Prosecution Insights
Last updated: July 17, 2026
Application No. 18/783,586

INSECTICIDAL PROTEINS AND METHODS FOR THEIR USE

Non-Final OA §101§102§112
Filed
Jul 25, 2024
Priority
Jan 31, 2017 — provisional 62/452,627 +4 more
Examiner
IBRAHIM, MEDINA AHMED
Art Unit
1662
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Pioneer Hi-bred International Inc.
OA Round
1 (Non-Final)
88%
Grant Probability
Favorable
1-2
OA Rounds
2m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 88% — above average
88%
Career Allowance Rate
1277 granted / 1460 resolved
+27.5% vs TC avg
Moderate +12% lift
Without
With
+12.0%
Interview Lift
resolved cases with interview
Typical timeline
2y 2m
Avg Prosecution
31 currently pending
Career history
1486
Total Applications
across all art units

Statute-Specific Performance

§101
2.8%
-37.2% vs TC avg
§103
19.9%
-20.1% vs TC avg
§102
13.5%
-26.5% vs TC avg
§112
51.9%
+11.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1460 resolved cases

Office Action

§101 §102 §112
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions Applicant’s election without traverse of species of SEQ ID NO: 1018 in the reply filed on 04/29/2026 is acknowledged. The sequences of SEQ ID NO: 958-1017 and 1019-1026 are withdrawn from consideration as being directed to the non-elected species. Claims 14-24 are pending. Claims 14-24, drawn to SEQ ID NO: 1018 is under examination. Copending Applications Applicants must bring to the attention of the Examiner, or other Office official involved with the examination of a particular application, information within their knowledge as to other copending United States applications, which are "material to patentability" of the application in question. MPEP 2001.06(b). See Dayco Products Inc. v. Total Containment Inc., 66 USPQ2d 1801 (CA FC 2003). Improper Markush Grouping Rejection Claims 14-24 are rejected on the basis that it contains an improper Markush grouping of alternatives. See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). A Markush grouping is proper if the alternatives defined by the Markush group (i.e., alternatives from which a selection is to be made in the context of a combination or process, or alternative chemical compounds as a whole) share a “single structural similarity” and a common use. A Markush grouping meets these requirements in two situations. First, a Markush grouping is proper if the alternatives are all members of the same recognized physical or chemical class or the same art-recognized class, and are disclosed in the specification or known in the art to be functionally equivalent and have a common use. Second, where a Markush grouping describes alternative chemical compounds, whether by words or chemical formulas, and the alternatives do not belong to a recognized class as set forth above, the members of the Markush grouping may be considered to share a “single structural similarity” and common use where the alternatives share both a substantial structural feature and a common use that flows from the substantial structural feature. See MPEP § 2117. The Markush grouping of nucleic acid sequences encoding the polypeptide sequences of SEQ ID NO: 958-1026 of claims 14, 16 and 23 is improper because the alternatives defined by the Markush grouping do not share both a single structural similarity and a common use for the