Prosecution Insights
Last updated: October 02, 2026
Application No. 18/819,661

TRANSGENIC BRASSICA EVENT MON 88302 AND METHODS OF USE THEREOF

Non-Final OA §102§112§DOUBLEPATENT
Filed
Aug 29, 2024
Priority
Jun 04, 2010 — provisional 61/351,317 +5 more
Examiner
KOVALENKO, MYKOLA V
Art Unit
1662
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Monsanto Technology LLC
OA Round
1 (Non-Final)
70%
Grant Probability
Favorable
1-2
OA Rounds
1y 2m
Est. Remaining
95%
With Interview

Examiner Intelligence

Grants 70% — above average
70%
Career Allowance Rate
380 granted / 547 resolved
+9.5% vs TC avg
Strong +26% interview lift
Without
With
+25.8%
Interview Lift
resolved cases with interview
Typical timeline
3y 3m
Avg Prosecution
37 currently pending
Career history
584
Total Applications
across all art units

Statute-Specific Performance

§101
4.0%
-36.0% vs TC avg
§103
35.1%
-4.9% vs TC avg
§102
10.5%
-29.5% vs TC avg
§112
38.3%
-1.7% vs TC avg
Black line = Tech Center average estimate • Based on career data from 547 resolved cases

Office Action

§102 §112 §DOUBLEPATENT
DETAILED ACTION Notice of Pre-AIA or AIA Status 1. The present application is being examined under the pre-AIA first to invent provisions. Status of the Claims 2. Claims 1-5, 12-17, and 26-34 are pending. 3. Claims 12-17 and 30-34 are withdrawn. 4. Claims 1-5 and 26-29 are examined. Election/Restrictions 5. Applicant’s election of Group I, claims 1-5 and 26-29 in the reply filed on June 18, 2026 is acknowledged. Because Applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)).Claims 12-17 and 30-34 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on June 18, 2026. Specification 6. The disclosure is objected to because on page 1, paragraph 1, Applicant claims “benefit of priority” of a US provisional application. Applicant cannot claim priority to a provisional application, only benefit of a provisional application. Claim Objections 7. In claims 1 and 2, the antecedent for the term “or a complement thereof” is ambiguous. The claim should be amended to clearly indicate that the term refers to SEQ ID NO: 6. In claims 27 and 28, the units for dosages should be clearly recited as pounds of acid equivalent or active ingredient per acre. Appropriate correction is required. Claim Interpretation 8. The following is noted with regard to claim interpretation. In claims 1 and 2, the term “a complement thereof,” due to the use of the indefinite article, is given its broadest reasonable interpretation as not being limited to the full length SEQ ID NO: 6, but instead comprising any number of nucleotides complementary to a portion of SEQ ID NO: 6. The values of glyphosate application rates recited in claims 27 and 28 are interpreted as encompassing either ai/acre or ae/acre. Claim Rejections - 35 USC § 112 - New Matter 9. The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. 10. Claim 5 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. Claim 5 is directed to an amplicon comprising the DNA molecule of claim 1, which molecule comprises SEQ ID NO: 6. SEQ ID NO: 6 is the full-length nucleic acid of Brassica event MON 88302 and is 6,126 nucleotides long (see Sequence Listing). While the specificaiton does describe “amplicons” diagnostic for event MON 88302 that comprise oligonucleotides encompassing the 5’ and 3’ junction regions, the specification does not provide express or implied written support for an amplicon comprising the entire event. The term “amplicon” indicates that a nucleic acid sequence has been obtained using an amplification reaction. However, the state of the art indicates that attempting to amplify a region that is as large as the 6,126 bp-long SEQ ID NO: 6 would be far from routine. See for example, Gryson (Anal. Bioanal. Chem (2010) 396:2003-2022; see Abstract; pg. 2010, both col.), discussed below in the scope of enablement rejection. Thus, describing the DNA molecule of the full-length SEQ ID NO: 6 itself is not sufficient to provide written support for an “amplicon” of that length. For these reasons, the claim contains New Matter. Claim Rejections - 35 USC § 112 - Scope of Enablement 11. The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. 