DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claim Objections
Claims 13-15, 17, 18, and 20 are objected to because of the following informalities: these claims inconsistently refer to the “unspliced RNA molecule” or “unspliced precursor RNA molecule” based upon their antecedent basis.
Claim 13 (L2 and L3): “unspliced precursor RNA molecule” should be “unspliced RNA molecule”
Claim 14 (L1) and claim 15 (L1 and L3): “RNA molecule” should be “unspliced RNA molecule”
Claim 17 (L14), claim 18 (L3), claim 20 (L2): “RNA molecule” should be “unspliced precursor molecule”
However, the Examiner would prefer that one version was selected for use across all claims.
Appropriate correction is required.
Claim Interpretation
Claim 11 mentions a “change of fluorescence signal of the probe” and claim 17 mentions a first and second “fluorescence signal level change of the mixture”. In both instances, this is being interpreted as referring to the mechanism of the molecular beacon probe of claim 1 wherein a fluorescence change occurs upon hybridization or release of the probe from its target.
Claims 19 and 20 are both interpreted as depending from claim 18.
Claim Rejections
35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1-22 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claims 1, 6-8, 10, 12, and 13 recite the following limitations for which there is insufficient antecedent basis:
Claim 1 (L17 and L18): “…the fluorescent signal…”
Claim 6 (L1): “…the length…” (two instances)
Claim 7 (L1): “…the number…”
Claim 8 (L1): “…the melting temperature…”
Claim 10 (L1): “…the length…”
Claim 12 (L1): “…the amount…”
Claim 12 (L2): “…the efficiency…”
Claim 13 (L1 and L2): “…the level…”
Claim 13 (L2): “…the amount…”
35 USC § 112(d)
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claims 19 and 20 are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
The language of claim 19 is identical to the language of the claim from which it depends (claim 16). As a result, it does not further limit the subject matter of the claim upon which it depends.
Claim 20 refers to a method of screening anti-pathogenic compounds. However, it depends from claim 14 which is a method of monitoring RNA splicing specific to developmental processes or differentiated tissues which appears to be unrelated to the screening of anti-pathogenic compounds or any compound in general. As a result, it does not further limit the subject matter of the claim upon which it depends.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1-10 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Taveau [Taveau M, et al. Analytical biochemistry. 2002 Jun 15;305(2):227-35].
Alternative splicing of genes plays a significant role in the complexity of an organism allowing for a small number of genes to code for a significantly greater number of mRNA. As a result, evaluating spatiotemporal gene splicing and its correlation to biological events requires the development of robust and reliable methods. One such method is fluorescence-based real-time quantitative RT-PCR. By designing specific boundary-spanning probes and/or primers, RT-qPCR can be used to discriminate between the different isoforms formed by alternative splicing. Within this methodology several variations exist including the use of a DNA-binding dye (i.e. SYBR green), TaqMan probes, molecular beacons, and scorpion primers [Taveau, p227].
Taveau’s study evaluated the use of molecular beacons and scorpion primers to quantify the alternative splicing isoforms of calpain 3, a calcium-binding cysteine protease whose defects have been associated with limb-girdle muscular dystrophy type 2A. Specifically, they analyzed the alternative splicing of exon 6 (molecular beacon) and exons 15 and 16 (scorpion primers) within tissues containing a large variation in the ratio of the different transcripts [Taveau, abstract, p228].
Regarding claim 1, a diagram of how each of these probes detect their respective isoforms is replicated below [Taveau, Figure 1]. As is apparent from this diagram, Taveau teaches two nucleic acid probes each with (1) two complementary stem portions which for a hairpin when unhybridized to the probe target, (2) a loop portion which hybridizes to a splicing product and not to the pre-spliced RNA molecule, (3) fluorescent elements attached to each end of the nucleic acid, and (4) wherein hybridization results in a change in the fluorescent signal of the probe (i.e., quenched to unquenched). The sequences of these probes in Table 1 show they are nucleic acid probes.
Therefore, the molecular beacon and scorpion primer of Taveau anticipate the probe of claim 1.
PNG
media_image1.png
516
676
media_image1.png
Greyscale
Regarding claim 2, the probes are comprised of DNA [Taveau, Table 1].
Regarding claims 3 and 4, each probe has a fluorophore attached to one end and a quencher attached to the opposite end. When unbound to a target, the probe forms a hairpin loop which brings the ends in proximity to each other. This results in the quenching of the fluorophore by the quencher [Taveau, Figure 1].
