Prosecution Insights
Last updated: July 17, 2026
Application No. 18/780,938

COMPOSITIONS AND METHODS FOR PRODUCING TOBACCO PLANTS AND PRODUCTS HAVING ALTERED ALKALOID LEVELS

Non-Final OA §102§112
Filed
Jul 23, 2024
Priority
Jan 12, 2018 — provisional 62/616,959 +3 more
Examiner
KEOGH, MATTHEW R
Art Unit
1663
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Altria Client Services LLC
OA Round
1 (Non-Final)
78%
Grant Probability
Favorable
1-2
OA Rounds
8m
Est. Remaining
93%
With Interview

Examiner Intelligence

Grants 78% — above average
78%
Career Allowance Rate
550 granted / 702 resolved
+18.3% vs TC avg
Moderate +14% lift
Without
With
+14.5%
Interview Lift
resolved cases with interview
Typical timeline
2y 7m
Avg Prosecution
41 currently pending
Career history
732
Total Applications
across all art units

Statute-Specific Performance

§101
1.3%
-38.7% vs TC avg
§103
39.4%
-0.6% vs TC avg
§102
13.6%
-26.4% vs TC avg
§112
31.0%
-9.0% vs TC avg
Black line = Tech Center average estimate • Based on career data from 702 resolved cases