12. Claims 3-5 and 26-29 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for a Brassica napus plant comprising event MON 88302, which event is represented by the full-length SEQ ID NO: 6, and for methods of using said Brassica plant, does not reasonably provide enablement for the invention as broadly claimed, including a Brassica plant or part thereof comprising a sequence having 95% identity to SEQ ID NO: 6. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make or use the invention commensurate in scope with these claims. In re Wands, 858 F.2d 731 (Fed. Cir. 1988) lists the following eight factors for determining whether undue experimentation would be required to practice an invention: (1) quantity of experimentation necessary; (2) amount of direction or guidance supplied; (3) presence or absence of working examples; (4) nature of the invention; (5) state of the prior art; (6) relative skill of those in the art; (7) predictability or unpredictability or the prior art; (8) breadth of the claims. Applicant claims a Brassica plant, plant cell, seed, or progeny plant, plant part, or commodity product, comprising the DNA molecule comprising a nucleotide sequence having at least 95% sequence identity to SEQ ID NO: 6. Applicant claims an amplicon comprising SEQ ID NO: 6. Applicant claims a method for controlling weeds in a field comprising plant comprising said DNA molecule. Applicant teaches Brassica napus plants comprising event MON 88302 deposited with the ATCC under Accession Number PTA-10955. Applicant teaches that SEQ ID NO: 6 represents the full-length of the event, comprised of the 5’ and 3’ genomic flanking regions and the inserted DNA of the transgene (SEQ ID NO: 3), which comprises the CP4 EPSPS gens (See Brief Description of the Sequences on pages 5-8; Example 1). Applicant teaches identifying event MON 88302 in the progeny of the plants grown from the seed deposited at the ATCC under Accession number PTA-10955 (Example 5, beginning at pg. 42; Fig. 2). Applicant does not teach how to use a Brassica plant comprising a DNA molecule having only 95% sequence identity to the instant SEQ ID NO: 6. Applicant does not teach how to make or use a plant comprising said DNA molecule wherein the plant is other than Brassica napus. The specification indicates that the enablement of the present invention is limited to event MON 88302 and the Brassica plants obtained using the plants comprising event MON 88302 seed deposited ATCC under Accession number PTA-10955, and to the full-length DNA molecules comprising said event. The disclosure teaches that an event refers to a DNA molecule, which is an integral part of the Brassica chromosome, where the DNA was “produced as a result of inserting transgenic DNA into a plant’s genome at a particular location on a chromosome” (pg. 8, lines 9-11 of the specification, for example). Thus, the site at which the incorporation occurs is unpredictable. The unpredictability of the transgene incorporation site within the Brassica genome and the fixed nature of the event do not permit variability in the sequence of the event by percent identity, as claimed. The unpredictability of being able to use the genus of plants encompassed by the claims is borne out by the state of the prior art. For example, Devine teaches that the development of a transgenic event with acceptable properties is much more complex than merely obtaining a transformant, and involves the screening of a large population of transgenic plants to eliminate those that do not meet the molecular requirements (Pest Manag. Sci. (2005) 61:312-317; pg. 314, right col. - pg. 315 left col). Moreover, even if one were to use the Brassica napus plants of the deposit, which comprise