following reasons: each of the sequences listed are structurally divergent; the sequences are heterogeneous in length and composition. According to Table 12 of the specification, nucleic acid sequences encoding SEQ ID NO: 958-1026 differ in the level of activity against FAW (Fall Armyworm),CEW (Corn Earworm), SBL (Soybean Looper) and ECB (European Corn Borer). For example, the polypeptide sequence of SEQ ID NO: 958 lacks insecticidal activity against FAW but has activity against CEW, while the elected species of SEQ ID NO: 1018 has insecticidal activity against FAW but lacks activity against CEW. In response to this rejection, Applicant should either amend the claim(s) to recite only individual species or groupings of species that share a substantial structural feature as well as a common use that flows from the substantial structural feature, or present a sufficient showing that the species recited in the alternative of the claims in fact share a substantial structural feature as well as a common use that flows from the substantial structural feature. This is a rejection on the merits and may be appealed to the Board of Patent Appeals and Interferences in accordance with 35 USC 134 and 37 CFR 41.31. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claim 14 is rejected under 35 U.S.C. 101 because the claimed invention is directed to a product of nature exception or a natural phenomenon without significantly more. The claims recite a DNA construct or a composition comprising (i) a nucleic acid molecule encoding SEQ ID NO: 1018 having insecticidal activity, without significantly more. This judicial exception is not integrated into a practical application because nucleic acid sequence encoding SEQ ID NO: 1018 from Lecanopteris sinuosa, according to the sequence listing, and is the sole component in the DNA construct. SEQ ID NO: 1018 is not markedly different from its naturally occurring counterpart (i.e., DNA/polypeptide sequence that is naturally found in Lecanopteris sinuosa). The claims do not include additional elements that are sufficient to amount to significantly more than the judicial exception because the insecticidal activity by SEQ ID NO: 1018 merely points to functional property that is inherent in Lecanopteris sinuosa. Therefore, there is no markedly different characteristics (function, structure, property) between the instant SEQ ID NO: 1018 and those naturally present in Lecanopteris sinuosa. Thus, claim 14 is not directed to patent eligible subject matter. The above rejection can be obviated by amending claim 14 to recite, ---wherein the nucleic acid is operably linked to a heterologous regulatory element---. Applicant may cancel claim 15. Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 14-24 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. The claims are drawn to a DNA construct or recombinant polynucleotide comprising a nucleic acid sequence encoding a polypeptide having at least 80% sequence identity to 1018 (as the elected species) or a variant or fragment thereof having insecticidal activity, wherein the nucleic acid sequence is operably linked to a heterologous regulatory element; a transgenic plant or plant comprising the recombinant polynucleotide; a method for controlling, inhibiting or killing an insect pest population, comprising contacting the insect pest population with the transgenic plant, wherein the insect pest population is resistant to at least one Bt toxin; wherein the transgenic or progeny thereof is corn or soy; a composition comprising a recombinant polypeptide sequence having at least 80% sequence identity to SEQ ID NO: 1018, or a variant or fragment thereof having insecticidal activity, wherein the polypeptide is fused to a heterologous transit peptide or signal sequence; and a method for controlling an insect pest population comprising contacting the insect pest population with the composition. The specification describes nucleotide sequences encoding the PtlP-83 polypeptides of SEQ ID NO: 1 from Adiantum pedatum and homologs including SEQ ID NO: 1018 from other organisms (Table 2) that share sequence identity of from 71% to 99% (Table 9a-9b). The specification also describes transformation of maize with SEQ ID NO: 2 encoding SEQ ID NO: 1 for insecticidal activity. Example 10 teaches six chimeras between SEQ ID NO: 1 and SEQ ID NO: 34 to show crossover points (Table 13 and Fig. 3a-3b). Examples 11-13 describes motifs in SEQ ID NO: 1 and multiple amino acid substitutions affecting protein function (Tables 14-21). Example 14 describes shuffling between SEQ ID NO: 2 encoding SEQ ID NO: 1 and SEQ ID NO: 8 encoding SEQ ID NO: 7 or fragments thereof for transient expression. Tables 24-25 show percent of sequence identity of active variants to SEQ ID NO: 1. The purpose of the written description is to ensure that the inventor had possession at the time the invention was made, of the specific subject claimed. For a broad generic claim, the specification must provide adequate written description to identify the genus of the claim. “The test for sufficiency is whether the disclosure of the application relied upon reasonably conveys to skilled in the art that the inventor had possession of the claimed subject matter as of the filing date.” Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1351 (Fed. Cir. 2010). To satisfy the written description requirement, a patent specification must describe the claimed invention in sufficient detail that one skilled in the art can reasonably conclude that the inventor had possession of the claimed invention. Lockwood v. Amer. Airlines, Inc., 107 F.3d 1565, 1572, 41 USPQ2d 1961, 1966 (Fed. Cir. 1997). “An applicant shows possession of the claimed invention by describing the claimed invention with all of its limitations. Lockwood, 107 F.3d at 1572, 41 USPQ2d at 1966”. While the written description requirement does not demand either examples or an actual reduction, actual “possession” or reduction to practice outside of the specification is not enough. Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1352 (Fed. Cir. 2010). Rather, it is the specification itself that must demonstrate possession. Id. The Federal Circuit has recently clarified the application of the written description requirement to inventions in the field of biotechnology. See University of California v. Eli Lilly and Co., 119 F.3d 1559, 1568, 43 USPQ2d 1398; 1406 (Fed. Cir. 1997). In summary, the court stated that a written description of an invention requires a precise definition, one that defines the structural features of the chemical genus that distinguishes it from other chemical structures. The specification does not sufficiently