Office Action

§102 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claim Status Claims 36-57 are pending and examined on the merits. Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claim(s) 36-57 is/are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Humphry et al (WO2018237107). Humphry et al disclose a Nicotiana tabacum plant comprising a premature stop codon in SEQ ID NO:5 (aka Nitab4.5_0003090g003.1) having a Q25STOP change (Example 13). The features of leaf grade and nicotine level naturally flow from mutation. They further contemplate that the invention can be practiced in burley, flue-cured, Oriental, or Turkish tobaccos (p. 55, lines 8-13) and the resultant tobacco can be used to make both smokeless and smokable tobacco products (p. 76-77). Accordingly, claims 36-57 is/are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Humphry et al. BFY84097 (NOTE: this sequence has 44 duplicates in the database searched. See complete list at the end of this report) ID BFY84097 standard; DNA; 720 BP. XX AC BFY84097; XX DT 21-FEB-2019 (first entry) XX DE Tobacco Nitab4.5_0003090g0030.1 (ERF199) genomic DNA, SEQ 5. XX KW ERF199 gene; Nitab4.5_0003090g0030.1; alkaloid; cell culture; KW crop improvement; ds; gene; gene expression; plant; plant breeding; KW transgenic plant. XX OS Nicotiana tabacum. XX CC PN WO2018237107-A1. XX CC PD 27-DEC-2018. XX CC PF 21-JUN-2018; 2018WO-US038679. XX PR 23-JUN-2017; 2017US-0524216P. XX CC PA (KENT) UNIV KENTUCKY RES FOUND. XX CC PI Humphry ME, Yang S, Qin Q; XX DR WPI; 2019-00091P/06. DR P-PSDB; BFY84100. XX CC PT Modulating alkaloid content of a plant, plant portion or cell culture CC PT used to breed plant for producing plant product and leaf, and growing CC PT crop, involves modifying plant or cell culture by modulating activity of CC PT NIC1 ERF gene. XX CC PS Claim 1; SEQ ID NO 5; 169pp; English. XX CC The present invention relates to a novel method for modulating the CC alkaloid content of a plant, plant portion or cell culture. The method CC involves: modifying the plant or cell culture by modulating the activity CC or expression of Nic1 ERF gene. The invention also provides: (1) a method CC for modulating the content of a tobacco specific nitrosamine (TSNA) or a CC precursor of TSNA in a tobacco plant or plant portion; (2) a method for CC producing a plant or plant portion, cell culture, plant propagation CC material, leaf, cut harvested leaf, processed leaf or cut and processed CC leaf which has modulated alkaloid content; (3) a tobacco blend comprises CC the cured tobacco material; (4) a tobacco industry product is prepared CC from a tobacco plant, or plant portion or a tobacco cell culture, and CC tobacco plant or portion propagated from tobacco plant propagation CC material, and harvested leaf of a plant, where the plant is tobacco, CC processed leaf; and (5) a mutant of a plant carrying a heritable mutation CC in a nucleotide sequence of Nic1 ERF gene. The method is useful to breed CC a plant for producing a plant product, and a leaf and a growing crop. The CC modulating the alkaloid content in plants: can increase the value of said CC plant as a biomass resource; can help to protect plants against insects CC and herbivores; and for producing tobacco plants and products with CC reduced nicotine may be desirable in view of the potential regulation of CC nicotine ceilings. The present sequence is a tobacco CC Nitab4.5_0003090g0030.1 (ERF199) genomic DNA, whose activity or CC expression is modulated in the method of the invention for modulating the CC alkaloid content of a plant, plant portion or cell culture. XX SQ Sequence 720 BP; 211 A; 168 C; 168 G; 173 T; 0 U; 0 Other; Query Match 100.0%; Score 720; Length 720; Best Local Similarity 100.0%; Matches 720; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ATGGCAATGGAAATGAATCCAGCTGACGAAACCTTGTTTTTCTCCGACTCTCATCTCCTT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 ATGGCAATGGAAATGAATCCAGCTGACGAAACCTTGTTTTTCTCCGACTCTCATCTCCTT 60 Qy 61 GAATCGATAAAGCAACATCTTCTTGACGATTCAGATTTTTCTGAAATTTTTTCGTCGATG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 GAATCGATAAAGCAACATCTTCTTGACGATTCAGATTTTTCTGAAATTTTTTCGTCGATG 120 Qy 121 AATTCTAGCAACGAAATATTGCCTAACAGTCCTAGCTCAAGTTTTAGCAGCTTCGACTTC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 AATTCTAGCAACGAAATATTGCCTAACAGTCCTAGCTCAAGTTTTAGCAGCTTCGACTTC 180 Qy 181 GACTGCAGCTTCCTTAATTGGGATGAAAACTCTGAGGAAACATTAATACCAACTGATCAG 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 GACTGCAGCTTCCTTAATTGGGATGAAAACTCTGAGGAAACATTAATACCAACTGATCAG 240 Qy 241 AATCCTTCACATGAATCCCATGAAAAGTACTCCGAGTCCGAGGAGAAAACCCAGGGCCCT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 AATCCTTCACATGAATCCCATGAAAAGTACTCCGAGTCCGAGGAGAAAACCCAGGGCCCT 300 Qy 301 GGGGTGGCGCGTGAGAAAAACGCGCCGCGAGATTGGACGCGGTACATAGGAGTGAAACGG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 