event MON 88302, it would be unpredictable to attempt to introgress the event into a Brassica plant, for the following reason. The specification teaches that “Event MON 88302 refers to the DNA molecules produced as a result of the insertion of transgenic DNA having a sequence provided herein as SEQ ID NO: 5 into a particular location in the Brassica napus A genome on linkage group N4” (pg. 8, paragraph 37). The art teaches that not all Brassica species share genome A with B. napus. For example, Gingera et al teach that Brassica oleraceae is a diploid with only a C genome, B. nigra is a diploid with has only a B genome, and B. carinata is an amphidiploid with B and C genomes, but not A genome (Gingera et al, US Patent 6,613,963, Fig. 1). It is also well-known in the art that introgressing a gene from, for example, the A-genome of Brassica napus onto the B or the C genomes is difficult to achieve. Gingera et al teach that “it is extremely rare to have pairing of A and B or A and C” genomes. The “pairing may be forced by repeated crossing and careful selection of plant phenotype during breeding although there is no expectation that a trait from one genome may be combined with a trait from the other genome” (col. 3, lines 5-12). This indicates that attempting to introgress event MON 88302 from the A genome of Brassica napus, where it is present, onto a B or a C genome of other Brassicas would have been highly unpredictable. Applicant has not provided any examples of introgressing event MON 88302 into any Brassica species besides Brassica napus. For this additional reason, it would be unpredictable to practice the instant invention as broadly claimed. Finally, the specificaiton has not reduced to practice any “amplicons” comprising the entire SEQ ID NO: 6. The teachings of the prior art indicate that it would be unpredictable to attempt to amplify a contiguous genomic region that is over 6,000 nucleotides long. For example, Gryson teaches that “The number of cycles, the amplicon length, and the amount of DNA added to the PCR will affect detection and quantification limits. Preference should be given to short amplicons of 150 bp maximum” (Anal. Bioanal. Chem (2010) 396:2003-2022; see Abstract; pg. 2010, both col.; page 2018, left col., emphasis supplied). This is consistent with the instant specificaiton, which teaches that an amplicon “of the present invention comprises at least about 40 contiguous nucleotides of SEQ ID NO: 1 or SEQ ID NO: 2” (page 12). SEQ ID NO’s 1 and 2 are 60-mers encompassing the 5’ and 3’ junctions between the transgene of the events and the genomic flanking regions (see page 5). Given limited guidance supplied by Applicant, the breadth of the claims and the nature of the invention, as well as the unpredictability in the art, it would have required one skilled in the art undue trial and error experimentation to practice the claimed invention through the full scope of the claims. Claim Rejections - 35 USC § 102 13. The following is a quotation of the appropriate paragraphs of pre-AIA 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (b) the invention was patented or described in a printed publication in this or a foreign country or in public use or on sale in this country, more than one year prior to the date of application for patent in the United States. 14. Claims 1-5 and 26-29 are rejected under pre-AIA 35 U.S.C. 102(b) as being anticipated by Malven et al (US Patent No: 7,632,985, issued on December 15, 2009). As set forth above, claims 1 and 2 do not require that “a complement” be of the full-length SEQ ID NO: 6, and will thus encompass DNA sequences with only partial identity to SEQ ID NO: 6. It is also noted that the glyphosate application dosages recited in claims 27 and 28, due to the use of the term “about,” will encompass values from below 0.125 to above 6.4 lb/A. Malven et al disclose a soybean plants and parts thereof comprising event MON89788, wherein SEQ ID NO: 9 represents the full-length sequence of the event (Abstract; Fig. 1; Table 3, Example 2; claims 1-10). SEQ ID NO: 9 of Malven et al has 70.3% sequence identity to the instant SEQ ID NO: 6 over nucleotides 780-5094 of the latter. The sequence alignment is set forth below. Sequence 9, US/11441914 Patent No. 7632985 GENERAL INFORMATION APPLICANT: Malven, Marianne APPLICANT: Rinehart, Jennifer APPLICANT: Taylor, Nancy APPLICANT: Dickinson, Ellen TITLE OF INVENTION: SOYBEAN EVENT MON89788 AND METHODS TITLE OF INVENTION: FOR DETECTION THEREOF FILE REFERENCE: MONS:113US CURRENT APPLICATION NUMBER: US/11/441,914 CURRENT FILING DATE: 2006-05-26 PRIOR APPLICATION NUMBER: 60/685,584 PRIOR FILING DATE: 2005-05-27 NUMBER OF SEQ ID NOS: 22 SEQ ID NO 9 LENGTH: 6466 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: NAME/KEY: misc_feature LOCATION: (1)..(6466) OTHER INFORMATION: Chimeric DNA molecule of soybean genomic DNA and transgene insert Query Match 70.3%; Score 4305.4; Length 6466; Best Local Similarity 99.9%; Matches 4309; Conservative 0; Mismatches 6; Indels 0; Gaps 0; Qy 780 GTTGTACCACTTCAAACACTGATAGTTTAAACTGAAGGCGGGAAACGACAATCTGATCCC 839 ||| | || |||||||||||||||||||||||||||||||||||||||||||||||| Db 1092 GTTATCAAGCTCCAAACACTGATAGTTTAAACTGAAGGCGGGAAACGACAATCTGATCCC 1151 Qy 840 CATCAAGCTCTAGCTAGAGCGGCCGCGTTATCAAGCTTCTGCAGGTCCTGCTCGAGTGGA 899 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1152 CATCAAGCTCTAGCTAGAGCGGCCGCGTTATCAAGCTTCTGCAGGTCCTGCTCGAGTGGA 1211 Qy 900 AGCTAATTCTCAGTCCAAAGCCTCAACAAGGTCAGGGTACAGAGTCTCCAAACCATTAGC 959 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1212 AGCTAATTCTCAGTCCAAAGCCTCAACAAGGTCAGGGTACAGAGTCTCCAAACCATTAGC 1271 Qy 960 CAAAAGCTACAGGAGATCAATGAAGAATCTTCAATCAAAGTAAACTACTGTTCCAGCACA 1019 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1272 CAAAAGCTACAGGAGATCAATGAAGAATCTTCAATCAAAGTAAACTACTGTTCCAGCACA 1331 Qy 1020 TGCATCATGGTCAGTAAGTTTCAGAAAAAGACATCCACCGAAGACTTAAAGTTAGTGGGC 1079 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1332 TGCATCATGGTCAGTAAGTTTCAGAAAAAGACATCCACCGAAGACTTAAAGTTAGTGGGC 1391 Qy 1080 ATCTTTGAAAGTAATCTTGTCAACATCGAGCAGCTGGCTTGTGGGGACCAGACAAAAAAG 1139 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1392 ATCTTTGAAAGTAATCTTGTCAACATCGAGCAGCTGGCTTGTGGGGACCAGACAAAAAAG 1451 Qy 1140 GAATGGTGCAGAATTGTTAGGCGCACCTACCAAAAGCATCTTTGCCTTTATTGCAAAGAT 1199 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1452 GAATGGTGCAGAATTGTTAGGCGCACCTACCAAAAGCATCTTTGCCTTTATTGCAAAGAT 1511 Qy 1200 AAAGCAGATTCCTCTAGTACAAGTGGGGAACAAAATAACGTGGAAAAGAGCTGTCCTGAC 1259 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1512 AAAGCAGATTCCTCTAGTACAAGTGGGGAACAAAATAACGTGGAAAAGAGCTGTCCTGAC 1571 Qy 1260 AGCCCACTCACTAATGCGTATGACGAACGCAGTGACGACCACAAAAGAATTAGCTTGAGC 1319 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1572 AGCCCACTCACTAATGCGTATGACGAACGCAGTGACGACCACAAAAGAATTAGCTTGAGC 1631 Qy 1320 TCAGGATTTAGCAGCATTCCAGATTGGGTTCAATCAACAAGGTACGAGCCATATCACTTT 1379 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1632 TCAGGATTTAGCAGCATTCCAGATTGGGTTCAATCAACAAGGTACGAGCCATATCACTTT 1691 Qy 1380 ATTCAAATTGGTATCGCCAAAACCAAGAAGGAACTCCCATCCTCAAAGGTTTGTAAGGAA 1439 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1692 ATTCAAATTGGTATCGCCAAAACCAAGAAGGAACTCCCATCCTCAAAGGTTTGTAAGGAA 1751 Qy 1440 GAATTCGATATCAAGCTTGATATCGGAAGTTTCTCTCTTGAGGGAGGTTGCTCGTGGAAT 1499 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1752 GAATTCGATATCAAGCTTGATATCGGAAGTTTCTCTCTTGAGGGAGGTTGCTCGTGGAAT 1811 Qy 1500 GGGACACATATGGTTGTTATAATAAACCATTTCCATTGTCATGAGATTTTGAGGTTAATA 1559 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1812 GGGACACATATGGTTGTTATAATAAACCATTTCCATTGTCATGAGATTTTGAGGTTAATA 1871 Qy 1560 TATACTTTACTTGTTCATTATTTTATTTGGTGTTTGAATAAATGATATAAATGGCTCTTG 1619 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1872 TATACTTTACTTGTTCATTATTTTATTTGGTGTTTGAATAAATGATATAAATGGCTCTTG 1931 Qy 1620 ATAATCTGCATTCATTGAGATATCAAATATTTACTCTAGAGAAGAGTGTCATATAGATTG 1679 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1932 