describe the structural features that must be retained by the members of the claimed genus that define function, and the structural features that would distinguish members of the claimed genus from other insecticidal proteins. Therefore, the specification does not describe a representative species of the genus of variants and fragments of sequences having 80% identity to SEQ ID NO: 1018 and having insecticidal activity. The specification also does not describe common structural domains that define function other than insecticidal activity for the sequences as broadly claimed. Therefore, the application has not met either of the two elements of the written description requirement as set forth in the court's decision in Eli Lilly, and has not shown her/his possession of the claimed genus at the time of the application. Since the specification fails to sufficiently describe variants and fragment sequences of SEQ ID NO: 1018 as broadly claimed, DNA constructs, transgenic plants or compositions comprising said sequences, and methods of controlling insects by contacting said insects with said transgenic plants are similarly not described. Therefore, the specification fails to sufficiently describe the claimed invention in such full, clear, concise, and exact terms that a skilled artisan would recognize that Applicant was in possession of the invention as broadly claimed at the time of filing. Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claims 14-22 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Barry et al (WO 2015120276 A1). The claims are drawn to a DNA construct or recombinant polynucleotide comprising a nucleic acid sequence encoding a polypeptide having at least 80% sequence identity to 1018 (as the elected species) or a variant or fragment thereof having insecticidal activity, wherein the nucleic acid sequence is operably linked to a heterologous regulatory element; a transgenic plant or plant comprising the recombinant polynucleotide; a method for controlling, inhibiting or killing an insect pest population, comprising contacting the insect pest population with the transgenic plant, wherein the insect pest population is resistant to at least one Bt toxin; wherein the transgenic or progeny thereof is corn or soy; a composition comprising a recombinant polypeptide sequence having at least 80% sequence identity to SEQ ID NO: 1018, or a variant or fragment thereof having insecticidal activity, wherein the polypeptide is fused to a heterologous transit peptide or signal sequence; and a method for controlling an insect pest population comprising contacting the insect pest population with the composition. Barry et al teach a vector/ construct or recombinant polynucleotide comprising a nucleic acid sequence encoding an insecticidal polypeptide having more than 49% sequence identity to Applicant’s SEQ ID NO: 1018 (alignment of sequences shown below); said nucleic acid is operably linked to a heterologous promoter, a transgenic soybean or corn plant or plant cell expressing said insecticidal polypeptide; (Pages 2-3; and Examples 9-10); a composition comprising said insecticidal polypeptide; and methods of controlling, killing and inhibiting Bt-toxin resistant insects population by contacting said insect population with said transgenic plant, plant cell or polypeptide (see at least the