DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 09/05/2025 has been entered.
Application Status
This action is written in response to applicant' s correspondence received 09/05/2025. Claims 3-4, 6-20 and 22 are currently pending. Claims 5 and 21 have been cancelled. Claims 13-20 are withdrawn from prosecution as being drawn to non-elected subject matter. Accordingly, claims 3-4, 6-12 and 22 are examined herein. The restriction requirement mailed 10/04/2024 is still deemed proper. Applicants elected the invention of Group I and the species of SEQ ID NO: 12, a 2’-methoxy modification, snRNA, and hnRNP in the reply filed on 12/04/2024.
Any rejection or objection not reiterated herein has been overcome by amendment. Applicant' s amendments and arguments have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow.
Response to Amendment
The affidavit under 37 CFR 1.132 filed 09/05/2025 to overcome the rejection of claims 6-7 under 35 U.S.C. § 103 as set forth in the last Office action is insufficient because, as also discussed below, while the affidavit provided additional evidence showing differences in the splicing efficiency of the snRNAs disclosed in the instant applicant versus AONs and, together with the remarks of that date, sets forth objective evidence that these efficiencies were higher than might be expected from the disclosures of the prior art, the evidence is not commensurate in scope with what is claimed (MPEP 716.02(d)). Instead, the results were obtained with specific snRNAs (i.e., 28, 29, 33, 34) comprising full, specific recognition sequences (Table 1A) expressed in optimized U7 scaffolds as described in para [0123]. In contrast, the claims more broadly claim any recognition domain “of” the recited SEQ ID NOs, i.e., any region within those sequences which is capable of recognizing a target and inducing splice skipping, and place this recognition domain in a generic U7 snRNA, not the specific, modified scaffold exemplified in the specification and discussed in the affidavit and arguments. The interpretation of the claims is discussed in more detail below.
Additionally, in light of the amendments to the claims and after further consideration, a new prior art rejection was required.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Section 33(a) of the America Invents Act reads as follows:
Notwithstanding any other provision of law, no patent may issue on a claim directed to or encompassing a human organism.
Claim 10 is rejected under 35 U.S.C. 101 and section 33(a) of the America Invents Act as being directed to or encompassing a human organism. See also Animals - Patentability, 1077 Off. Gaz. Pat. Office 24 (April 21, 1987) (indicating that human organisms are excluded from the scope of patentable subject matter under 35 U.S.C. 101). In view of the broadest reasonable interpretation of the term “cell” the cell reads on a cell in a human. The specification discusses using the nucleic acid to treat Usher syndrome in a human (page 1). Thus, if a human has this cell, the human would be embraced by the claim. Amending the claim to recite “An isolated cell” would obviate this rejection.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 3-4, 6 and 8-11 are rejected under 35 U.S.C. 103 as being unpatentable over WIPO Publication 2020/219981 A2 to Wave Life Sciences Ltd. (hereinafter ‘Wave’, of record, applicant’s submission), in view of Gadgil & Raczyńska (U7 snRNA: A tool for gene therapy. J Gene Med. 2021 Feb 23;23(4):e3321.; of record, cited in a previous office action).
A note on claim interpretation: The broadest reasonable interpretation of the term “comprises a recognition domain of any one of SEQ ID NOs: 11-17 and 20-21” encompasses nucleic acids encompassing any region of the sequences represented in those identifiers which may act as a recognition domain (i.e., specifically bind a target nucleic acid in USH2A pre-mRNA). While the specification does not provide a clear, explicit definition of the term “recognition domain”, nor does it specify what level of complementarity is required for a recognition domain to bind USH2A pre-mRNA and induce splice skipping of exon 13, it does provide some guidelines. In [0123], it describes, “replacing the original recognition domain at the 5' end of the SmOPT sequence with a recognition domain reverse complementary paired with the specific target site for USH2A pre-mRNA”. This indicates that the recognition domain has a certain amount of reverse complementarity with a specific target site. As to the recommended length and complementarity, in [0124], the specification indicates that, “The recognition domain sequence of snRNA is preferably 16 bp or more in length, further preferably 18 bp-40 bp in length, and still further preferably 20 bp-27 bp in length.”. In [0068], the specification states that, “there may be 0-5 mismatched nucleotides, e.g., 0-1, in the reverse complementary pairing between a recognition domain and a target site.”.