ATAATCTGCATTCATTGAGATATCAAATATTTACTCTAGAGAAGAGTGTCATATAGATTG 1991 Qy 1680 ATGGTCCACAATCAATGAAATTTTTGGGAGACGAACATGTATAACCATTTGCTTGAATAA 1739 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1992 ATGGTCCACAATCAATGAAATTTTTGGGAGACGAACATGTATAACCATTTGCTTGAATAA 2051 Qy 1740 CCTTAATTAAAAGGTGTGATTAAATGATGTTTGTAACATGTAGTACTAAACATTCATAAA 1799 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2052 CCTTAATTAAAAGGTGTGATTAAATGATGTTTGTAACATGTAGTACTAAACATTCATAAA 2111 Qy 1800 ACACAACCAACCCAAGAGGTATTGAGTATTCACGGCTAAACAGGGGCATAATGGTAATTT 1859 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2112 ACACAACCAACCCAAGAGGTATTGAGTATTCACGGCTAAACAGGGGCATAATGGTAATTT 2171 Qy 1860 AAAGAATGATATTATTTTATGTTAAACCCTAACATTGGTTTCGGATTCAACGCTATAAAT 1919 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2172 AAAGAATGATATTATTTTATGTTAAACCCTAACATTGGTTTCGGATTCAACGCTATAAAT 2231 Qy 1920 AAAACCACTCTCGTTGCTGATTCCATTTATCGTTCTTATTGACCCTAGCCGCTACACACT 1979 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2232 AAAACCACTCTCGTTGCTGATTCCATTTATCGTTCTTATTGACCCTAGCCGCTACACACT 2291 Qy 1980 TTTCTGCGATATCTCTGAGGTAAGCGTTAACGTACCCTTAGATCGTTCTTTTTCTTTTTC 2039 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2292 TTTCTGCGATATCTCTGAGGTAAGCGTTAACGTACCCTTAGATCGTTCTTTTTCTTTTTC 2351 Qy 2040 GTCTGCTGATCGTTGCTCATATTATTTCGATGATTGTTGGATTCGATGCTCTTTGTTGAT 2099 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2352 GTCTGCTGATCGTTGCTCATATTATTTCGATGATTGTTGGATTCGATGCTCTTTGTTGAT 2411 Qy 2100 TGATCGTTCTGAAAATTCTGATCTGTTGTTTAGATTTTATCGATTGTTAATATCAACGTT 2159 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2412 TGATCGTTCTGAAAATTCTGATCTGTTGTTTAGATTTTATCGATTGTTAATATCAACGTT 2471 Qy 2160 TCACTGCTTCTAAACGATAATTTATTCATGAAACTATTTTCCCATTCTGATCGATCTTGT 2219 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2472 TCACTGCTTCTAAACGATAATTTATTCATGAAACTATTTTCCCATTCTGATCGATCTTGT 2531 Qy 2220 TTTGAGATTTTAATTTGTTCGATTGATTGTTGGTTGGTGGATCTATATACGAGTGAACTT 2279 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2532 TTTGAGATTTTAATTTGTTCGATTGATTGTTGGTTGGTGGATCTATATACGAGTGAACTT 2591 Qy 2280 GTTGATTTGCGTATTTAAGATGTATGTCGATTTGAATTGTGATTGGGTAATTCTGGAGTA 2339 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2592 GTTGATTTGCGTATTTAAGATGTATGTCGATTTGAATTGTGATTGGGTAATTCTGGAGTA 2651 Qy 2340 GCATAACAAATCCAGTGTTCCCTTTTTCTAAGGGTAATTCTCGGATTGTTTGCTTTATAT 2399 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2652 GCATAACAAATCCAGTGTTCCCTTTTTCTAAGGGTAATTCTCGGATTGTTTGCTTTATAT 2711 Qy 2400 CTCTTGAAATTGCCGATTTGATTGAATTTAGCTCGCTTAGCTCAGATGATAGAGCACCAC 2459 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2712 CTCTTGAAATTGCCGATTTGATTGAATTTAGCTCGCTTAGCTCAGATGATAGAGCACCAC 2771 Qy 2460 AATTTTTGTGGTAGAAATCGGTTTGACTCCGATAGCGGCTTTTTACTATGATTGTTTTGT 2519 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2772 AATTTTTGTGGTAGAAATCGGTTTGACTCCGATAGCGGCTTTTTACTATGATTGTTTTGT 2831 Qy 2520 GTTAAAGATGATTTTCATAATGGTTATATATGTCTACTGTTTTTATTGATTCAATATTTG 2579 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2832 GTTAAAGATGATTTTCATAATGGTTATATATGTCTACTGTTTTTATTGATTCAATATTTG 2891 Qy 2580 ATTGTTCTTTTTTTTGCAGATTTGTTGACCAGAGATCTACCATGGCGCAAGTTAGCAGAA 2639 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2892 ATTGTTCTTTTTTTTGCAGATTTGTTGACCAGAGATCTACCATGGCGCAAGTTAGCAGAA 2951 Qy 2640 TCTGCAATGGTGTGCAGAACCCATCTCTTATCTCCAATCTCTCGAAATCCAGTCAACGCA 2699 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2952 TCTGCAATGGTGTGCAGAACCCATCTCTTATCTCCAATCTCTCGAAATCCAGTCAACGCA 3011 Qy 2700 AATCTCCCTTATCGGTTTCTCTGAAGACGCAGCAGCATCCACGAGCTTATCCGATTTCGT 2759 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3012 AATCTCCCTTATCGGTTTCTCTGAAGACGCAGCAGCATCCACGAGCTTATCCGATTTCGT 3071 Qy 2760 CGTCGTGGGGATTGAAGAAGAGTGGGATGACGTTAATTGGCTCTGAGCTTCGTCCTCTTA 2819 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3072 CGTCGTGGGGATTGAAGAAGAGTGGGATGACGTTAATTGGCTCTGAGCTTCGTCCTCTTA 3131 Qy 2820 AGGTCATGTCTTCTGTTTCCACGGCGTGCATGCTTCACGGTGCAAGCAGCCGTCCAGCAA 2879 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3132 