Prosecution Insights
Last updated: October 04, 2026
Application No. 18/772,022

ENGINEERED YEAST FOR EFFICIENT AND RAPID SYNTHESIS OF ERYTHRITOL AND CONSTRUCTION METHOD THEREOF

Non-Final OA §102§103§112§DP
Filed
Jul 12, 2024
Priority
Jan 22, 2024 — CN 202410087435.8
Examiner
SHELTON, SYNPHANE LA'SHAWN
Art Unit
Tech Center
Assignee
Shanghai Jiao Tong University
OA Round
1 (Non-Final)
100%
Grant Probability
Favorable
1-2
OA Rounds
1y 3m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 100% — above average
100%
Career Allowance Rate
2 granted / 2 resolved
+40.0% vs TC avg
Minimal +0% lift
Without
With
+0.0%
Interview Lift
resolved cases with interview
Typical timeline
3y 5m
Avg Prosecution
43 currently pending
Career history
24
Total Applications
across all art units

Statute-Specific Performance

§101
1.9%
-38.1% vs TC avg
§103
40.6%
+0.6% vs TC avg
§102
14.4%
-25.6% vs TC avg
§112
28.1%
-11.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 2 resolved cases

Office Action

§102 §103 §112 §DP
DETAILED ACTION Status of Application Claims 1-20 are pending The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Applicant’s election with traverse of Invention I, claims 1-5, drawn to an engineered yeast for efficient and rapid synthesis of erythritol, obtained by introducing genes related to the synthesis of erythritol by using a Yarrowia lipolytica strain as a chassis microorganism, as submitted in communication filed on 07/18/2026 is acknowledged. Applicant’s traverse is on the grounds that the requirement is improper because the inventions share the same core inventive concept. Applicants’ arguments have been fully considered but not deemed persuasive to withdraw the restriction requirement. It is noted that the restriction requirement is needed under 35 USC §121 and not under 35 USC § 372 because the instant application is not a 371 US national application. In view of the instant application being a 35 USC 111 (a) application, the basis for the restriction requirement is set forth in MPEP § 803 (I) and not on whether the claimed inventions share the same core inventive concept. The restriction analysis is based on whether the inventions are patentably distinct and whether there would be a serious search and/or examination burden on the Examiner if restriction is not required. The Examiner previously provided the reason why the inventions are independent and patently distinct in the restriction requirement mailed on 06/01/2026.Therefore, contrary to Applicant’s assertions, a comprehensive search of all the claims would require sequence and class/subclass searches which are not necessarily co-extensive as well as different keyword searches in the patent/non-patent literature. Thus, an examination of all the claimed inventions would impose an undue burden on the Office. The restriction requirement is deemed proper and therefore is made FINAL. As to the species election, the Applicant elected Yarrowia lipolytica strain CGMCC No. 28807 and elected the combination of all ten gene groups (1)-(10) as a single functional unit. Applicant’s traverse is on the grounds that the genes listed in Species Group 2 are indispensable and must function synergistically. Applicants’ arguments have been fully considered and are deemed persuasive to withdraw the species election requirement for Species Group 2. Also, upon further consideration the species election requirement for Species Group 1 is withdrawn. Claims 1-5 are at issue and will be examined to the extent they encompass the elected invention. Priority Acknowledgment is made of a claim for foreign priority under 35 U.S.C. 119(a)-(d) to CHINA 202410087435.8 filed on 01/22/2024. Receipt is acknowledged of papers submitted under 35 U.S.C. 119(a)-(d), which papers have been placed of record in the file. Drawings The drawings submitted on 07/12/2024 have been reviewed and are accepted by the examiner for examination purposes. Claim Objection Claims 2 and 4 are objected to due to the terms “SEQ ID No. X”. It should be amended to recite “SEQ ID NO: X”. Appropriate correction is required. Claim 4 is objected to due to the labels (1)-(10). To avoid confusion with the Arabic numerals in the numbering of the claims the labels (1)-(10) should be amended to (i)-(x) or (a)-(j). Appropriate correction is required. Claim 5 is objected to due to the recitation of “wherein the engineered yeast is a Yarrowia lipolytica strain with a deposition number of CGMCC No.28807”. It should be amended to recite “wherein the engineered yeast is a Yarrowia lipolytica strain has the deposit number CGMCC No. 28807”. Appropriate correction is required. Claim Rejections - 35 USC § 112(b) or Second Paragraph (pre-AIA ) The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1-5 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 