GGGGTGGCGCGTGAGAAAAACGCGCCGCGAGATTGGACGCGGTACATAGGAGTGAAACGG 360 Qy 361 CGACCGTGGGGGACGTTTTCGGCGGAGACAAGAGACCCAAGTAGGAAAGGTGAAGGTGCA 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 CGACCGTGGGGGACGTTTTCGGCGGAGACAAGAGACCCAAGTAGGAAAGGTGAAGGTGCA 420 Qy 421 AGGCTGTGGTTAGGAACTTACGAGACCGCAGAGGATGCAGCGTTAGCTTACGATCAAGCC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 AGGCTGTGGTTAGGAACTTACGAGACCGCAGAGGATGCAGCGTTAGCTTACGATCAAGCC 480 Qy 481 GCTTTCAAAATCCGCGGCTCGAGAGCTCGGCTCAATTTTCCTCACTTAATCGGCTCAAAC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 GCTTTCAAAATCCGCGGCTCGAGAGCTCGGCTCAATTTTCCTCACTTAATCGGCTCAAAC 540 Qy 541 ATGCCTAAGCCGGCTAGAGTTACAGCGAGGCGTAGTCGTACGCGCTCACCCGAGCCATCG 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 ATGCCTAAGCCGGCTAGAGTTACAGCGAGGCGTAGTCGTACGCGCTCACCCGAGCCATCG 600 Qy 601 TCTTCTTCATCCACCTCATCATCAGAAAATGTACCAAGGAAAAGGAATATAGATGTGATA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 TCTTCTTCATCCACCTCATCATCAGAAAATGTACCAAGGAAAAGGAATATAGATGTGATA 660 Qy 661 AATTCCATAGCCAAAGCCAAATTCCTTTGTCATAGCTTGAATTTACAGAGATTAGCTTAA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 AATTCCATAGCCAAAGCCAAATTCCTTTGTCATAGCTTGAATTTACAGAGATTAGCTTAA 720 Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. Claims 36, 39-57 rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for making a Nicotiana tabacum plant that naturally comprises a nucleic acid molecule comprising SEQ ID NO:13, does not reasonably provide enablement for making a tobacco plant in species that do not naturally comprise a nucleic acid molecule comprising SEQ ID NO:13. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the invention commensurate in scope with these claims. The claimed invention is not supported by an enabling disclosure taking into account the Wands factors. In re Wands, 858/F.2d 731, 8 USPQ2d 1400 (Fed. Cir. 1988). In re Wands lists a number of factors for determining whether or not undue experimentation would be required by one skilled in the art to make and/or use the invention. These factors are: the quantity of experimentation necessary, the amount of direction or guidance presented, the presence or absence of working examples of the invention, the nature of the invention, the state of the prior art, the relative skill of those in the art, the predictability or unpredictability of the art, and the breadth of the claim. The claims are broadly drawn to tobacco plants of any species comprising a non-natural mutation that introduces a stop codon in SEQ ID NO:13, and related products. It is unclear from the disclosure whether any working examples of tobacco plants having a non-naturally occurring stop codon are taught. The Examiner read through the Examples looking for both recitations of ERF199 and SEQ ID NO:13 and was unable to determine if any of the disclosed data were from tobacco plants having a non-naturally occurring stop codon within SEQ ID NO:13. If there are data disclosed from such plants, please identify these data and explain the basis of the nomenclature used such that the record is clear. If no working examples were disclosed in the originally filed specification, please make such a statement attesting to that. Logically, if a tobacco plant does not naturally comprise a nucleotide sequence comprising SEQ ID NO:13 then it would be impossible to practice the invention as claimed in such a tobacco plant. It appears that SEQ ID NO:13 only naturally exists in Nicotiana tabacum. Given the lack of guidance in the instant specification, undue trial and error experimentation would have been required for one of ordinary skill in the art to make the invention throughout the broad scope of the claims. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to MATTHEW R KEOGH whose telephone number is (571)272-2960. The examiner can normally be reached M-Th 7-4:30, half day on Fridays. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad Abraham can be reached on 571-270-7058. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /MATTHEW R KEOGH/Primary Examiner, Art Unit 1663
Read full office action

Prosecution Timeline

Jul 23, 2024
Application Filed
Jun 04, 2026
Non-Final Rejection mailed — §102, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12677788
SOYBEAN VARIETY 01098747
2y 8m to grant Granted Jul 14, 2026
Patent 12677792
TRANSGENIC SOYBEAN VARIETY '22151688'
2y 7m to grant Granted Jul 14, 2026
Patent 12653121
CANOLA HYBRID 21GG2040N
2y 7m to grant Granted Jun 16, 2026
Patent 12635651
SOYBEAN CULTIVAR 27301119
2y 3m to grant Granted May 26, 2026
Patent 12628763
INBRED CORN LINE CB121
3y 0m to grant Granted May 19, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
78%
Grant Probability
93%
With Interview (+14.5%)
2y 7m (~8m remaining)
Median Time to Grant
Low
PTA Risk
Based on 702 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month