AGGTCATGTCTTCTGTTTCCACGGCGTGCATGCTTCACGGTGCAAGCAGCCGTCCAGCAA 3191 Qy 2880 CTGCTCGTAAGTCCTCTGGTCTTTCTGGAACCGTCCGTATTCCAGGTGACAAGTCTATCT 2939 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3192 CTGCTCGTAAGTCCTCTGGTCTTTCTGGAACCGTCCGTATTCCAGGTGACAAGTCTATCT 3251 Qy 2940 CCCACAGGTCCTTCATGTTTGGAGGTCTCGCTAGCGGTGAAACTCGTATCACCGGTCTTT 2999 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3252 CCCACAGGTCCTTCATGTTTGGAGGTCTCGCTAGCGGTGAAACTCGTATCACCGGTCTTT 3311 Qy 3000 TGGAAGGTGAAGATGTTATCAACACTGGTAAGGCTATGCAAGCTATGGGTGCCAGAATCC 3059 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3312 TGGAAGGTGAAGATGTTATCAACACTGGTAAGGCTATGCAAGCTATGGGTGCCAGAATCC 3371 Qy 3060 GTAAGGAAGGTGATACTTGGATCATTGATGGTGTTGGTAACGGTGGACTCCTTGCTCCTG 3119 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3372 GTAAGGAAGGTGATACTTGGATCATTGATGGTGTTGGTAACGGTGGACTCCTTGCTCCTG 3431 Qy 3120 AGGCTCCTCTCGATTTCGGTAACGCTGCAACTGGTTGCCGTTTGACTATGGGTCTTGTTG 3179 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3432 AGGCTCCTCTCGATTTCGGTAACGCTGCAACTGGTTGCCGTTTGACTATGGGTCTTGTTG 3491 Qy 3180 GTGTTTACGATTTCGATAGCACTTTCATTGGTGACGCTTCTCTCACTAAGCGTCCAATGG 3239 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3492 GTGTTTACGATTTCGATAGCACTTTCATTGGTGACGCTTCTCTCACTAAGCGTCCAATGG 3551 Qy 3240 GTCGTGTGTTGAACCCACTTCGCGAAATGGGTGTGCAGGTGAAGTCTGAAGACGGTGATC 3299 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3552 GTCGTGTGTTGAACCCACTTCGCGAAATGGGTGTGCAGGTGAAGTCTGAAGACGGTGATC 3611 Qy 3300 GTCTTCCAGTTACCTTGCGTGGACCAAAGACTCCAACGCCAATCACCTACAGGGTACCTA 3359 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3612 GTCTTCCAGTTACCTTGCGTGGACCAAAGACTCCAACGCCAATCACCTACAGGGTACCTA 3671 Qy 3360 TGGCTTCCGCTCAAGTGAAGTCCGCTGTTCTGCTTGCTGGTCTCAACACCCCAGGTATCA 3419 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3672 TGGCTTCCGCTCAAGTGAAGTCCGCTGTTCTGCTTGCTGGTCTCAACACCCCAGGTATCA 3731 Qy 3420 CCACTGTTATCGAGCCAATCATGACTCGTGACCACACTGAAAAGATGCTTCAAGGTTTTG 3479 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3732 CCACTGTTATCGAGCCAATCATGACTCGTGACCACACTGAAAAGATGCTTCAAGGTTTTG 3791 Qy 3480 GTGCTAACCTTACCGTTGAGACTGATGCTGACGGTGTGCGTACCATCCGTCTTGAAGGTC 3539 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3792 GTGCTAACCTTACCGTTGAGACTGATGCTGACGGTGTGCGTACCATCCGTCTTGAAGGTC 3851 Qy 3540 GTGGTAAGCTCACCGGTCAAGTGATTGATGTTCCAGGTGATCCATCCTCTACTGCTTTCC 3599 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3852 GTGGTAAGCTCACCGGTCAAGTGATTGATGTTCCAGGTGATCCATCCTCTACTGCTTTCC 3911 Qy 3600 CATTGGTTGCTGCCTTGCTTGTTCCAGGTTCCGACGTCACCATCCTTAACGTTTTGATGA 3659 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3912 CATTGGTTGCTGCCTTGCTTGTTCCAGGTTCCGACGTCACCATCCTTAACGTTTTGATGA 3971 Qy 3660 ACCCAACCCGTACTGGTCTCATCTTGACTCTGCAGGAAATGGGTGCCGACATCGAAGTGA 3719 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3972 ACCCAACCCGTACTGGTCTCATCTTGACTCTGCAGGAAATGGGTGCCGACATCGAAGTGA 4031 Qy 3720 TCAACCCACGTCTTGCTGGTGGAGAAGACGTGGCTGACTTGCGTGTTCGTTCTTCTACTT 3779 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4032 TCAACCCACGTCTTGCTGGTGGAGAAGACGTGGCTGACTTGCGTGTTCGTTCTTCTACTT 4091 Qy 3780 TGAAGGGTGTTACTGTTCCAGAAGACCGTGCTCCTTCTATGATCGACGAGTATCCAATTC 3839 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4092 TGAAGGGTGTTACTGTTCCAGAAGACCGTGCTCCTTCTATGATCGACGAGTATCCAATTC 4151 Qy 3840 TCGCTGTTGCAGCTGCATTCGCTGAAGGTGCTACCGTTATGAACGGTTTGGAAGAACTCC 3899 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4152 TCGCTGTTGCAGCTGCATTCGCTGAAGGTGCTACCGTTATGAACGGTTTGGAAGAACTCC 4211 Qy 3900 GTGTTAAGGAAAGCGACCGTCTTTCTGCTGTCGCAAACGGTCTCAAGCTCAACGGTGTTG 3959 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4212 GTGTTAAGGAAAGCGACCGTCTTTCTGCTGTCGCAAACGGTCTCAAGCTCAACGGTGTTG 4271 Qy 3960 ATTGCGATGAAGGTGAGACTTCTCTCGTCGTGCGTGGTCGTCCTGACGGTAAGGGTCTCG 4019 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4272 ATTGCGATGAAGGTGAGACTTCTCTCGTCGTGCGTGGTCGTCCTGACGGTAAGGGTCTCG 4331 Qy 4020 GTAACGCTTCTGGAGCAGCTGTCGCTACCCACCTCGATCACCGTATCGCTATGAGCTTCC 4079 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4332 