1 (claims 2-5 dependent thereon) is indefinite in the recitation of “yeast for efficient and rapid synthesis of erythritol”, for the following reason: The terms “efficient” and “rapid” in claim 1 are relative terms which renders the claim indefinite. The term terms “efficient” and “rapid” are not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. Therefore, the degree of erythritol synthesis is unclear in this case. Correction is required. Claim 2 is indefinite in the recitation of “sequence having 97% or more homology”, for the following reason: The term “97% or more homology” is unclear and confusing in the absence of a definition providing the intended meaning of the term or the intended parameters required to determine the required homology value. While one could argue that the term “homology” can be interpreted as “identity”, as known in the art, these terms are not equivalent. The calculation of sequence homology takes into consideration the type of mismatches, i.e. even mismatches contribute to the % homology value, whereas mismatches do not have any weight in the calculation of sequence identity, i.e. only exact matches contribute to the % identity value. Thus, if there is no indication that the term “homology” is intended to mean “identity”, and the specification does not provide the specific parameters intended in the calculation of sequence homology (e.g., PAM matrices), one of skill in the art cannot determine the scope of the term “97% or more homology” because one could have a nucleic acid sequence which is 97% sequence homologous to a reference sequence based on a particular matrix/set of parameters, and at the same time, not 97% sequence homologous to the same reference sequence if other matrices/parameters are used. Furthermore, the term “…homology or similarity to a sequence of SEQ ID NO: 1” is indefinite because “a sequence of SEQ ID NO: 1” can be interpreted as a fragment of SEQ ID NO: 1 (a sequence within SEQ ID NO: 1). Therefore, it is unclear if the homology or similarity is with respect to the entire sequence of SEQ ID NO: 1 or with respect to a fragment of SEQ ID NO: 1. For examination purposes, homology will be interpreted as identity and “a sequence of SEQ ID NO: 1” will be interpreted as the full sequence of SEQ ID NO: 1 or a fragment of SEQ ID NO: 1 (a sequence within SEQ ID NO: 1). Correction is required. Claim 3 is indefinite due to the term “wherein the Yarrowia lipolytica strain comprises any one of…” for the following reasons: It is unclear as to how a unicellular organism can comprise a Yarrowia lipolytica strain. If the intended limitation is “wherein the Yarrowia lipolytica strain is any one of…”, the claim should be amended accordingly. Correction is required. Claim 4 is indefinite in the recitation of “genes glucose transporter proteins....genes erythritol synthases” because it is unclear as to how genes can be proteins. If the intended limitation is “genes encoding glucose transporter proteins....genes encoding erythritol synthases”, the claim should be amended accordingly. Correction is required. Claim 4 is indefinite in the recitation of “genes…as shown in SEQ ID NO: X” for the following reasons. The term “as shown” can be interpreted as exemplary language (e.g., like SEQ ID NO: X). Therefore, it is unclear if the genes are required to comprise SEQ ID NO: X or if the genes are required to comprise a sequence like SEQ ID NO: X. If the intended limitation is “genes…comprising SEQ ID NO: X”, the claim should be amended accordingly. Correction is required. Claim 4 is indefinite due to the term “genes encoding growth factors ... SEQ ID NO: 16” being unclear since there is only one sequence recited. If the term refers to a single gene, the claim should be amended accordingly. Correction is required. Claim 4 is indefinite due to the term “genes encoding growth…. factors…SEQ ID NO: 17” being unclear since there is only one sequence recited. If the term refers to a single gene, the claim should be amended accordingly. Correction is required. Claim Rejections - 35 USC § 112(a) or First Paragraph (pre-AIA ) The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1-4 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention. As stated in MPEP 2111.01, during examination, the claims must be interpreted as broadly as their terms reasonably allow. Claims 1-3 are directed in part to a genus of yeasts that have been modified by any means to produce erythritol. Claim 4 requires only one of the genes listed in (1)-(10) which is not sufficient to produce erythritol. While the specification in the instant application discloses a means to synthesize erythritol by using all the genes listed in (1)-(10) of claim 4, it provides no clue as to the modifications necessary to modify a genus