DETAILED ACTION
DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Status of the Claims
Claims 1-31 are pending.
Claims 1-31 are examined herein.
Claims 1-6, 11, 13, 17-18, 21-25, and 31 are rejected.
Claims 7-10, 12, 14-16, 19-20, and 26-30 are allowed.
Priority
Application No. 18/797,867 filed on 08/08/2024 is a CIP of PCT Application No. PCT/EP2023/053276 filed on 02/10/2023 and also claims foreign priority to PCT/EP2022/053284 filed on 02/10/2022.
Election/Restrictions
The restriction requirement between groups I and II as set forth in the Office action mailed on 06/03/2026 is hereby withdrawn. In view of the withdrawal of the restriction requirement as to the rejoined inventions, applicant(s) are advised that if any claim presented in a divisional application is anticipated by, or includes all the limitations of, a claim that is allowable in the present application, such claim may be subject to provisional statutory and/or nonstatutory double patenting rejections over the claims of the instant application.
Once the restriction requirement is withdrawn, the provisions of 35 U.S.C. 121 are no longer applicable. See In re Ziegler, 443 F.2d 1211, 1215, 170 USPQ 129, 131-32 (CCPA 1971). See also MPEP § 804.01.
Specification
The disclosure is objected to because of the following informalities: The specification references “Figure 3” (spec., ¶0095), however there is only a single figure (Fig. 1, see drawings) provided in the drawings. Applicant should correct the specification by amending “Figure 3” to read “Fig. 1”.
Additionally, “Figure 1.” as recited in ¶0041 of the specification should read “Fig. 1” to match the recitation of “Fig. 1” as seen in the drawings.
Appropriate correction is required.
Claim Rejections - 35 USC § 112
Indefiniteness
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 5-6 and 24-25 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 5 recites “…as compared to a Cucurbitaceae plant that is isogenic but does not possess the DCAF8 gene”. Because the claim recites “does not possess the DCAF8 gene” and because previous claims reference both a wild-type and modified DCAF8 gene, it is unclear if the plant in claim 5 is being compared to a plant that does not possess the DCAF8 gene at all, either in wild-type or modified form, or if the plant in claim 5 is meant to be compared to a plant that does not possess the modified/mutated DCAF8 gene. For this reason, the claim is indefinite.
Claim 6 is also rejected as a function of dependency.
Claim 24 recites “…as compared to a Cucumis sativa plant that is isogenic but does not possess the DCAF8 gene”. Because the claim recites “does not possess the DCAF8 gene” and because previous claims reference both a wild-type and modified DCAF8 gene, it is unclear if the plant in claim 24 is being compared to a plant that does not possess the DCAF8 gene at all, either in wild-type or modified form, or if the plant in claim 5 is meant to be compared to a plant that does not possess the modified/mutated DCAF8 gene. For this reason, the claim is indefinite.
Claim 25 is also rejected as a function of dependency.
Written Description
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-6, 11, 13, 17-18, and 21-23 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claims 1-6, 11, 13, 17-78, and 21-23 are broadly drawn to all species of the Cucurbitaceae family, wherein the claimed modification to a DCAF8 gene or any homologous gene that is over 90% identical to SEQ ID NO: 2 results in a reduced leaf area phenotype when homozygously present in any species of the Cucurbitaceae family.
In working examples, Applicant has described the homozygous mutation to DCAF8 (the WT sequence being SEQ ID NO: 2 encoding SEQ ID NO: 3 at 100% sequence identity) confers reduced leaf area phenotype in cucumber (Cucumis sativa L.).
Applicant has not described the homozygous mutation confers reduced leaf area phenotype in any other species of the Cucurbitaceae family, which encompasses approximately 1,000 species. Applicant has not described the homozygous mutation in any homolog of DCAF8 confers reduced leaf area phenotype. The prior art fails to remedy this deficiency as there is a dearth of description in the prior art of how this homozygous mutation in DCAF8 affects leaf area in other Cucurbitaceae species.
The specification fails to provide an adequate written description to support the genus recited in the claims that are able to effectively confer a reduced leaf area phenotype when the modified DCAF8 gene or a homologous gene is homozygously present. The limited example of cucumber (Cucumis sativa L.) and a single mutation in SEQ ID NOs: 2-3 at 100% identity does/do not describe the claimed genus by virtue of example. Therefore, one of ordinary skill in the art would not have recognized the Applicant to be in possession of the claimed invention at the time of filing.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claim 31 is rejected under 35 U.S.C. 102(a)(1) as being anticipated by Phytozome (Phytozome, C.sativus v1.0, scaffold03678, published online by 10/22/2020, evidenced by Wayback machine).