GTAACGCTTCTGGAGCAGCTGTCGCTACCCACCTCGATCACCGTATCGCTATGAGCTTCC 4391 Qy 4080 TCGTTATGGGTCTCGTTTCTGAAAACCCTGTTACTGTTGATGATGCTACTATGATCGCTA 4139 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4392 TCGTTATGGGTCTCGTTTCTGAAAACCCTGTTACTGTTGATGATGCTACTATGATCGCTA 4451 Qy 4140 CTAGCTTCCCAGAGTTCATGGATTTGATGGCTGGTCTTGGAGCTAAGATCGAACTCTCCG 4199 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4452 CTAGCTTCCCAGAGTTCATGGATTTGATGGCTGGTCTTGGAGCTAAGATCGAACTCTCCG 4511 Qy 4200 ACACTAAGGCTGCTTGATGAGCTCAAGAATTCGAGCTCGGTACCGGATCCTCTAGCTAGA 4259 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4512 ACACTAAGGCTGCTTGATGAGCTCAAGAATTCGAGCTCGGTACCGGATCCTCTAGCTAGA 4571 Qy 4260 GCTTTCGTTCGTATCATCGGTTTCGACAACGTTCGTCAAGTTCAATGCATCAGTTTCATT 4319 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4572 GCTTTCGTTCGTATCATCGGTTTCGACAACGTTCGTCAAGTTCAATGCATCAGTTTCATT 4631 Qy 4320 GCGCACACACCAGAATCCTACTGAGTTTGAGTATTATGGCATTGGGAAAACTGTTTTTCT 4379 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4632 GCGCACACACCAGAATCCTACTGAGTTTGAGTATTATGGCATTGGGAAAACTGTTTTTCT 4691 Qy 4380 TGTACCATTTGTTGTGCTTGTAATTTACTGTGTTTTTTATTCGGTTTTCGCTATCGAACT 4439 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4692 TGTACCATTTGTTGTGCTTGTAATTTACTGTGTTTTTTATTCGGTTTTCGCTATCGAACT 4751 Qy 4440 GTGAAATGGAAATGGATGGAGAAGAGTTAATGAATGATATGGTCCTTTTGTTCATTCTCA 4499 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4752 GTGAAATGGAAATGGATGGAGAAGAGTTAATGAATGATATGGTCCTTTTGTTCATTCTCA 4811 Qy 4500 AATTAATATTATTTGTTTTTTCTCTTATTTGTTGTGTGTTGAATTTGAAATTATAAGAGA 4559 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4812 AATTAATATTATTTGTTTTTTCTCTTATTTGTTGTGTGTTGAATTTGAAATTATAAGAGA 4871 Qy 4560 TATGCAAACATTTTGTTTTGAGTAAAAATGTGTCAAATCGTGGCCTCTAATGACCGAAGT 4619 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4872 TATGCAAACATTTTGTTTTGAGTAAAAATGTGTCAAATCGTGGCCTCTAATGACCGAAGT 4931 Qy 4620 TAATATGAGGAGTAAAACACTTGTAGTTGTACCATTATGCTTATTCACTAGGCAACAAAT 4679 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4932 TAATATGAGGAGTAAAACACTTGTAGTTGTACCATTATGCTTATTCACTAGGCAACAAAT 4991 Qy 4680 ATATTTTCAGACCTAGAAAAGCTGCAAATGTTACTGAATACAAGTATGTCCTCTTGTGTT 4739 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4992 ATATTTTCAGACCTAGAAAAGCTGCAAATGTTACTGAATACAAGTATGTCCTCTTGTGTT 5051 Qy 4740 TTAGACATTTATGAACTTTCCTTTATGTAATTTTCCAGAATCCTTGTCAGATTCTAATCA 4799 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5052 TTAGACATTTATGAACTTTCCTTTATGTAATTTTCCAGAATCCTTGTCAGATTCTAATCA 5111 Qy 4800 TTGCTTTATAATTATAGTTATACTCATGGATTTGTAGTTGAGTATGAAAATATTTTTTAA 4859 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5112 TTGCTTTATAATTATAGTTATACTCATGGATTTGTAGTTGAGTATGAAAATATTTTTTAA 5171 Qy 4860 TGCATTTTATGACTTGCCAATTGATTGACAACATGCATCAATCGACCTGCAGCCACTCGA 4919 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5172 TGCATTTTATGACTTGCCAATTGATTGACAACATGCATCAATCGACCTGCAGCCACTCGA 5231 Qy 4920 AGCGGCCGCATCGATCGTGAAGTTTCTCATCTAAGCCCCCATTTGGACGTGAATGTAGAC 4979 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5232 AGCGGCCGCATCGATCGTGAAGTTTCTCATCTAAGCCCCCATTTGGACGTGAATGTAGAC 5291 Qy 4980 ACGTCGAAATAAAGATTTCCGAATTAGAATAATTTGTTTATTGCTTTCGCCTATAAATAC 5039 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5292 ACGTCGAAATAAAGATTTCCGAATTAGAATAATTTGTTTATTGCTTTCGCCTATAAATAC 5351 Qy 5040 GACGGATCGTAATTTGTCGTTTTATCAAAATGTACTTTCATTTTATAATAACGCT 5094 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5352 GACGGATCGTAATTTGTCGTTTTATCAAAATGTACTTTCATTTTATAATAACGCT 5406 Malven et al disclose that said soybean plants are tolerant to the application of glyphosate and teach a method for controlling weeds by applying glyphosate to said plants, including at up to R4 growth stage, which is beyond the 6-leaf stage, as recited in the instant claim 29 (Example 3; claims 17-19). Malven et al disclose said method for controlling the growth of weeds, wherein glyphosate is applied at the rates from about 0.25 lb ae/A to about 3 or more lb ae/A. The dosages of Malven will read on and anticipate the ranges of application rates recited in the instant claims 27-28. The method of Malven et al will also read on the instant claim 26, and the plants and DNA molecule of Malven et al will read on the DNA and plants of the instant claims 1-5. It is noted that the DNA molecule of Malven et al will inherently comprise “a complement” that will read on “a complement” of the instant SEQ ID NO: 6. For these reasons, the disclosure of Malven anticipates the limitations of the instant claims. Double Patenting 15. The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. 