of Yarrowia lipolytica strains by any means to synthesize erythritol or by using only one of the genes listed in (1)-(10) of claim 4. In the instant case, there are no recited modifications which are representative of all the modifications necessary to modify a genus of Yarrowia lipolytica strains by any means, or by using only one of the genes listed in (1)-(10) of claim 4, to synthesize erythritol. Furthermore, while one could argue that the modifications disclosed are representative of all the modifications necessary to modify a genus of Yarrowia lipolytica strains to synthesize erythritol, it is noted that the art teaches several examples of yeast strain modifications to synthesize erythritol using combinations of different genes. For example, Cheng et al. (CN 111363759 A published 07/03/2020; hereby “Cheng”) teach the overexpression of multiple genes in Yarrowia lipolytica to preform erythritol synthesis, in addition to genes being knocked out to block or reduce the synthesis of by-products to make the effect of synthesizing erythritol more significant (Page 5-6, section: (2)Transformation of integrated expression vector containing the target gene). Therefore, since there are a multitude of modifications that can be made on Yarrowia lipolytica to perform erythritol synthesis, one cannot reasonably conclude that the modifications disclosed are representative of all the modifications required by the claims. Due to the fact that the specification only discloses a means to synthesize erythritol by using all the genes listed in (1)-(10) of claim 4, and the lack of description of any other modifications relevant to synthesize erythritol rapidly, one of skill in the art would not recognize from the disclosure that Applicant was in possession of the claimed invention. Claims 1-4 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for an engineered Yarrowia lipolytica for synthesis of erythritol by using all the genes listed in (1)-(10) of claim 4, does not reasonably provide enablement for modifying a genus of Yarrowia lipolytica strains by any means, or by using only one of the genes listed in (1)-(10) of claim 4, to synthesize erythritol. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention commensurate in scope with these claims. Factors to be considered in determining whether undue experimentation is required are summarized in In re Wands (858 F.2d 731, 737, 8 USPQ2nd 1400 (Fed. Cir. 1988)) as follows: 1) quantity of experimentation necessary, 2) the amount of direction or guidance presented, 3) the presence and absence of working examples, 4) the nature of the invention, 5) the state of prior art, 6) the relative skill of those in the art, 7) the predictability or unpredictability of the art, and 8) the breadth of the claims. The factors which have led the Examiner to conclude that the specification fails to teach how to make and/or use the claimed invention without undue experimentation, are addressed in detail below. The breadth of the claims. Claims 1-4 broadly encompass a genus of Yarrowia lipolytica strains modified by any means to synthesize erythritol or modified by using only one of the genes listed in (1)-(10) of claim 4 to synthesize erythritol rapidly. The enablement provided is not commensurate in scope with the claims due to the lack of information as to the modifications required in Yarrowia lipolytica strains to synthesize erythritol rapidly using only one of the genes listed in (1)-(10) of claim 4. In the instant case, the specification enables an engineered Yarrowia lipolytica strain for the rapid synthesis of erythritol by using all the genes listed in (1)-(10) of claim 4 together. The amount of direction or guidance presented and the existence of working examples. The specification discloses engineered Yarrowia lipolytica strains for the synthesis of erythritol by using all the genes listed in (1)-(10) of claim 4 together. However, the specification fails to provide any clue as to the modifications required in any Yarrowia lipolytica strains modified by any means to produce erythritol and fails to show only one gene from (1)-(10) being used to produce erythritol rapidly. The state of prior art, the relative skill of those in the art, and the predictability or unpredictability of the art. While the art discloses a limited number of Yarrowia lipolytica strain modifications, one of skill in the art cannot envision Yarrowia lipolytica strains that can be modified by any means to rapidly produce erythritol. The quantity of experimentation required to practice the claimed invention based on the teachings of the specification. While methods for producing erythritol with yeast strains were known in the art at the time of the invention, it was not routine in the art to screen by a trial and error process