Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Application status
Claims 39-58 are pending in this application.
Priority
It is acknowledged that the instant application is a CON of US Application No. 17054424, filed on 11/10/2020 (now US PAT 12133884), which is the 371 national stage entry of PCT/US2019/031897, filed on 05/11/2019, which claims benefit of 62780890 filed on 12/17/2018, 62670539 filed on 05/11/2018 and 62670521 filed on 05/11/2018.
Election
Applicants’ election without traverse of Group I, Claims 39-50 and 52-58, and species 1) adenosine deaminase domain, 2) SEQ ID NO: 238, and 3) SEQ ID NO: 176 in the response filed on 08/19/2026, is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.03(a)).
Claim 51 is withdrawn from further consideration by the Examiner, 37 CFR 1.142(b) as being drawn to a non-elected invention.
For the reasons provided above, this restriction requirement is deemed proper, and therefore, it is made final.
Information Disclosure Statement
The information disclosure statements (IDS) submitted on 08/16/2024, 02/13/2026, and 08/07/2026 are acknowledged. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statements are being considered by the examiner.
Claim Rejections - 35 U.S.C. § 112
The following is a quotation of 35 U.S.C. 112(b):
(B) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
Claims 39-50 and 52-58 are rejected under 35 U.S.C. § 112(b) as being indefinite for failing to particularly point out and distinctly claim the subject matter which applicant regards as the invention.
Claims 39 and 52 (40-50 and 53-58 dependent therefrom) are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being incomplete for omitting essential elements, such omission amounting to a gap between the elements. See MPEP § 2172.01. The omitted elements are: specific type of cell which comprises HBG1 and/or HBG2 genes because not all cells comprise HBG1 and/or HBG2 genes (only a specific type of cells, i.e., erythroid cells comprise HBG1 and/or HBG2 genes). In the interest of advancing prosecution, the “cell” is interpreted as “any cell”.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
Claims 39-50 and 52-58 are rejected under 35 U.S.C. 103 as being unpatentable over Traxler et al. (A genome-editing strategy to treat β-hemoglobinopathies that recapitulates a mutation associated with a benign genetic condition, Nature Medicine volume 22, pages 987–990 (2016)) in view of Gaudelli et al. (Programmable base editing of A•T to G•C in genomic DNA without DNA cleavage, Nature, 551, pages 464–471 (2017)), Martyn et al. (Natural regulatory mutations elevate the fetal globin gene via disruption of BCL11A or ZBTB7A binding, Nature Genetics volume 50, pages 498–503 (2018)), Hendel et al. (Chemically modified guide RNAs enhance CRISPR-Cas genome editing in human primary cells, Nature Biotechnology volume 33, pages985–989 (2015)), Andries et al. (N1-methylpseudouridine-incorporated mRNA outperforms pseudouridine-incorporated mRNA by providing enhanced protein expression and reduced immunogenicity in mammalian cell lines and mice, Journal of Controlled Release, 217:337-344 (2015)) and KSR International Co. v. Teleflex Inc., 550 U.S.--, 82 USPQ2d 1385 (2007).
The instant claims are drawn to a method of producing a cell for treating sickle cell disease or beta thalassemia in a subject in need thereof, the method comprising: contacting the cell with a base editor, or mRNA encoding the base editor, wherein the base editor comprises a polynucleotide-programmable nucleotide-binding domain and an adenosine deaminase domain or a cytidine deaminase domain, and a guide RNA (gRNA); binding the gRNA in conjunction with the base editor to a target nucleotide sequence in the cell located in a regulatory region of an HBG1 and/or HBG2 gene; and editing a nucleobase of the target nucleotide sequence by deaminating the nucleobase upon the binding of the gRNA to the target nucleotide sequence, thereby producing the cell for treating the sickle cell anemia or beta thalassemia by changing the nucleobase to another nucleobase, wherein the nucleobase is located in c. -114 ~-102 of the HBG1 and/or HBG2 gene, and/or wherein the target nucleotide sequence comprises a nucleotide sequence selected from CTTGACCAATAGCCTTGACAAGG (SEQ ID NO: 238; gRNA1), GCTATTGGTCAAGGCAAGGC (SEQ ID NO: 240; gRNA4), and AAGTTTGCCTTGTCAAGGCTATTGGT (SEQ ID NO: 245; gRNA45).