16. Claims 1-5 and 26-29 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 13-15, and 17-20 of U.S. Patent No. 8,816,156. Although the claims at issue are not identical, they are not patentably distinct from each other. The claims of the patent are drawn to a recombinant DNA comprising SEQ ID NO: 6; a Brassica plant comprising event MON 88302, wherein the event comprises SEQ ID NO: 6; and to a method for controlling weeds in a field comprising plants comprising event MON 88302 by applying glyphosate at doses between about 0.125 lb/acre to about 6.4 lb/acre, including wherein glyphosate is applied at beyond a 6-leaf growth stage of the plants. The instant SEQ ID NO: 6 is identical to SEQ ID NO: 6 of the ‘156 patent (see Sequence Search Results for SEQ ID NO: 6 against the Issued Patents database). The recombinant DNA molecule of the patent will thus read on the DNA molecule and amplicon of the instant claims 1-5. The MON 88302 plant of the patent represents a species of the genus of any Brassica plant comprising SEQ ID NO: 6 or “a complement thereof.” And the range and timing of the glyphosate application rates claimed in the ‘156 patent will read on the rates and timing recited in the instant claims 26-29. For these reasons, the invention of the ‘156 patent makes obvious the invention of the instant claims. 17. Claims 26-29 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1 and 2 of U.S. Patent No. 11,193,137. Although the claims at issue are not identical, they are not patentably distinct from each other. The claims of the patent are drawn to a method for controlling weeds in a field comprising planting plants comprising event MON 88302, and treating said plants, growing between the 4-6 leaf stage and the first flower stage, with an effective amount of glyphosate, including at least about 1800 g ae/ha, and one or more cumulative application between 1800 g ae/ha and 3600 g ae/ha. Given that MON 88302 comprises SEQ ID NO: 6, the steps of the method of the ‘137 patent will read on the method steps of the instant claims. Conclusion 18. No claims are allowed. 19. Any inquiry concerning this communication or earlier communications from the examiner should be directed to MYKOLA V KOVALENKO whose telephone number is (571)272-6921. The examiner can normally be reached Mon.-Fri. 9:00-5:30 PST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, BRATISLAV STANKOVIC can be reached at (571)270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /MYKOLA V. KOVALENKO/Primary Examiner, Art Unit 1662
Read full office action

Prosecution Timeline

Aug 29, 2024
Application Filed
Aug 18, 2026
Non-Final Rejection mailed — §102, §112, §DOUBLEPATENT (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12740531
SOYBEAN VARIETY '22148807'
2y 9m to grant Granted Sep 22, 2026
Patent 12742177
BRASSICA EVENT MON94100 AND METHODS OF USE THEREOF
2y 5m to grant Granted Sep 22, 2026
Patent 12721294
COTTON VARIETY 11PUJJ24
3y 7m to grant Granted Sep 01, 2026
Patent 12698508
GEMINIVIRUS RESISTANT PLANTS
6y 1m to grant Granted Aug 04, 2026
Patent 12692510
METHODS AND COMPOSITIONS FOR GENE EXPRESSION IN PLANTS
3y 4m to grant Granted Jul 28, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
70%
Grant Probability
95%
With Interview (+25.8%)
3y 3m (~1y 2m remaining)
Median Time to Grant
Low
PTA Risk
Based on 547 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month