for an essentially infinite number of modifications to find the modifications that can be used as claimed. In the absence of (i) a rational and predictable scheme for selecting those modifications most likely to have the desired result, and/or (ii) a correlation between Yarrowia lipolytica modifications and rapid erythritol synthesis, one of skill in the art would have to test an essentially infinite number of modifications to determine which ones have the desired results. Therefore, taking into consideration the extremely broad scope of the claims, the lack of guidance, the amount of information provided, the lack of knowledge about a correlation between modifications and erythritol synthesis, and the high degree of unpredictability of the prior art in regard to yeast modifications and their effect on erythritol synthesis, one of ordinary skill in the art would have to go through the burden of undue experimentation in order to practice the claimed invention. Thus, Applicant has not provided sufficient guidance to enable one of ordinary skill in the art to make and use the invention in a manner reasonably correlated with the scope of the claims. Claims 3 and 5 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention. The invention appears to employ strains (i.e., Yarrowia lipolytica A, B, C and D). Since the strains are essential to the claimed invention, they must be obtainable by a repeatable method set forth in the specification or otherwise be readily available to the public. The claimed strains do not appear to be publicly known and freely available. The enablement requirements of 35 U.S.C. § 112 may be satisfied by a deposit of the strains. The specification does not disclose a repeatable process to obtain the strains, and it is not apparent if the strains are readily available to the public. Accordingly, it is deemed that a deposit of these strains should have been made in accordance with 37 CFR 1.801-1.809. It appears that Applicant has deposited the strains but there is no indication in the specification as to public availability. If the deposit was made under the terms of the Budapest Treaty, then an affidavit or declaration by applicants, or a statement by an attorney of record over his or her signature and registration number, stating that the specific strains have been deposited under the Budapest Treaty and that the strains will be available to the public under the conditions specified in 37 CFR 1.808, would satisfy the deposit requirement made herein. If the deposit has not been made under the Budapest treaty, then in order to certify that the deposit meets the criteria set forth in 37 CFR 1.801-1.809, applicants may provide assurance or compliance by an affidavit or declaration, or by a statement by an attorney of record over his or her signature and registration number, showing that: a. during the pendency of this application, access to the invention will be afforded to the Commissioner upon request; b. upon granting of the patent the strains will be available to the public under the conditions specified in 37 CFR 1.808; c. the deposit will be maintained in a public repository for a period of 30 years or 5 years after the last request or for the effective life of the patent, whichever is longer; and d. the deposit will be replaced if it should ever become unviable. Claim Rejections - 35 USC § 102 (AIA ) The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claims 1-3 are rejected under 35 U.S.C. 102(a)(1) and 102(a)(2) as being anticipated by Cheng et al. (CN 111363759 A published 07/03/2020; hereby “Cheng”). The examiner will use the English translation provided when referring to specific teachings relevant to the instant claims. Claims 1-3 as interpreted are directed in part to an engineered yeast for synthesis of erythritol, obtained by introducing genes related to the synthesis of erythritol by using a Yarrowia lipolytica strain as a chassis microorganism; wherein the Yarrowia lipolytica strain has a genome containing a deoxyribonucleic acid (DNA) sequence having 97% or more identity or similarity to a sequence of SEQ ID No.1 and is capable of synthesizing erythritol wherein the Yarrowia lipolytica strain comprises any one of Yarrowia lipolytica CGMCC 7326, Yarrowia lipolytica ery929 CGMCC No.18478, and Yarrowia lipolytica ery929 CGMCC No.19351. Regarding claim 1, Cheng teaches a method for constructing a recombinant Yarrowia lipolytica strain capable of synthesizing erythritol of the present invention includes expressing one or more of the following genes in the cells of the chassis microorganism Yarrowia lipolytica: (1) Gene encoding Hexokinase (HK); (2) Genes encoding transketolase (TKL1); (3) Genes encoding transaldolase (TAL); (4)A gene encoding 4-phosphate-erythrose phosphorylase (Erythrose 