Abstract). The “variant” and “fragment” of the instant claims read on the prior art insecticidal sequences, absent evidence to the contrary. RESULT 20 BCD46902 (NOTE: this sequence has 1 duplicate in the database searched) ID BCD46902 standard; cDNA; 2628 BP. XX AC BCD46902; XX DT 08-OCT-2015 (first entry) XX DE Phyllitis scolopendium 'Angustifolia' PtIP-83Fg encoding cDNA, SEQ:750. XX KW PtIP-83Fg; Pteridophyta insecticidal protein-83Fg; agriculture; KW biological control agent; coding sequence; crop improvement; expression; KW insect resistance; nematode resistance; pathogen resistance; plant; KW plant fungal disease; plant insect pest; recombinant protein; ss; KW transgenic plant. XX OS Asplenium scolopendrium. XX CC PN WO2015120276-A1. XX CC PD 13-AUG-2015. XX CC PF 06-FEB-2015; 2015WO-US014824. XX PR 07-FEB-2014; 2014US-0937295P. PR 17-SEP-2014; 2014US-0051720P. XX CC PA (DUPO ) DU PONT DE NEMOURS & CO E I. CC PA (DUPO ) PIONEER HI-BRED INT INC. XX CC PI Barry J, Liu L, Lum A, Schepers E, Yalpani N, Zhu G; XX DR WPI; 2015-46977S/57. XX CC PT New purified Pteridophyta insecticidal protein-83 (PtlP-83) polypeptide, CC PT for preparing agricultural composition used for controlling, inhibiting CC PT growth or killing insect pest population, and for producing transgenic CC PT pest-resistant plants. XX CC PS Disclosure; SEQ ID NO 750; 324pp; English. XX CC The present invention relates to a purified Pteridophyta insecticidal CC protein-83 (PtlP-83) polypeptide of SEQ ID NO: 1 (see BCD46153). The CC invention further discloses: (1) a recombinant polynucleotide encoding CC the PtlP-83 polypeptide; (2) a transgenic plant comprising the CC polynucleotide; (3) a DNA construct comprising the polynucleotide CC operably linked to a heterologous regulatory element; (4) a transgenic CC plant or plant cell comprising the DNA construct; (5) a fusion protein CC comprising the PtlP-83 polypeptide; (6) a method for controlling an CC insect pest population, and inhibiting growth or killing an insect pest, CC which involves contacting the insect pest population with the PtlP-83 CC polypeptide, or contacting the insect pest population with the transgenic CC plant or plant cell; and (7) a method of controlling Lepidoptera and/or CC Coleoptera insect infestation in a transgenic plant and providing insect CC resistance management, which involves expressing the PtlP-83 polypeptide CC in the plant. The PtlP-83 polypeptide of the invention is useful: (a) for CC preparing agricultural composition for controlling insect pest population CC ; (b) for inhibiting growth or killing insect pest or insect population; CC (c) for controlling Lepidoptera and/or Coleoptera insect infestation in CC transgenic plant and providing insect resistance management; (d) for CC controlling, inhibiting growth or killing Lepidopteran, Coleopteran, CC Dipteran, fungal, Hemipteran and nematode pest populations; and (e) for CC producing transgenic pest-resistant plants. The present sequence CC represents a Phyllitis scolopendium 'Angustifolia' PtIP-83Fg encoding CC cDNA which is used in preparing the recombinant PtIP-83 polynucleotide. XX SQ Sequence 2628 BP; 667 A; 669 C; 681 G; 611 T; 0 U; 0 Other; Length: 2628 Score: 2186.50 Matches: 478 Percent Similarity: 69.1% Conservative: 145 Best Local Similarity: 53.1% Mismatches: 216 Query Match: 49.2% Indels: 