Traxler et al. teach a method of producing a cell for treating sickle cell disease or beta thalassemia, the method comprising: contacting the cell, i.e., human hematopoietic progenitor cell which inherently comprise CD34+, with a base editor, i.e., Cas9, and a guide RNA (gRNA); binding the gRNA in conjunction with the Cas9 to a target nucleotide sequence in the cell located in a regulatory region of an HBG1 and/or HBG2 gene; and editing the target nucleotide sequence upon the binding of the gRNA to the target nucleotide sequence, thereby producing the cell for treating the sickle cell anemia or beta thalassemia by deleting c. -114 ~-102 of the HBG1 and/or HBG2 gene, and/or wherein the target nucleotide sequence comprises a nucleotide sequence selected from CTTGACCAATAGCCTTGACAAGG, which is identical to Applicants’ SEQ ID NO: 238 (see abstract, para under the abstract, Figures 1 & 2 on pages 988-989).
It is noted by the Examiner that the gRNA comprising Applicants’ SEQ ID NO: 176 would be obvious because SEQ ID NO: 176 is the RNA equivalent of the DNA target sequence of SEQ ID NO: 238 already mapped onto by Traxler et al. Therefore, it is an obvious gRNA design of the already known 13-nt site.
Traxler et al. do not teach a fusion of Cas9 nickase to TadA deaminase (adenosine deaminase).
Gaudelli et al. teach a method of using a fusion of Cas9 D10A nickase to TadA deaminase (adenosine deaminase) with gRNA or sRNA to deaminate the target nucleobase, thereby producing A·T to G·C base (see page 464; and Figure 1 on page 465). It is noted by the Examiner that the TadA deaminase taught by Gaudelli et al. is identical to TadA deaminase, and therefore, said TadA deaminase inherently comprises the identical amino acid sequence as shown in claim 42.
Martyn et al. teach that TGACCA present in the Applicants’ target sequence of SEQ ID NO: 238 is critical for BCL11A binding (see Fig. 4a, red highlighted sequence under “center of peak”), and confirms that single base change within that target site is therapeutic.
Hendel et al. teach the synthesis of sgRNAs with 2’-O-methyl (M) modifications incorporated at three terminal nucleotides at both the 5’ and 3’ ends (see Fig. 1a on page 986). Hendel et al. teach that such modifications increase guide RNA stability and editing in primary CD34+ cells compared to unmodified gRNA (see abstract and entire text).
Andries et al. teach that N1MePseudoU modified mRNA increases protein expression and reduces innate-immune activation relative to unmodified mRNA (see abstract and pages 338-341).
It would have been obvious to a person of ordinary skill in the art (POSITA) prior to the effective filing date of the instant application to practice the method taught by Traxler et al. and replace Cas9 with the fusion of Cas9 nickase/TadA deaminase as taught by Gaudelli et al. while making modifications taught by Hendel et al. and Andries et al. to gRNA and mRNA, respectively. A POSITA would have been motivated to practice such methods because [1] the fusion taught by Gaudelli et al. changes nucleotide bases without making a double strand break thereby reducing the problem of Cas9 producing indels; [2] Martyn et al. validated that making a point mutation at the target site for binding BCL11A is ~-102 to -114 (the identical target sequence located in the promoter region of HBG1/2 as taught by Traxler et al.) is therapeutic; [3] the use of 2’-O-methyl (M) modifications taught by Hendel et al. increase guide RNA stability and editing in primary CD34+ cells; and [4] the use of N1MePseudoU modified mRNA increases protein expression and reduces innate-immune activation as taught by Andries et al.
As discussed in KSR International Co. v. Teleflex Inc., 550 U.S.--, 82 USPQ2d 1385 (2007), it is considered obvious to combine prior art elements known to be used in equivalent fields of endeavor together into a single combination. The references clearly show that all of the cited reference teach making genome editing using CRISPR/Cas9 nickase fused to TadA deaminase with gRNA, which were known to be used in the equivalent field of endeavor; thus, it is considered obvious to combine them together.
A POSITA would have had a reasonable expectation of success to practice such methods because all of the required biochemical reagents and techniques were readily available and rampantly used as evidenced by Traxler et al., Gaudelli et al., Martyn et al., Hendel et al. and Andries et al. prior to the filing of the instant application.
It is noted by the Examiner that claims 48 and 49 are included in this rejection because these claims do not add any limitations to the claimed method steps but only name the patient population and what the sickle cell disease etiology is, which is inherent in the teachings of Traxler et al. and Gaudelli et al.
For the reasons provided herein, the invention as claimed is prima facie obvious over the combined teachings of the prior art.
Conclusion
Claims 39-50 and 52-58 are rejected for the reasons as stated above. Applicants must respond to the objections/rejections in this Office action to be fully responsive in prosecution.
The instant Office action is non-final.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JAE W LEE whose telephone number is (571)272-9949. The examiner can normally be reached on M-F between 9:00-6:00.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Manjunath Rao can be reached on (571)272-0939. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JAE W LEE/
Examiner, Art Unit 1656
/MANJUNATH N RAO/Supervisory Patent Examiner, Art Unit 1656
