 2014, benefitting from priority of US Application No. 14/183,486 filed February 18, 2014), as applied to claim 1 above, and in further view of Hasty (Hasty, P. et al. Molecular and Cellular Biology, Vol. 12 (1992), pp: 2464-2474; previously cited). Regarding claim 9, the combination of Collin and Zhang renders elements of claim 1 obvious. Collin and Zhang do not specifically teach a method wherein the combined use of the first targeting vector with the first nuclease agent results in an increased targeting efficiency that is at least two-fold compared to the use of the first targeting vector alone. However, Hasty teaches that an endonuclease site in the targeting vector produces linearized targeting vector, with an increase in targeting efficiency, five to twelve fold (see page 2467, right column, second ¶ and Table 1, experiment A). Therefore, it would have been obvious to one with ordinary skills in the art before the effective filing date of the claimed invention, to have combined the teachings of Collin and Zhang, with the teachings of Hasty and used an expression construct, expressing a Cas nuclease, and transfect before or at the same time than transfecting the targeting vector for an increased targeting efficiency, as taught by Hasty. One motivated in increasing the targeting efficiency of the targeting vector by at least two-fold could have performed this modification with a reasonable expectation of success and arrived at the claimed invention. Claim 15 is rejected under 35 U.S.C. §103 as being unpatentable over Collin (Collin, J. et al. “Concise review: Putting a finger on stem cell biology: Zinc Finger Nuclease-driven targeted genetic editing in human pluripotent stem cells”. Stem Cells, Vol. 29 (2011), pp: 1021-1033; previously cited), in view of Zhang (Zhang, F. US Patent No. 8,795,965 B2, published August 5, 2014, benefitting from priority of US Application No. 14/183,486 filed February 18, 2014) , as applied to claims 1 and 14 above, and in further view of Bӧttcher (Bӧttcher, R. et al. Nucleic acids Research, Vol. 42 (April 19, 2014), p: e89; previously cited) and Evans (Evans, G.A. WO 99/14318 A1, published March 25, 1999; previously cited). Regarding claim 15, the combination of Collin and Zhang renders the elements of claims 1 and 14 obvious as required for claim 15. The rejections of claims 1 and 14 are described above. Zhang teaches PAM sequences NGG that may be identified by searching for: 5’-Nx—NGG-3’ (see example 3, “sample Target sequence selection Algorithm”, column 67, line 18). Zhang also teaches 5’-N20-NGG-3’ (see column 69, line 37). However, the combination of references does not render all elements of claim 15 obvious, specifically, the sequence set forth in SEQ ID NO: 1 (GN19NGG). Bӧttcher teaches a target locus comprising the nucleotide sequence of SEQ ID NO: 1 (GN19NGG) (see Supplemental pdf-2 page 17). Collin in view of Zhang teach serial modifications of a target locus using a CRISPR-Cas system. The claimed PAM element is taught by Bӧttcher. Therefore, it would have been obvious to one with ordinary skills in the art, before the effective filing date to have substituted the PAM elements taught by Collin/Zhang with a PAM as taught by Bӧttcher, since the specific PAM is similar to the general formula taught by Zhang. One with ordinary skills in the art motivated in optimizing PAM sequences for specific gene of interest, could have performed this modification with a reasonable expectation of success and arrived at the claimed invention. Evans teaches a sequence that comprises SEQ ID NO: 13 in oligonucleotide R28 (oligoR28) in Figure 5D. This oligonucleotide used as a primer to amplify and construct a synthetic plasmid comprising a sequence for Kanamycin/neomycin phosphotransferase selection marker. This oligoR28 taught by Evans is a 50 nt long and encompasses SEQ ID NO: 3 and is a 100% match to SEQ ID NO: 3, therefore it is inherently a sequence to target when using a neomycin resistance selection marker. See alignment below (Qy= query: SEQ ID NO: 3; Db= database: OligoR28) Query Match 100.0%; Score 20; Length 50; Best Local Similarity 100.0%; Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 TGCGCAAGGAACGCCCGTCG 