62 Gaps: 17 US-18-783-586-1018 (1-875) x BCD46902 (1-2628) Qy 1 MetGluTyrSerSerLeuTyrSerAsnProSerLeuValAsnProAsnLeuGlnAlaThr 20 ||||||||| ||||||||| ::: ::: |||::: ::: ||| Db 1 ATGGAGTATGGCAGCTTGTATGGTGATGTGAACCAGGTGAGCCTGAGGTTCGAGAATACG 60 Qy 21 GluPheSerGluValMetValValHisArgMetHisValSerLeuSerGlnLeuAspIle 40 ||| ||||||||||||||||||||||||||||||||| ||| :::||||||::: Db 61 GAGGTCTCTGAGGTGATGGTGGTGCATCGGATGCATGTGCGGCTGGAGGAGCTGGACATG 120 Qy 41 AsnThrAlaAspSerValThrArgProThrLeuLeuGluGlySerAspLysValLysArg 60 ::: :::||||||:::|||||| Db 121 AGC---------------------------------------AACGACAAGCTCAAACGC 141 Qy 61 LeuPheIleValAlaAspValValGluValProThr------AlaTyrValPheLeuPro 78 |||:::::::::|||||||||||||||:::|||::: ::: :::||| Db 142 CTGTACGTGCTGGCGGACGTGGTGGAGCTGCCTTCCCAGCGTAAAACTATCGTTATCCCC 201 Qy 79 AlaSerLeuSerValValIleLeuCysArgLeuLeuHisVal------------------ 92 |||::::::||| :::|||:::||||||:::|||:::::: Db 202 GCCACCGTTTCGGCGATAATCATGTGCCGTGTTCTCTACATCCCTTACATCTGGACCGTG 261 Qy 93 ------------ThrVal--ProProThrHisHisLeuHisGly-ProSerValSerLeu 107 |||||| |||||| ||| ||| ||| |||||| Db 262 TTTGACAACTGCACCGTCCTCCTCCCGCACATGCGCTTCCGGGTCGTCGAAACAAGCCTC 321 Qy 108 ThrPheProPheMetArgPhePheIleAsnGluPheIleAlaAspPhePheProSerLys 127 ||| :::|||||| |||||| Db 322 ACGCTCAGAACTGGCCAATTCTTTGCC---------------------TTACCCTCCTCT 360 Qy 128 AspAsp---------------AspAlaGluIleGlyCysTyrIleTyrAlaAspArgIle 142 ||| ::: ||| ||||||:::||||||||| Db 361 GACACCGTCGACAACGGCGCCGGCAGCTTTGGCGGCCTCTACATCCATGCCGACCGCTTC 420 Qy 143 IleArgArgLeuAlaThrSer---ProSerAspArgArgLeuArgLeuValMetValAla 161 ||| ||| ||||||||| |||||| ||| ::: Db 421 ATCTACCGCCAGGCCACATCGTTTACCTCCGACTGGGTCCAGCCTCTGCAACTTCGGGTA 480 Qy 162 GluGlyProSerValPheSer---------ArgAsp---AsnTrp------------Pro 173 ||| ||| |||||| |||||| :::||| ||| Db 481 CGAGGCAGCTCCACCTTCTCCTCAACCTTCCGTGATCCTGACTGGCCAGAAACCCTACCT 540 Qy 174 IleSerArgPheGluPheThrGlnAspThrValThrProAspGluProLeuSerMetAla 193 :::::: ||| |||:::::: |||::: ::: Db 541 GTCACCAACCTCAATCAAACC---ATCACCCTCTCCTTGGGCTCATTCCTCACACCCTCC 597 Qy 194 AspSerGluLeuGlnArgSerAspGluTyrGluLeuGlnAspGlyThrIleGlnPhePro 213 ||||||:::|||||||||||||||||| ||| ||| Db 598 GACTCTGACTTGCAGAGATCTGACGAGATTGAGTTCCTGCAGACGGAGCCCCAGAGAGTG 657 Qy 214 LeuAlaValIleThrPheSerProLeuLeuProProSerThrSerAlaMetGlyArgGly 233 ||| ||| |||::: ||| Db 658 CAAGTGGTATTTAAC------------CGACCCGGCGGCACGACC------GGCGTGGCT 699 Qy 234 LeuAspThrAlaArgProProValPheCysTyrPheGlnPheArgSer------AspVal 251 ||| ||| :::||| ||| ||| Db 700 TTACTCGTCGAGAACTCCCCTGAAATCAGCTTTTTCCCTGCACCATCGCTGGAACATGTC 759 Qy 252 ProSerHisValLeuThrAsnProHisValValLeuGlyMetGlnMetThrMetLeuPhe 271 |||::: |||||| :::||| ::::::||||||||||||||| |||||| Db 760 CCTGCAGACGTCCTCGCCGATCCTTCCATCATCTTGGGCATGCAAATGAACATGCTCAGT 819 Qy 272 AlaGluLeuValGlnValAlaHisAsnAlaProArgValLeuLysLeuValThrArgHis 291 ||||||||||||::: |||||||||::: :::|||:::||| ||||||:::||| Db 820 GCCGAGCTTGTCCGGGCTGCTCACAATTCGCAGCAAGTCATCAAAGCTGTCACTAAGCAT 879 Qy 292 ValGluTrpLeuAsnLysLeuLeuArgGlnValAlaSerProAsnAspAspIleLeuGly 311 ||||||||||||:::|||:::||| |||||||||||||||:::|||||||||||| Db 880 GTGGAATGGCTCAGCAAGATCTTGCTTCAGGTTGCTTCACCGAGTGATGACATTCTAGCG 939 Qy 312 LeuLeuPheArgValGlnValPheLysArgThrAlaGluGlnGlyArgGlyTyrLeuVal 331 |||||||||||||||||| ||| ::: |||:::||| ||| ::::::||| Db 940 CTCTTGTTTCGCGTGCAAGCATTCATTAAGATGGCAAAGCAATCGCGC---TTTGTGGTT 996 Qy 332 ProMetLeuGlnTyrHisMetTyrSerAsnLeuIleAspArgMetValGlnAlaGlyGlu 