Claim 31 is drawn to an isolated nucleic acid molecule
comprising a sequence having at least 90% and up to 99% sequence identity to SEQ ID No. 2 and encoding a protein having at least 90% and up to 99% sequence identity to SEQ ID No. 3, wherein:
(a) with reference to SEQ ID No. 2, the isolated nucleic acid molecule comprises a modification at position 592; or
(b) with reference to SEQ ID No. 3, the isolated nucleic acid molecule comprises a modification that leads to a Gln to Glu substitution at position 198 of SEQ ID No. 3; or,
(ii) comprising marker sequence SEQ ID No. 7.
Regarding claim 31, Phytozome disclose a sequence that has 100% identity to SEQ ID NO: 7 (see alignment below). Because the nucleic acid molecule comprising SEQ ID NO:7 has been sequenced, it is reasonably interpreted to have been isolated and therefore is an isolated nucleic acid molecule comprising SEQ ID NO: 7.
Score = 359 bits (397), Expect = 5e-98
Identities = 200/201 (99%), Gaps = 0/201 (0%)
Strand=Plus/Minus
Query 1 CCCCCAGACTTGCGAATATCATACAATCGTGCATACTCATCTGAACCAGCAACAACAAAG 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 39337 CCCCCAGACTTGCGAATATCATACAATCGTGCATACTCATCTGAACCAGCAACAACAAAG 39278
Query 61 AGATTTGGATTTCTGGGATCAATCACAATTGCATTAAGCTCAATCGATGACATGTAACCT 120
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Sbjct 39277 AGATTTGGATTTCTGGGATCAATCACAATTGCATTAAGCTGAATCGATGACATGTAACCT 39218
Query 121 GCCCTATTGTCAACTGATTGGCAAGTGAACAGCTCAACGGCATCCCCAGTTCTTAGATCA 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 39217 GCCCTATTGTCAACTGATTGGCAAGTGAACAGCTCAACGGCATCCCCAGTTCTTAGATCA 39158
Query 181 AACTATAAAATTAGTAAAGTC 201
|||||||||||||||||||||
Sbjct 39157 AACTATAAAATTAGTAAAGTC 39137
Closest Prior Art
Claims 1-30 appear free of the prior art.
Regarding claims 1-30, the closest prior art is Shi (Shi TingTing, S. T., Wang ShenHao, W. S., Lin Tao, L. T., Yang Qing, Y. Q., & Huang SanWen, H. S. (2014). Genetic mapping of little leaf 2 (ll2), a major QTL controlling leaf area in cucumber (Cucumis sativus L.).C). Shi teaches about two major QTLs, little leaf (ll) and little leaf 2 (ll2) that control leaf area in cucumber (Cucumis sativus L.) and were found on chromosomes 6 and 7, respectively (abstract). However, the prior art is silent to a mutation at position 592 in the DCAF8 gene and position 198 in the encoded DCAF8 protein, wherein the wild type DCAF8 sequences is SEQ ID NO: 2 encoding SEQ ID NO: 3. Mutated sequences with 90-99% identity to SEQ ID NO: 2 or 3 with the claimed mutations at positions 198 and 592, respectively, do not expressly appear in the prior art, and the claimed mutation(s) to DCAF8 gene and/or protein have not previously been reported as associated with a reduced leaf area phenotype. Therefore, Shi does not disclose, teach, or otherwise render obvious the plant comprising the claimed modified DCAF8 gene, a method of identifying a plant having the modified DCAF8 gene, a method of selecting a plant exhibiting reduced lead area phenotype by identifying and selecting a plant that has the modified DCAF8 gene, a method of producing a plant having exhibiting a reduced leaf area phenotype by introducing the specified modification into a DCAF8 gene.
Conclusion
Claims 1-6, 11, 13, 17-18, 21-25, and 31 are rejected.
Claims 7-10, 12, 14-16, 19-20, and 26-30 are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JESSICA N STOCKDALE whose telephone number is (703)756-5395. The examiner can normally be reached M-F 8:30-5:00 CT.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad Abraham can be reached at (571) 270-7058. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
JESSICA N. STOCKDALE
Examiner
Art Unit 1663
/JESSICA NICOLE STOCKDALE/Examiner, Art Unit 1663
/CHARLES LOGSDON/Primary Examiner, Art Unit 1662
Prosecution Insights