Regarding claim 5, as depicted in Taveau’s Figure 1, the loop portion of each probe hybridizes to a segment of the splicing product which spans two consecutive exons.
Regarding claim 8, the melting temperature of the target specific portion of the molecular beacon is 63oC [Taveau, p228].
Regarding claims 6, 7, 9, and 10, the sequences of the probes are shown below [Taveau, Table 1]. The underlined sequences represent the loop portions which are 22 and 16 nucleotides long for the molecular beacon and scorpion primer respectively. The stem portions are all 6 nucleotides long. Between the underlined (loop) portions and one of the stem portions in each probe is a single nucleotide which is the linker. For ease of viewing, brackets are placed around these linker nucleotides.
Molecular Beacon:
CGGTCGGCTGCTCCATTGACACAATTGT[T]CGACCG
Scorpion Primer:
CCGCGG[G]GCCTTGGCACTGGCCGCCGCGG76CTCTGAGGAAGCTGAAAATACAAT
Claims 1-13 and 21 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Vargas [Vargas DY et al. Cell. 2011 Nov 23;147(5):1054-65].
While RNA transcription and splicing have long been held to be coupled, two views exist in how this coupling occurs. In one view, splicing factors are prepositioned on RNA polymerase and remove introns as they emerge; in the other view, splicing factors directly assemble on the nascent introns into productive spliceosomes such that the rate-limiting step is not splicing, but rather the completion of mRNA synthesis, processing and release. However, in order for alternative splicing to occur, it must be slowed down until all of the splice sites involved have been synthesized. The question then becomes, is processing delayed until the alternative splice sites are generated or does alternative splicing results instead in the uncoupling of splicing from transcription. While several alternatively spliced transcripts appear to result from the former, how splicing regulators impact splicing-transcription coupling for tissue and developmental stage-specific alternative splicing patterns remains unexplored [Vargas, p1054].
In order to further explore this coupling, Vargas developed a single molecule imaging approach, demonstrating that while splicing is generally tightly coupled to transcription, it is possible to uncouple the processes by introducing mutations that interfere with the recognition of key splice signals. This imaging of live cells is possible by inserting multiple sets of tandemly repeating sequences, termed “arrays”, into the pre-mRNA molecule. By designing probes to be complementary to a single repeat, multiple probes can hybridize to these arrays which increases the fluorescence of a since molecule to a detectable level. Array 1 or 2 was inserted into an artificial intron with canonical splice sites in the middle of a GFP-coding sequence and array 3 was inserted at the 3` UTR site, as depicted in Figure 1A below. [Vargas, p1055-1057, pS4].
PNG
media_image2.png
100
524
media_image2.png
Greyscale
Regarding claim 1, one type of probe used to detect these array repeats were molecular beacon probes. Molecular beacons are hairpin-shaped oligonucleotides with an internally quenched fluorophore. The loop region serves as a probe and the stem holds the fluorophore in close contact with a quencher which are attached at opposite ends of the oligonucleotide. When unbound to a target, the probes emit no fluorescence. Upon hybridization, the stem regions separate which consequently separates the quencher and the fluorophore, resulting in an increase in fluorescence. Using a molecular beacon specific for array 2, Vargas was able to detect RNAs containing an intron (i.e., pre-spliced RNA) [Vargas, p1057]. Therefore, the loop portion of the molecular beacon was specific for the pre-splicing RNA molecule.
Regarding claim 2, each molecular beacon probe contained a 2`-O-methylribonucleotide back bone (i.e., modified nucleic acid) [Vargas, pS4].
Regarding claims 3 and 4, molecular beacons are probes that become fluorescent upon hybridization and allow detection and tracking of individual RNA molecules [Vargas, p1055-1057]. This fluorescent change occurs because these probes self-hybridize when not in contact with their target, bringing their ends in proximity to each other. As is apparent from the sequences below, each probe is labeled with a fluorophore on the 5`-end (Alexa 594 or TMR) and a quencher on the 3`-end (BHQ2) [Vargas, pS4]. When in proximity, the fluorophore is quenched by the quencher and it only upon binding to a target that the probe unfolds, separating the ends, resulting in an increase in fluoresce.
Regarding claims 6, 7, 9, and 10, the sequences of the probes are shown below [Vargas, pS4]. The underlined sequences represent the loop portions which are 18, 11, and 21 nucleotides long for the array 2 probe, array 3 probe 1, and array 3 probe 2 respectively. The stem portions are all 4 nucleotides long. Between each of the underlined (loop) portions and the stem portions is a single nucleotide which is the linker. For ease of viewing, brackets are placed around these linker nucleotides.