4-P phosphatase, EryPase) (Page 3, Scheme 3). Regarding claims 2 and 3, Cheng teaches that the chassis microbial Yarrowia lipolytica contains a DNA sequence with 97% or more homology or similarity with SEQ ID No.1 in the genome, and can synthesize Yarrowia lipolytica strains of erythritol, such as Yarrowia lipolytica CGMCC 7326 and Yarrowia lipolytica ery929 CGMCC No. 18478. It is noted that SEQ ID No.1 of Cheng and SEQ ID No:1 of this instant case has 100% sequence identity. See alignment below. Therefore, the teachings of Cheng anticipate the instant claims as written/interpreted. RESULT 1 BIA87823 (NOTE: this sequence has 4 duplicates in the database searched) ID BIA87823 standard; DNA; 1397 BP. XX AC BIA87823; XX DT 03-SEP-2020 (first entry) XX DE Yarrowia lipolytica derived nucleotide sequence, SEQ 1. XX KW ds; fermentation; genetically engineered microorganism. XX OS Yarrowia lipolytica; ery929-4 delta. XX CC PN CN111363759-A. XX CC PD 03-JUL-2020. XX CC PF 21-JAN-2020; 2020CN-10069250. XX PR 21-JAN-2020; 2020CN-10069250. XX CC PA (USJT ) UNIV SHANGHAI JIAOTONG. XX CC PI Cheng H, Wang N, Chi P; XX DR WPI; 2020-640760/059. XX CC PT Constructing recombinant Yarrowia lipolytica strain capable of CC PT synthesizing erythritol comprises using Yarrowia lipolytica strain as CC PT chassis microorganism and constructing recombinant strain using e.g. CC PT glucose as carbon source. XX CC PS Claim 2; SEQ ID NO 1; 64pp; Chinese. XX CC The present invention relates to a novel method for constructing a CC recombinant Yarrowia lipolytica strain capable of synthesizing CC erythritol. The method comprises using Yarrowia lipolytica strain as CC chassis microorganism and constructing recombinant strain using e.g., CC glucose as carbon source. The invention further relates to a method for CC fermenting and synthesizing erythritol using the recombinant Yarrowia CC lipolytica strain. XX SQ Sequence 1397 BP; 380 A; 290 C; 386 G; 341 T; 0 U; 0 Other; Query Match 100.0%; Score 1397; Length 1397; Best Local Similarity 100.0%; Matches 1397; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 CAGATCTTGGTGGTAGTAGCAAATATTCAAATGAGAACTTTGAAGACTGAAGTGGGGAAA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 CAGATCTTGGTGGTAGTAGCAAATATTCAAATGAGAACTTTGAAGACTGAAGTGGGGAAA 60 Qy 61 GGTTCCGTGTGAACAGCAGTTGGACACGGGTAAGTCGATCCTAAGGGGTGGCATAACTGT 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 GGTTCCGTGTGAACAGCAGTTGGACACGGGTAAGTCGATCCTAAGGGGTGGCATAACTGT 120 Qy 121 CGCGTACGGCCCGATAAGGGCCTTCTCCAAAAGGGAAGCCGGTTGAAATTCCGGCACTTG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 CGCGTACGGCCCGATAAGGGCCTTCTCCAAAAGGGAAGCCGGTTGAAATTCCGGCACTTG 180 Qy 181 GATGTGGATTCTCCACGGCAACGTAACTGAATGTGGGGACGGTGGCACAAGTCTTGGAAG 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 GATGTGGATTCTCCACGGCAACGTAACTGAATGTGGGGACGGTGGCACAAGTCTTGGAAG 240 Qy 241 GAGTTATCTTTTCTTTTTAACGGAGTCAACACCCTGGAATTAGTTTGTCTAGAGATAGGG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 GAGTTATCTTTTCTTTTTAACGGAGTCAACACCCTGGAATTAGTTTGTCTAGAGATAGGG 300 Qy 301 TATCGTTCCGGAAGAGGGGGGCAGCTTTGTCCCCTCCGATGCACTTGTGACGCCCCTTGA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 TATCGTTCCGGAAGAGGGGGGCAGCTTTGTCCCCTCCGATGCACTTGTGACGCCCCTTGA 360 Qy 361 AAACCCGCAGGAAGGAATAGTTTTCACGCCAAGTCGTACTGATAACCGCAGCAGGTCTCC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 AAACCCGCAGGAAGGAATAGTTTTCACGCCAAGTCGTACTGATAACCGCAGCAGGTCTCC 420 Qy 421 AAGGTGAACAGCCTCTAGTTGATAGAATAATGTAGATAAGGGAAGTCGGCAAAATAGATC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 AAGGTGAACAGCCTCTAGTTGATAGAATAATGTAGATAAGGGAAGTCGGCAAAATAGATC 480 Qy 481 CGTAACTTCGGGATAAGGATTGGCTCTGGGGGTTGGTGGATGGAAGCGTGGGAGACCCCA 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 CGTAACTTCGGGATAAGGATTGGCTCTGGGGGTTGGTGGATGGAAGCGTGGGAGACCCCA 540 Qy 541 AGGGACTGGCAGCTGGGCAACTGGCAGCCGGACCCGCGGCAGACACTGCGTCGCTCCGTC 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 AGGGACTGGCAGCTGGGCAACTGGCAGCCGGACCCGCGGCAGACACTGCGTCGCTCCGTC 600 Qy 601 CACATCATCAACCGCCCCAGAACTGGTACGGACAAGGGGAATCTGACTGTCTAATTAAAA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 CACATCATCAACCGCCCCAGAACTGGTACGGACAAGGGGAATCTGACTGTCTAATTAAAA 660 Qy 661 CATAGCTTTGCGATGGTTGTAAAACAATGTTGACGCAAAGTGATTTCTGCCCAGTGCTCT 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 CATAGCTTTGCGATGGTTGTAAAACAATGTTGACGCAAAGTGATTTCTGCCCAGTGCTCT 720 Qy 721 GAATGTCAAAGTGAAGAAATTCAACCAAGCGCGCGGGTAAACGGCGGGAGTAACTATGCT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 GAATGTCAAAGTGAAGAAATTCAACCAAGCGCGCGGGTAAACGGCGGGAGTAACTATGCT 780 Qy 781 CTCTTAAGGTAGCCAAATGCCTCGTCATCTAATTAGTGACGCGCATGAATGGATTAACGA 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 CTCTTAAGGTAGCCAAATGCCTCGTCATCTAATTAGTGACGCGCATGAATGGATTAACGA 840 Qy 841 GATTCCCACTGTCCCTATCTACTATGTAGCGAAACCACAGCCAAGGGAACGGGCTTGGCA 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 