20 |||||||||||||||||||| Db 24 TGCGCAAGGAACGCCCGTCG 43 The combination of Collin and Zhang teaches a method for serial modifications of a target locus using a CRISPR-Cas system and different selection markers at each step. The claimed PAM element is taught by Bӧttcher and Evans teaches SEQ ID NO: 3, the gRNA sequence for the neomycin gene resistance. Therefore, it would have been obvious to one with ordinary skills in the art, before the effective filing date of the claimed invention, to have substituted the kanamycin resistance gene taught by Zhang in the system taught by Collin modified by Zhang, with a neomycin resistance cassette and use the sequence taught by Evans to design a specific gRNA for the selection marker. The selection markers are equivalent in their function and neomycin resistance is well known and largely used in the art. One with ordinary skills in the art could have performed this modification with a reasonable expectation of success and arrived at the claimed invention. Claims 22-23, 30 and 31 are rejected under 35 U.S.C. §103 as being unpatentable over Collin (Collin, J. et al. “Concise review: Putting a finger on stem cell biology: Zinc Finger Nuclease-driven targeted genetic editing in human pluripotent stem cells”. Stem Cells, Vol. 29 (2011), pp: 1021-1033; previously cited), in view of Zhang, F. US Patent No. 8,795,965 B2, published August 5, 2014, benefitting from priority of US Application No. 14/183,486 filed February 18, 2014), as applied to claims 1, 21 and 29 above, and in further view of Mombaerts ( Mombaerts, P. et al. Nature, Vol. 360 (1992), pp: 225-231; previously cited) and Kimura (Kimura, N. et al. European Journal of Immunology, Vol. 17 (1987), pp: 375-383; previously cited). The rejection of claims 1, 21 and 29 based on obviousness of the combination of Collin and Zhang have been described above. Regarding claims 22-23, 30 and 31, the combination of Collin and Zhang renders obvious the elements of claims 1, 21 and 29, as presented above, and as required by the claims. The combination of Collin and Zhang does not render obvious a polynucleotide of interest comprising a human polynucleotide, the targeting of a T cell receptor alpha locus or a region encoding a region of a T cell receptor (claim 22), using a first polynucleotide that comprises a joining region gene segment of a T cell receptor alpha locus (claims 23, 30-31). However, Mombaerts teaches the targeting of a TCR alpha locus. Mombaerts teaches a targeting vector pPMKO-1 that comprises 3.9 kb of homologous DNA sequence from TCR α locus in the first exon of TCR Cα and a pgk-neo selectable marker (see figure 1a). Mombaerts teaches that two ES clones were produced carrying a genomic deletion of 15 kb that encompasses the TCR-β (see page 229, Figure 4, right column, lines 5-7). It would have been obvious to one with ordinary skills in the art, before the effective filing date of the claimed invention, to have substituted any gene of interest within the targeting vector of the system taught by Collin modified by Zhang, for a TCR Cα gene and homology arms as taught by Mombaerts. One with ordinary skills in the art, motivated in targeting the TCRα for obtaining a targeting vector usable in gene therapy for immune disorders involving the TCR, could have made this modification with a reasonable expectation of success. Although the combination of Collin and Zhang and Mombaerts does not teach specifically a variable region gene segment and/or a joining region gene segment of a T cell receptor alpha locus, Kimura does teach the sequencing and cloning of variable regions and joining region gene segments in human (see title)(claim 23). Kimura teaches that a joining region is located upstream of the Cα (see figure 1a). Kimura teaches genomic clones that contain both Jα and a Cα genes (see figure 4). Therefore, it would be obvious to extend the homology arms taught by Mombaerts to comprises a human Jα (joining region) gene segment as taught by Kimura, and include the resulting sequence into the targeting vector from the system as taught by Collin/Zhang. The level of skills in the art is high. One with ordinary skills in art, motivated in targeting a region with