In light of the specification, a functional recognition domain is interpreted as requiring a sequence that shares at least 16 nt (with 0-5 mismatches) to 40 nt (with 0-5 mismatches) with the recited sequences. Please note that a sequence with fewer than 16 contiguous nucleotides (e.g., 11 nt) in common with the recited sequences would still meet the requirements when accounting for a possible 0-5 mismatches. Also note that, under this interpretation, the recited sequences are not required in their entirety with 100% identity. Rather, all that is required is that the prior art teach or suggest a sequence comprising a recognition domain which is also present in any of SEQ ID NOs: 11-17 and 20-21 and would be expected to perform the recited functions.
Regarding claim 3, Wave teaches a nucleic acid molecule having the ability to specifically bind to an USH2A pre-mRNA to induce splice-skipping of exon 13, wherein the nucleic acid molecule comprises a recognition domain of any of SEQ ID NOs: 11-17 and 20-21:
[0009] In some embodiments, an USH2A oligonucleotide, e.g., one capable of mediating skipping of USH2A exon 13, has a sequence which hybridizes to (e.g., is complementary to a sequence of) an USH2A gene transcript sequence within exon 13, a sequence within an intron immediately adjacent to exon 13 (e.g., intron 12 or intron 13), or a sequence spanning the boundary between USH2A exon 13 and an intron immediately adjacent to exon 13 (e.g., spanning the boundary between exon 13 and intron 12, or the spanning the boundary between exon 13 and intron 13).
Wave further teaches various preferred embodiments of the oligonucleotides, including sequences comprising recognition domains present in SEQ ID NOs: 11-17 and/or 20-21. For example, in para [0010], [00233], and in claim 3, Wave teaches a USH2A oligonucleotide that “comprises at least 10 contiguous bases” or “at least 15 contiguous bases (with 0 to 3 mismatches)” of, “AAUACAUUUCUUUCUUACCU”, “wherein each U may be replaced with T". When accounting for the substitution of T with U, this sequence shares 20 nucleotides with both of instant SEQ ID NOs: 21 and 20 (aatacatttctttcttacct) with 100% identity, and 17 nucleotides with SEQ ID NOs: 15-17 (acatttctttcttacct), also with 100% identity, which all meet the guidelines for a recognition domain. Additionally, oligonucleotide “UACCUGGUUGACACUGAUUA” shares a common recognition sequence with SEQ ID NO: 17 (acctggttgacact), and oligonucleotide “CACCUUCUUCCUUGACGAUU” shares a common recognition sequence common to SEQ ID NOs: 11-13 (accttcttccttgacgatt), as well as a similar recognition sequence in SEQ ID NO: 14 (accttcttccttgac). Therefore, Wave teaches or suggests oligonucleotides comprising various recognition domains present in SEQ ID NOs: 11-17 and 20-21.
Wave further notes (para [0010]), “such an oligonucleotide is an USH2A oligonucleotide which targets a mutant USH2A gene transcript (e.g., an oligonucleotide whose base sequence is complementary to a base sequence in the mutant USH2A target gene transcript)…such an oligonucleotide is capable of mediating skipping of USH2A exon 13…As demonstrated herein, oligonucleotides whose base sequences are or comprise such sequences can be particularly useful.”.
Wave does not teach that the nucleic acid comprising the recognition domain is a U7 small nuclear RNA.
Gadgil & Raczyńska teach, “In U7 Sm OPT-based therapy, an antisense oligonucleotide is incorporated into the U7 snRNA.”. They provide a teaching, suggestion or motivation to incorporate antisense oligonucleotides for splicing manipulation (i.e., exon skipping), such as those taught by Wave, into U7 snRNAs, because (p. 2-3, §1):
as a tool of manipulation of pre-mRNA splicing, antisense oligonucleotides are used in the U7 Sm OPT therapeutic strategy. Although directly using antisense oligonucleotide has certain benefits, it has some limitations because it is sensitive to degradation, may cause immunoreactivity and usually needs repeated dosage. Thus, incorporating antisense oligonucleotides into U7 snRNP and delivering it using viral vectors overcomes many limitations. U7 Sm OPT snRNP is compact in size, accumulates in the nucleus, is non-toxic to the cells and overcomes the issue of repeated administration of oligonucleotides.