GATTCCCACTGTCCCTATCTACTATGTAGCGAAACCACAGCCAAGGGAACGGGCTTGGCA 900 Qy 901 GAATCAGCGGGGAAAGAAGACCCTGTTGAGCTTGACTCTAGTTTGACATTGTGAAGAGAC 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 GAATCAGCGGGGAAAGAAGACCCTGTTGAGCTTGACTCTAGTTTGACATTGTGAAGAGAC 960 Qy 961 ATAGGGGGTGTAGAATAAGTGGGAGCTTCGGCGCCGGTGAAATACCACTACCCTTATCGT 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 ATAGGGGGTGTAGAATAAGTGGGAGCTTCGGCGCCGGTGAAATACCACTACCCTTATCGT 1020 Qy 1021 TTCTTTACTTATTTAGTAAGTGGAAGTGGTTTAACAACCATTTTCTAGCATTCCTTTCCA 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1021 TTCTTTACTTATTTAGTAAGTGGAAGTGGTTTAACAACCATTTTCTAGCATTCCTTTCCA 1080 Qy 1081 GGCTGAAGACATTGTCAGGTGGGGAGTTTGGCTGGGGCGGCACATCTGTTAAAAGATAAC 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1081 GGCTGAAGACATTGTCAGGTGGGGAGTTTGGCTGGGGCGGCACATCTGTTAAAAGATAAC 1140 Qy 1141 GCAGATGTCCTAAGGGGGACTCAATGAGAACAGAAATCTCATGTAGAACAAAAGGGTAAA 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1141 GCAGATGTCCTAAGGGGGACTCAATGAGAACAGAAATCTCATGTAGAACAAAAGGGTAAA 1200 Qy 1201 AGTCCCCTTGATTTTGATTTTCAGTGTGAATACAAACCATGAAAGTGTGGCCTATCGATC 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1201 AGTCCCCTTGATTTTGATTTTCAGTGTGAATACAAACCATGAAAGTGTGGCCTATCGATC 1260 Qy 1261 CTTTAGTTGTTCGGAGTTTGAACCTAGAGGTGCCAGAAAAGTTACCACAGGGATAACTGG 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1261 CTTTAGTTGTTCGGAGTTTGAACCTAGAGGTGCCAGAAAAGTTACCACAGGGATAACTGG 1320 Qy 1321 CTTGTGGCAGTCAAGCGTTCATAGCGACATTGCTTTTTGATCCTTCGATGTCGGCTCTTC 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1321 CTTGTGGCAGTCAAGCGTTCATAGCGACATTGCTTTTTGATCCTTCGATGTCGGCTCTTC 1380 Qy 1381 CTATCATACCGAAGCAG 1397 ||||||||||||||||| Db 1381 CTATCATACCGAAGCAG 1397 Claim Rejections - 35 USC § 103 (AIA ) The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. Claim 4 is rejected under 35 U.S.C. 103 as being unpatentable over Cheng et al. (CN 111363759 A published 07/03/2020; hereby “Cheng”), in view of Caimi et al. (US 20120156746 A1 published 07/03/2020; hereby “Caimi”). The teachings of Cheng are discussed above. Claim 4 as interpreted is directed in part to the engineered yeast of claim 1; wherein the genes related to the synthesis of erythritol comprise one or more of the following genes: SEQ ID NO 2-17. Regarding claim 4, Cheng teaches that there are several other enzyme genes in the pathway of synthesizing erythritol, such as 5-phosphoribulose isomerase gene (RPI) (Page 20 [1]). Cheng teaches overexpression of RPI (Page 20 [1]). Cheng does not teach that the expression of RPI having the sequence of SEQ ID NO 10. Caimi teaches ethanol producing, recombinant xylose-utilizing Zymomonas or Zymobacter cells that are engineered to have increased ribose-5-phosphate isomerase (RPI) activity; wherein the increase of RPI activity improves cell growth ([0007]). Caimi discloses the sequences encoding RPI-A proteins, that may be used in microorganisms, which include SEQ ID NOs: 2108 through 3237 ([0096]). It is noted that SEQ ID NO: 2741 of Caimi and SEQ ID NO: 10 of the instant case have 100% identity. Query Match 100.0%; Score 732; Length 732; Best Local Similarity 100.0%; Matches 732; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ATGTCCTCCGAACTGCCTCCTCTTGAGCAGGCCAAGCGAATCGCCGCCCACCAGGCCGTG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 ATGTCCTCCGAACTGCCTCCTCTTGAGCAGGCCAAGCGAATCGCCGCCCACCAGGCCGTG 60 Qy 61 GAGCAACACTACCCCAAGGACGCCAAGGTCGTGGGCATTGGCTCAGGATCCACCGTGGTC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 GAGCAACACTACCCCAAGGACGCCAAGGTCGTGGGCATTGGCTCAGGATCCACCGTGGTC 120 Qy 121 TACGTTGCCGAGAAGATTGCGTCGTTGCCCAAGGAGCTCACCAAGGACACCGTGTTCATT 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 TACGTTGCCGAGAAGATTGCGTCGTTGCCCAAGGAGCTCACCAAGGACACCGTGTTCATT 180 Qy 181 TCTACGGGTTTCCAGAGCAAGCAGCTGATCCAGAACGCCGGGTTGCGACTGGGATGCATC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 TCTACGGGTTTCCAGAGCAAGCAGCTGATCCAGAACGCCGGGTTGCGACTGGGATGCATC 240 Qy 241 GACCAGTACTCCAACGGAGATCTGGACGTGGCGTTTGACGGCGCCGACGAGACCGACCCT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 GACCAGTACTCCAACGGAGATCTGGACGTGGCGTTTGACGGCGCCGACGAGACCGACCCT 300 Qy 301 CAGCTCAACTGCATCAAGGGCGGAGGAGCATGCCTCTTCCAGGAAAAGATTGTCGCCGAG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 CAGCTCAACTGCATCAAGGGCGGAGGAGCATGCCTCTTCCAGGAAAAGATTGTCGCCGAG 360 Qy 361 TGTGCCCGCAAGTTTGTCGTGGTGGCCGACTACCGAAAACAGTCCAAGGCTCTGGGCACC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 TGTGCCCGCAAGTTTGTCGTGGTGGCCGACTACCGAAAACAGTCCAAGGCTCTGGGCACC 420 Qy 421 GTGTGGATCCAGGGTATCCCCATTGAGGTGGTGCCCGACGCCTACAACAAGGTAATTGCT 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 GTGTGGATCCAGGGTATCCCCATTGAGGTGGTGCCCGACGCCTACAACAAGGTAATTGCT 480 Qy 481 GATCTCAAGAAGATGGGCGCCCAGTCCGCGGTGCTGCGACCCGGCTCTCCCGGAAAGGCG 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 