high genetic diversity and recombination important in human diseases, could have performed this modification with a reasonable expectation of success and arrived at the claimed invention. Response to Arguments Applicant’s arguments with respect to claims 1-3, 5-9, 11, 14-23 and 26-37 have been considered but are moot because the new ground of rejections does not rely on the same combination of references. Regarding arguments against Collin, Applicant's arguments filed 12/12/2025 have been fully considered but they are not persuasive. The instant rejections are made with a combination of Collin and Zhang as primary references. Applicant argues in Remarks on page 14 , challenging Collin as a primary reference and “Principle of Operation”, stating : “The principle of operation of NHEJ-mediated repair (as in Collin's ZFN-mediated targeting of the yellow gene) is entirely different than the nuclease-mediated HDR strategy of the present claims that uses a targeting vector with an insert nucleic acid flanked by homology arms. As further explained in this paragraph of Collin and the preceding paragraph of Collin, NHEJ is an error-prone pathway causing additions or deletions at the break point, which can be used to disrupt genes to generate knockouts. NHEJ works by quickly rejoining the broken DNA ends without needing a homologous template”. In response, Collins reviews the state of the art using ZFNs, and states “This technique has been routinely used for successful and efficient gene targeting in mouse embryonic stem cell (ESC) (with a HR [Homologous Recombination] rate of one in 103 cells [3]) to knock genes in and out and generate transgenic lines…Thus, recent publications demonstrating increased HR efficiency at specific sites using zinc finger nucleases (ZFNs) in many cell types [15-17], including hPSCs [18-22], holds new promise for the stem cell research field.” (see page 1021, “Targeted gene editing in hPSCs” section left column, second paragraph and right column). Also, in the legend of Figure 2 : “Panel (B) portrays gene knockout via HR-mediated insertional mutagenesis of a selection cassette”. Panel (B) is shown on page 1024 and in the rejection above. Regarding Applicant’s arguments on page 16, “3. Impermissible hindsight”, In response to applicant's argument that the examiner's conclusion of obviousness is based upon improper hindsight reasoning, it must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made, and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971). Allowable Subject Matter SEQ ID NO: 17 appears to be free from prior art. Claims 17-18 are objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims. Conclusion No claim is allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALEXANDRA G DACE DENITO whose telephone number is (703)756-4752. The examiner can normally be reached Monday-Friday, 8:30-5:00EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached on 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /A.D./Examiner, Art Unit 1636 /NANCY J LEITH/Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Jul 03, 2024
Application Filed
Feb 07, 2025
Non-Final Rejection — §103
May 12, 2025
Response Filed
Jun 14, 2025
Non-Final Rejection — §103
Sep 17, 2025
Response Filed
Oct 15, 2025
Final Rejection — §103
Dec 12, 2025
Request for Continued Examination
Dec 15, 2025
Response after Non-Final Action
Jan 23, 2026
Non-Final Rejection — §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12570996
Circular RNA For Translation In Eukaryotic Cells
2y 5m to grant Granted Mar 10, 2026
Patent 12529048
DOUBLE KNOCK-OUT CHO CELL LINE METHOD OF ITS GENERATION AND PRODUCING THERAPEUTIC PROTEINS THEREFROM
2y 5m to grant Granted Jan 20, 2026
Patent 12516376
OPTIMIZING BAG3 GENE THERAPY
2y 5m to grant Granted Jan 06, 2026
Patent 12509701
Circular RNA For Translation In Eukaryotic Cells
2y 5m to grant Granted Dec 30, 2025
Patent 12509686
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Dec 30, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

4-5
Expected OA Rounds
54%
Grant Probability
92%
With Interview (+38.1%)
3y 0m
Median Time to Grant
High
PTA Risk
Based on 43 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month