351 ||| ||||||||||||:::|||||||||||||||:::|||||||||||| ::: Db 997 CCACGGTTACAATACCACGTGTACAGTAACCTTATCAATCGGATGGTGCAAGTAGCCCAG 1056 Qy 352 AlaTyrAspArgAspLeuLysAsnLeuGlnPhePheIleAlaThrAsnGlnIleLeuGly 371 ||||||:::::: ::: |||::: ||||||||| |||:::||||||||| Db 1057 GATTATGACCAGGAGTTCAGGCAACTCAGACTTTTCATTGCACAAAATGAGATATTGGGA 1116 Qy 372 AsnTyrLeuLeuGlnGlnAsnArgAlaPheAlaGluArgGluArgGluMetSerGlyPhe 391 :::||||||||||||||||||:::|||||||||::::::|||::::::|||||| ||| Db 1117 AGCTATTTGCTACAGCAAAATAAGGCTTTCGCAGATAAGGAGAAGGACATGAGTGCTTTC 1176 Qy 392 HisSerAsnValValGluMetArgArgAspGluLeuArgAsnAlaLeuAsnLysMetAsp 411 |||||| |||||| ||||||||| |||||| ::: ::: ||| Db 1177 CACTCGCAAGTTGTGTCTATGAGGAGATCCGAGCTGACCTCTACCATAGAAATGATGGGC 1236 Qy 412 LeuLeuAlaLeuGlnMetGluArgGluAsnThrAlaMetGluGluAlaArgGluAlaLeu 431 |||:::|||||||||||| ||| ||||||:::|||||||||::::::::: Db 1237 AGGCTGAGCTTGCAAATGGAAACGGAGGGTGAGGCGATGGACGAAGCCAGGGACAGTATG 1296 Qy 432 AspLysAlaIleLeuGluTyrGlnArgArgGlnMetAlaAsnAlaIleLeuSerValVal 451 :::|||||| ||||||:::|||:::|||:::||| |||::: :::|||::: Db 1297 GTCGAAGCAATTCAAGAATATGAAAGGAAACAACTTGCAAGGGCTCTATTTGCAGTGCTT 1356 Qy 452 ArgAlaValValGlyValAlaLeuAlaPheAlaThrAlaGlyAlaThrLeuThrGlyAla 471 |||::: ||||||||||||||||||||| ||||||||| ||| Db 1357 GGGGCAATAGCAAGTGTTGCTCTTGCATTTGCCACTGGAGGTGCAACTGCACCAGCGGCA 1416 Qy 472 ValAlaSerAlaGlyGlnAlaValSerAlaAlaGlyGlnAlaAlaAlaSerLeuAlaLys 491 ||||||:::|||||| ||||||:::|||||||||::: ||| ||| ::: Db 1417 GTGGCAGCAGCTGGAGCGGCAGTCACTGCAGCAGGTAGATTGGCAGAAGGCCTCCGAAGG 1476 Qy 492 ValValAlaThrLeuGluAlaLeuGluGlyValMetGluPheValIleAlaLeuArgGlu 511 |||||| |||||| |||::: :::|||||| ||| |||:::|||::: Db 1477 GTTGTGGAGATCCTCGAAGGCTTGCAAGCGATCATGGAGGTTGTGGCAGCTATAAGAGAT 1536 Qy 512 ValAlaAspSerLeuGlySerMetAsnAsnLeuValAsnAlaProGluGlnProGluLeu 531 ::: :::|||||| :::||| |||||| ||||||||| ||||||::: Db 1537 CTCGTAGAATCACTGGAAAACATGGGTCAACTAGTAGGAGCTCCGGAAATGCCAGAGATG 1596 Qy 532 ProSerAspAlaAspTrpSerIlePheValAsnGluIleGluAlaValAlaGlyGlnMet 551 |||::::::||||||||| |||||||||||||||:::|||||||||||| |||::: Db 1597 CCTACAAATGCAGACTGGTTAATTTTTGTAAATGAGGTGGAGGCAGTGGCAGAGCAAGTG 1656 Qy 552 ProGluGluValValGlyProValSerValTrpGlnAlaLysCysLysAsnValAlaVal 571 ||||||||| ||| ||| ||||||:::|||||||||||||||||||||||| Db 1657 CCAGAAGAA---GTGTCAGAGGTCCCAGTGTGGAAGGCCAAGTGCAAGAATGTGGCGGTG 1713 Qy 572 LeuGlyArgGluMetCysThrThrThrAlaHisIleGlyGluLeuThrHisGlnIleLys 591 ||||||:::||||||||||||||| ||||||||| |||||| :::||||||::: Db 1714 CTAGGGCAAGAGATGTGCACAACAGCAGCACATATTAGCGAGCTACAGTATCAGATAAGG 1773 Qy 592 ValGluGluMetLeuGlnGluIleAlaLeuArgGlnAlaAspArgLeuAspAlaIleSer 611 ||||||||||||||||||||||||||| |||||||||||||||||| |||||| Db 1774 GTGGAAGAGATGCTACAGGAGATTGCACAACGTCAAGCAGACAGGCTAATGGGGATATCA 1833 Qy 612 SerProGlnAspLeuSerSerPheThrGluMetLeuSerGluIleAspMetArgSerLeu 631 ::: ||||||||||||:::||||||||| ::::::||||||||||||::: Db 1834 GCA---GCAGATCTATCAAGCTACACGGAGATGGCAACACAGATAGACATGCGTACAACT 1890 Qy 632 ArgLeuLeuLeuGlnLeuIleLysLeuLeuTyrIleGlnAsnProAlaLeuLysTyrGlu 651 |||:::||||||||||||||||||:::||||||||||||||| |||:::||||||||| Db 1891 CGGATGCTCCTTCAGCTCATCAAGATGTTGTACATTCAGAATGCTGCAATCAAGTACGAG 1950 Qy 652 TyrLeuPheThrThrThrGluSerLeuAspThrTrpProValSerMetGluThrValArg 671 ||||||::: :::||| |||::::::|||||||||:::|||:::|||||| Db 1951 TACTTGTACGCTGCGAGTGAGCGGCTTAACTCATGGCCAGTGACCATGCAGACAGTATGG 2010 Qy 672 