Gadgil & Raczyńska further teach that, “modification of the sequence motif of U7 snRNA, which is complementary to HDE within RDH pre-mRNA, can make the snRNP particle hybridize to almost any RNA sequence within the nucleoplasm” (p. 4).
It would have been prima facie obvious to a person having ordinary skill in the art before the effective filing date of the claimed invention to have tried any of the oligonucleotides and recognition domains for binding USH2A pre-MRNA and inducing exon 13 skipping, as taught by Wave. Wave provides a finite number of oligonucleotides which were identified as effective and preferred embodiments. It would further have been obvious to have substituted the specific antisense oligonucleotides capable of specifically binding USH2A pre-mRNA to induce skipping of exon 13, as taught by Wave, into the generic U7 snRNA recognition domain of a U7 snRNA scaffold as taught by Gadgil & Raczyńska, to achieve the predictable outcome of a nucleic acid which was effective at inducing USH2A exon 13 skipping while overcoming the limitations of directly using antisense oligonucleotides.
Regarding claim 4, Wave teaches wherein the nucleic acid molecule comprises at least one modified nucleotide (“one or more modified nucleobases, one or more modified sugars, and/or one or more modified internucleotide linkages” para [00216]). Table A1, starting on page 77, further provides various recommended modification patterns.
Regarding claim 6, Gadgil & Raczyńska teach SEQ ID NO: 5, a U7 Sm OPT sequence, which enables U7 snRNA to be used in gene therapy (p. 4).
Regarding claims 8, 9, 10, Gadgil & Raczyńska teach AAV vectors comprising gene expression cassettes to express the U7 snRNA and oligonucleotide (“The delivery of U7 Sm OPT by AAV is now broadly used because it ensures high efficiency gene transfer and relatively stable expression.”; p. 5).
Regarding claim 11, Gadgil & Raczyńska teaches pharmaceutical compositions comprising the AAV vectors (i.e., AAV vectors administered intravenously to mice, p. 9, or AAV9 U7 snRNA gene therapy to treat human subjects, p. 8).
Claim 7 is rejected under 35 U.S.C. 103 as being unpatentable over Wave and Gadgil & Raczyńska, as applied to claims 3-4, 6 and 8-11 above, further in view of Goyenvalle (Enhanced Exon- skipping Induced by U7 snRNA Carrying a Splicing Silencer Sequence: Promising Tool for DMD Therapy. Molecular Therapy, Volume 17, Issue 7, 1234 - 1240 (2009); of record, cited in a previous office action).
Wave and Gadgil & Raczyńska render obvious the nucleic acid molecule of claim 3, from which claim 7 depends.
Wave and Gadgil & Raczyńska do not teach wherein the nucleic acid molecule comprises a domain capable of binding hnRNP A1, wherein the domain capable of binding to the hnRNP A1 protein comprises the sequence 5’-UAGGU-3’.
Goyenvalle teaches that, "enhanced exon skipping can be induced by a U7 snRNA carrying binding sites for the heterogeneous ribonucleoprotein A1 (hnRNPA1)" (abstract).
Goyenvalle further discloses that the U7 (expression) constructs carrying hnRNPA1 binding sites comprise the DNA sequence corresponding to the binding motif "UAGGGU" (p. 1239 §U7 snRNA constructs design; underline added for clarity):
a 16-nt long nonhybridizing tail carrying high-affinity binding sites for the hnRNP A1 protein (TATGATAGGGACTTAGGGTG)
It would have been prima facie obvious to a person having ordinary skill in the art before the effective filing date of the claimed invention to have modified the U7-based nucleic acid molecule capable of binding USH2A pre-mRNA and inducing exon 13 skipping, as taught by Wave and Gadgil & Raczyńska , to comprise the binding sites and binding site sequences for the hnRNP A1 as taught by Goyenvalle, to achieve the predictable outcome of a nucleic acid molecule with enhanced exon skipping capabilities.