GATCTCAAGAAGATGGGCGCCCAGTCCGCGGTGCTGCGACCCGGCTCTCCCGGAAAGGCG 540 Qy 541 GGCCCCATCATCACCGACAATGGCAACTTCATTGTCGACGCCTACTTTGGCGAGATCCAA 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 GGCCCCATCATCACCGACAATGGCAACTTCATTGTCGACGCCTACTTTGGCGAGATCCAA 600 Qy 601 CCCGACGCCGTCAAGGACCTGCACATCAAGATCAAGCTGCTGTTGGGCGTCGTTGAGACC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 CCCGACGCCGTCAAGGACCTGCACATCAAGATCAAGCTGCTGTTGGGCGTCGTTGAGACC 660 Qy 661 GGCCTCTTCACTAACGCGGACGTAGCGTACTTTGGAAACGCCGACGGAACCATCTCCACC 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 GGCCTCTTCACTAACGCGGACGTAGCGTACTTTGGAAACGCCGACGGAACCATCTCCACC 720 Qy 721 ATTACCAAGTAA 732 |||||||||||| Db 721 ATTACCAAGTAA 732 It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the engineered yeast of Cheng to by using the RPI taught in Caimi. A person of ordinary skill in the art is motivated to combine the teaching of Cheng and Caimi because the RPIs used in Caimi increase cell growth. Accordingly, one of ordinary skill would be motivated to use the RPIs in Caimi to improve the cell growth of the microorganisms taught in Cheng, thus increasing the synthesis of erythritol. One of ordinary skill in the art has a reasonable expectation of success at arriving to combining the teachings of Cheng and Caimi because all that is required incorporating the RPI of Caimi into the engineered yeast of Cheng. Therefore, the invention as a whole would have been prima facie obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1-2 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-2 of copending Application No. 17/737012 (US 20220259622 A1 published 08/18/2022). Although the claims at issue are not identical, they are not patentably distinct from each other because claims 1-2, of the instant case, as interpreted are directed in part to an engineered yeast for synthesis of erythritol, obtained by introducing genes related to the synthesis of erythritol by using a Yarrowia lipolytica strain as a chassis microorganism; wherein the Yarrowia lipolytica strain has a genome containing a deoxyribonucleic acid (DNA) sequence having 97% or more similarity to a sequence of SEQ ID No.1 and is capable of synthesizing erythritol. Claim 1 of US 20220259622 A1 as interpreted is directed in part to a construction method of recombinant Yarrowia lipolytica strain capable of synthesizing xylitol, comprising adopting the Yarrowia lipolytica strain capable of synthesizing erythritol as the host microorganism, by means of metabolic engineering or genetic engineering, to construct the recombinant Yarrowia lipolytica strain that synthesizes xylitol by fermentation with one carbon source or more carbon sources, including glucose, fructose, glycerol, or starch as carbon sources; the metabolic engineering or genetic engineering strategies include the expression of a gene encoding xylitol dehydrogenase and a gene encoding 5-p xylitol dehydrogenase in the cell of Yarrowia lipolytica from the host microorganisms, and the knockout or down-regulation of the transketolase gene in Yarrowia lipolytica. Claim 2 of US 20220259622 A1 as interpreted is directed in part to the construction method as set forth in claim 1 of US 20220259622 A1, wherein the host microorganism is the Yarrowia lipolytica strain whose genome contains DNA sequences with 97% or above identity with SEQ ID NO.3 sequence. SEQ ID NO.3 of US 20220259622 A1 and SEQ ID NO: 1 of this instant case have 98.9% identity. See alignment below. Therefore, the claims at issue are patentably indistinct from each other. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. RESULT 4 US-17-737-012-3 Sequence 3, US/17737012 Publication No. US20220259622A1 GENERAL INFORMATION APPLICANT: Shanghai Jiao Tong University TITLE OF INVENTION: Construction method and recombinant yeast stain Yarrowia TITLE OF INVENTION: lipolytica for xylitol synthesis FILE REFERENCE: KAG38307 CURRENT APPLICATION NUMBER: US/17/737,012 CURRENT FILING DATE: 2022-05-04 NUMBER OF SEQ ID NOS: 79 SEQ ID NO 3 LENGTH: 1402 TYPE: DNA ORGANISM: Yarrowia lipolytica Query Match 98.9%; Score 1381; Length 1402; Best Local Similarity 99.3%; Matches 1387; Conservative 0; Mismatches 10; Indels 0; Gaps 0; Qy 1 CAGATCTTGGTGGTAGTAGCAAATATTCAAATGAGAACTTTGAAGACTGAAGTGGGGAAA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 6 CAGATCTTGGTGGTAGTAGCAAATATTCAAATGAGAACTTTGAAGACTGAAGTGGGGAAA 65 Qy 61 GGTTCCGTGTGAACAGCAGTTGGACACGGGTAAGTCGATCCTAAGGGGTGGCATAACTGT 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 66 GGTTCCGTGTGAACAGCAGTTGGACACGGGTAAGTCGATCCTAAGGGGTGGCATAACTGT 125 Qy 121 CGCGTACGGCCCGATAAGGGCCTTCTCCAAAAGGGAAGCCGGTTGAAATTCCGGCACTTG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 126 CGCGTACGGCCCGATAAGGGCCTTCTCCAAAAGGGAAGCCGGTTGAAATTCCGGCACTTG 185 Qy 181 GATGTGGATTCTCCACGGCAACGTAACTGAATGTGGGGACGGTGGCACAAGTCTTGGAAG 