AsnValLeuIleArgGlnGluAlaArgAlaIleGlnGlyLeuLeuGlnLeuGlyValSer 691 :::|||::::::|||||| |||||| ||||||||| |||||| ||| Db 2011 ACCATGCTCTTGCAACAAGAGAATGCAGCTATCTTGGGCTTGCTAGACTTGGGGCCCTCT 2070 Qy 692 AsnAspHisThrLeuThrTyrValAlaSerGlyIleProValGlyLeuLeuValGluGly 711 |||||| |||:::|||:::||| ||||||||| |||||||||:::||| Db 2071 AATGATTTCACAGTAACACATGTTGTTAAAGACATACCGGTCAAGTTGTTAGTTGATGGT 2130 Qy 712 HisAspTrpValPheSerPheProValHisAsnPheAspValPheProGluGlyPheSer 731 :::|||||| ||| |||||| ::: :::|||||| |||:::||| Db 2131 TACGATTGGCATTTTGAGATCCCTGTGGAGGATTCCGCAATCTTCCCGGCAGGATGGTCT 2190 Qy 732 ArgValArgIleArgTyrValGluLeuLysPheAspAlaAlaGlyGlnGlnAlaGluGly 751 ||||||||||||||||||||||||||||||||| ||| ::: Db 2191 CGTGTTCGGATACGCTATGTCGAGCTTAAATTTGGCAAACAGGGTACTGACAGT---AAC 2247 Qy 752 GlyMetIleHisLeuProSerThrAsnThrGlyLeuLeuTyrLeuLeuLeuGlnCysSer 771 :::|||||| |||||||||||||||||||||:::|||:::||||||||| ||| Db 2248 ATTGTCATCCACCAGCCTAGCACTAATACTGGCCTAATCTACGTGCTCTTACAAAGCTCT 2307 Qy 772 ProSerPheAlaAspArgLysAsnGlnGluMetLeuGlyTyrGluAlaThrSerGlyVal 791 :::||||||||| :::|||:::::: |||||||||::::::|||::: Db 2308 CGTTTCCTCAGTGATCGCAAACGGGAGGAGGTGATGGACTATGAGGCAAGCACGGGACTT 2367 Qy 792 AlaTyrAlaTyrAlaTyrAsnLeuGlnThrGlyGluProThrLeuThrAsnIleProSer 811 ||||||||||||||||||:::||| |||||| ||||||||||||||||||||| Db 2368 GCATATGCGTACGCCTATGACCTCAGCACGGGTGCAACCACTCTAACTAACATCCCCTCA 2427 Qy 812 ProGluPheAlaAsnThrPheMetArgMetThrProPheAsnThrTrpArgValArgLeu 831 |||||||||||||||:::||| |||||| ||||||:::|||||| Db 2428 GAGGCACATGCCAACACATTTATGCAAATGGCACCCTTCACTGCCTGGAGGCTTCGTCTC 2487 Qy 832 SerAlaSerAlaProGluAsnGlnGlyLeuSerPheLeuThrAlaAspSerProAspAsp 851 |||||||||||| ||||||||||||||| ||| |||||| |||||||||::: Db 2488 TCTGCCTCTGCTATGGAAAATCAGGGACTGGTGTTTCCTACAGCCACTTCTCCGGACAAT 2547 Qy 852 ThrThrGlnIleAlaIleThrPheHisPheSerAlaValArgArgIleHisThrArg 870 ||||||||||||:::|||||||||::: :::|||:::||||||||| |||||| Db 2548 ACTACCCAAATCTCCATCACATTCTATGTCACTGCTATTCGACGGATAGATACTCGT 2604 Conclusion No claim is allowed. Contact Information Any inquiry concerning this communication or earlier communications from the examiner should be directed to MEDINA AHMED IBRAHIM whose telephone number is (571)272-0797. The examiner can normally be reached Monday-Friday, 9:00 - 6:00. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, BRATISLAV STANKOVIC can be reached at 571-270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. MEDINA AHMED. IBRAHIM Primary Examiner Art Unit 1662 /MEDINA A IBRAHIM/ Primary Examiner, Art Unit 1662
Read full office action

Prosecution Timeline

Jul 25, 2024
Application Filed
Jun 03, 2026
Non-Final Rejection mailed — §101, §102, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12628754
WHEAT VARIETY 6PVED35B
2y 4m to grant Granted May 19, 2026
Patent 12616109
Spinach Plants Resistant to Peronospora Farinosa and Stemphylium Vesicarium
2y 11m to grant Granted May 05, 2026
Patent 12616120
PLANTS AND SEEDS OF HYBRID CORN VARIETY CH010566
2y 4m to grant Granted May 05, 2026
Patent 12616121
PLANTS AND SEEDS OF CORN VARIETY CV639533
2y 4m to grant Granted May 05, 2026
Patent 12616108
PLANTS AND SEEDS OF HYBRID CORN VARIETY CH010475
2y 4m to grant Granted May 05, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
88%
Grant Probability
99%
With Interview (+12.0%)
2y 2m (~2m remaining)
Median Time to Grant
Low
PTA Risk
Based on 1460 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month