Claims 12 and 22 are rejected under 35 U.S.C. 103 as being unpatentable over Wave and Gadgil & Raczyńska , as applied to claims 3-4, 6 and 8-11 above, further in view of WIPO Patent Publication No. 2016/005514 A1 to Van Wyk (of record, applicant’s submission and cited in previous office action).
Wave and Gadgil & Raczyńska render obvious the nucleic acid molecule of claims 3 and 11, from which claims 12 and 22 depend, as well as a vector comprising it, as discussed above.
Wave and Gadgil & Raczyńska do not teach a kit comprising the nucleic acid molecule, or a pharmaceutical composition comprising, in addition to the first vector, a second vector comprising a nucleic acid molecule having the ability to specifically bind to exon 13 of USH2A pre-mRNA and flanking regions or a fragment thereof, wherein the flanking regions comprise intron 12 and/or intron 13. This is interpreted as encompassing second vectors comprising additional oligonucleotides for exon 13 skipping or retention of desired exons.
Van Wyk teaches a kit comprising the molecule (p. 28 ln 8-10) as well as a composition comprising an exon retaining molecule together with the exon skipping molecule to avoid inadvertent skipping of exon 12:
Skipping of exon 13 may lead to the inadvertent skipping of exon 12 as well. Accordingly, there is provided a retention molecule for exon 12.(p. 18 In 8-9)
Said exon 12 retention molecule according to the invention is preferably combined with an exon skipping molecule according to the invention for skipping of exon 13. (p. 18 In 26-27)
the invention also provides a composition, preferably a pharmaceutical composition, comprising an exon skipping molecule or exon 12 retention molecule according to the invention, or a viral vector according to the invention and a pharmaceutically acceptable excipient. Such composition may comprise a single exon skipping molecule, exon 12 retention molecule or viral vector according to the invention, but may also comprise multiple, distinct exon skipping molecules, exon 12 retention molecules or viral vectors according to the invention. (p. 28 In 15-21)
It would have been prima facie obvious to a person having ordinary skill in the art before the effective filing date of the claimed invention to have modified the composition as taught by Wave and Gadgil & Raczyńska to include additional oligonucleotides and vectors to enhance exon 13 skipping and retain exon 12, as taught by Van Wyk, to achieve the predictable outcome of a composition which avoided negative outcomes via skipping of required exons such as exon 12.
Response to Arguments
Applicant’s arguments with respect to claim(s) 3-4, 6-12 and 22 have been considered but are moot because the new ground of rejection does not rely on any reference applied in the prior rejection of record for any teaching or matter specifically challenged in the argument.
It is also relevant to note that while the arguments addressed differences in the splicing efficiency of the snRNAs disclosed in the instant applicant versus those in the prior art and sets forth that these efficiencies were higher than might be expected from the disclosures of the prior art, the molecules associated with these results are not commensurate in scope with what is claimed (MPEP 716.02(d)). Instead, they concerned specific snRNAs (i.e., 28, 29, 33, 34) comprising specific recognition sequences and U7 scaffolds. In contrast, the claims more broadly claim any U7 snRNA comprising any recognition domain “of” the recited SEQ ID NOs. As discussed above and during the interview of 10/20/2025, this claim language encompasses a much broader genus of nucleic acid molecules and sequences than those specifically exemplified in the specification and discussed in the remarks of 09/05/2025. Therefore, even if the arguments were not moot in light of the new grounds of rejection, they would not be persuasive due to the difference between the breadth of the claims and the evidence provided.
Conclusion
No claim is allowed at this time.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to AMANDA M ZAHORIK whose telephone number is (703)756-1433. The examiner can normally be reached M-F 8:00-16:00 EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/AMANDA M ZAHORIK/Examiner, Art Unit 1636
/BRIAN WHITEMAN/Primary Examiner, Art Unit 1636