240 |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| Db 186 GATGTGGATTCTCCACGGCAACTTAACTGAATGTGGGGACGGTGGCACAAGTCTTGGAAG 245 Qy 241 GAGTTATCTTTTCTTTTTAACGGAGTCAACACCCTGGAATTAGTTTGTCTAGAGATAGGG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 246 GAGTTATCTTTTCTTTTTAACGGAGTCAACACCCTGGAATTAGTTTGTCTAGAGATAGGG 305 Qy 301 TATCGTTCCGGAAGAGGGGGGCAGCTTTGTCCCCTCCGATGCACTTGTGACGCCCCTTGA 360 |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| Db 306 TATCGTTCAGGAAGAGGGGGGCAGCTTTGTCCCCTCCGATGCACTTGTGACGCCCCTTGA 365 Qy 361 AAACCCGCAGGAAGGAATAGTTTTCACGCCAAGTCGTACTGATAACCGCAGCAGGTCTCC 420 |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| Db 366 AAACCCGCAGGAAGGAATAGTTTTCACGCCAAGTCGCACTGATAACCGCAGCAGGTCTCC 425 Qy 421 AAGGTGAACAGCCTCTAGTTGATAGAATAATGTAGATAAGGGAAGTCGGCAAAATAGATC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 426 AAGGTGAACAGCCTCTAGTTGATAGAATAATGTAGATAAGGGAAGTCGGCAAAATAGATC 485 Qy 481 CGTAACTTCGGGATAAGGATTGGCTCTGGGGGTTGGTGGATGGAAGCGTGGGAGACCCCA 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 486 CGTAACTTCGGGATAAGGATTGGCTCTGGGGGTTGGTGGATGGAAGCGTGGGAGACCCCA 545 Qy 541 AGGGACTGGCAGCTGGGCAACTGGCAGCCGGACCCGCGGCAGACACTGCGTCGCTCCGTC 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 546 AGGGACTGGCAGCTGGGCAACTGGCAGCCGGACCCGCGGCAGACACTGCGTCGCTCCGTC 605 Qy 601 CACATCATCAACCGCCCCAGAACTGGTACGGACAAGGGGAATCTGACTGTCTAATTAAAA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 606 CACATCATCAACCGCCCCAGAACTGGTACGGACAAGGGGAATCTGACTGTCTAATTAAAA 665 Qy 661 CATAGCTTTGCGATGGTTGTAAAACAATGTTGACGCAAAGTGATTTCTGCCCAGTGCTCT 720 |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| Db 666 CATAGCTTTGCGATGGTTCTAAAACAATGTTGACGCAAAGTGATTTCTGCCCAGTGCTCT 725 Qy 721 GAATGTCAAAGTGAAGAAATTCAACCAAGCGCGCGGGTAAACGGCGGGAGTAACTATGCT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 726 GAATGTCAAAGTGAAGAAATTCAACCAAGCGCGCGGGTAAACGGCGGGAGTAACTATGCT 785 Qy 781 CTCTTAAGGTAGCCAAATGCCTCGTCATCTAATTAGTGACGCGCATGAATGGATTAACGA 840 ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| Db 786 CTCTTAAGGTAGCCAAATGCCTCCTCATCTAATTAGTGACGCGCATGAATGGATTAACGA 845 Qy 841 GATTCCCACTGTCCCTATCTACTATGTAGCGAAACCACAGCCAAGGGAACGGGCTTGGCA 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 846 GATTCCCACTGTCCCTATCTACTATGTAGCGAAACCACAGCCAAGGGAACGGGCTTGGCA 905 Qy 901 GAATCAGCGGGGAAAGAAGACCCTGTTGAGCTTGACTCTAGTTTGACATTGTGAAGAGAC 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 906 GAATCAGCGGGGAAAGAAGACCCTGTTGAGCTTGACTCTAGTTTGACATTGTGAAGAGAC 965 Qy 961 ATAGGGGGTGTAGAATAAGTGGGAGCTTCGGCGCCGGTGAAATACCACTACCCTTATCGT 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 966 ATAGGGGGTGTAGAATAAGTGGGAGCTTCGGCGCCGGTGAAATACCACTACCCTTATCGT 1025 Qy 1021 TTCTTTACTTATTTAGTAAGTGGAAGTGGTTTAACAACCATTTTCTAGCATTCCTTTCCA 1080 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Db 1026 TTCTTTACTTATTTAGAAAGTGGAAGTGGTTTAACAACCATTTTCTAGCATTCCTTTCCA 1085 Qy 1081 GGCTGAAGACATTGTCAGGTGGGGAGTTTGGCTGGGGCGGCACATCTGTTAAAAGATAAC 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1086 GGCTGAAGACATTGTCAGGTGGGGAGTTTGGCTGGGGCGGCACATCTGTTAAAAGATAAC 1145 Qy 1141 GCAGATGTCCTAAGGGGGACTCAATGAGAACAGAAATCTCATGTAGAACAAAAGGGTAAA 1200 ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| Db 1146 GCAGATGTCCTAAGGGGGACTCAATGAGACCAGAAATCTCATGTAGAACAAAAGGGTAAA 1205 Qy 1201 AGTCCCCTTGATTTTGATTTTCAGTGTGAATACAAACCATGAAAGTGTGGCCTATCGATC 1260 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Db 1206 AGTCCCCTTGATTATGATTTTCAGTGTGAATACAAACCATGAAAGTGTGGCCTATCGATC 1265 Qy 1261 CTTTAGTTGTTCGGAGTTTGAACCTAGAGGTGCCAGAAAAGTTACCACAGGGATAACTGG 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1266 CTTTAGTTGTTCGGAGTTTGAACCTAGAGGTGCCAGAAAAGTTACCACAGGGATAACTGG 1325 Qy 1321 CTTGTGGCAGTCAAGCGTTCATAGCGACATTGCTTTTTGATCCTTCGATGTCGGCTCTTC 1380 |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| Db 1326 CTTGTGGCAGTCAAGCGTTCATAGCGACATAGCTTTTTGATCCTTCGATGTCGGCTCTTC 1385 Qy 1381 CTATCATACCGAAGCAG 1397 |||||||| |||||||| Db 1386 CTATCATAACGAAGCAG 1402 Conclusion No claim is in condition for allowance. Any inquiry concerning this communication or earlier communications from the examiner should be directed to SYNPHANE SHELTON whose telephone number is (571)272-6318. The examiner can normally be reached 9:00am-7pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Robert Mondesi can be reached at (408) 918-7584. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /S.L.S./Examiner, Art Unit 1652 /ROBERT B MONDESI/Supervisory Patent Examiner, Art Unit 1652
Read full office action

Prosecution Timeline

Jul 12, 2024
Application Filed
Sep 10, 2026
Non-Final Rejection mailed — §102, §103, §112 (current)

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
100%
Grant Probability
99%
With Interview (+0.0%)
3y 5m (~1y 3m remaining)
Median Time to Grant
Low
PTA Risk
Based on 2 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month