Array 2:
Alexa 594-CUUC[G]UCCACAAACACAACUCCUGAAG-BHQ2
Array 3 Probe 1:
TMR-CGAC[A]AGCCGAGCGUGGUCG-BHQ2
Array 3 Probe 2:
TMR-TGCG[A]AAGACAAGCCGAGCGUGGUCUCGCA-BHQ2
Regarding claims 11-13, as previously mentioned, Vargas used molecular beacon probes to detect RNAs containing an array 2 intron. These probes were injected into the cytoplasm of cells, thereby mixing unspliced RNA molecules with said probes, and images were collected via fluorescence microscopy [Vargas, p1057, S3]. Any splicing of these RNA molecules would result in loss of the intron, freeing the probes causing a reduction in fluorescence proportional to the number of spliced RNA molecules.
Regarding claim 21, Vargas inserted multiple sets of tandemly repeating sequences into a GFP-coding sequence thus affecting the sequence of the unspliced RNA molecule [Vargas, p1055].
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 14, 21, and 22 are rejected under 35 U.S.C. 103 as being unpatentable over Vargas.
Vargas is applied to the relevant teachings of claims 1 and 11 as discussed above and is incorporated herein by reference.
Vargas additionally examined PTB-controlled alternative splicing of nPTB pre-mRNA in HeLa cells. In nonneuronal cells, PTB is abundantly expressed, localized to the nucleus, and promotes the exclusion of exon 10 from mature nPTB mRNA which ultimately results in its degradation. However, in neuronal cells, PTB expression is lower such that splicing produces functional nPTB mRNA which includes exon 10. Vargas examined the splicing of nPTB introns 1, 8, 9, and 11 in pairwise combinations with the 3` terminal exon 13 in HeLa cells and found that there were a large number of pre-mRNAs containing intro 9 and exon 13 dispersed throughout the nucleoplasm. To further show that this dispersal was due to the regulatory activity of PTB, Vargas used RNA interference to decrease PTB expression finding that the number of pre-mRNAs decreased whereas the number of spliced mRNAs increased. Thus, Vargas demonstrates that RNA interference-mediated reduction of PTB affects the relative amounts of unspliced and spliced RNA [Vargas, p1061].
While Vargas did not use molecular beacon probes for this experiment and instead designed sets of about 50 different oligonucleotides, each about 20 nucleotides long and labeled with a single fluorescent moiety [Vargas, p1064], a skilled artisan would have recognized that a molecular beacon is another sequence-specific nucleic acid probe capable of detecting a target RNA and producing a detectable signal upon hybridization as Vargas expressly teaches this function for use in a different experiment as previously discussed. Accordingly, substituting molecular beacons for the labeled probes of this experiment would have been a predictable use of a known RNA-detection technology for its established purpose. The combination of familiar elements is likely to be obvious when it does no more than yield predictable results. See KSR International Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395 – 97 (2007) (see MPEP § 2143, A.).
Claims 15-20 are rejected under 35 U.S.C. 103 as being unpatentable over Vargas, as applied to claims 1 and 11 above, and further in view of Fedorova [Fedorova O, et al. Nat Chem Biol. Author Manuscript; available in PMC 2019 April 15].
Vargas is applied to the relevant teachings of claims 1 and 11 as discussed above and is incorporated herein by reference. However, while Vargas teaches a live-cell imaging technique in which molecular beacon probes are mixed with an unspliced RNA molecule and fluorescence signal that results is measured, they do not teach comparing these results to a second mixture which includes a test compound, such as an anti-pathogenic compound. They additionally do not teach that the sequence-specific splicing of the RNA molecule is present when a subject, tissue, or cell has a disease or disorder, is not present when said subject, tissue, or cell is healthy, and is specific to a eukaryotic pathogen such that the splicing does not occur in the pathogenic host.
Fedorova teaches that while structured RNA molecules represent potential therapeutic targets, efforts to identify pharmacologically valuable small molecule inhibitors of complex RNA tertiary structure has been limited. However, identification of such molecules could have far reaching impacts in molecular medicine as the number of physiologically important RNA tertiary structures that control gene expression across all domains of life is vast. One potential use of these small molecules is in the treatment of fungal infections [Fedorova, p2, 8].
Fungal infections have become increasingly problematic, particularly for individuals with comprised immune systems including recipients of implant devices, neonatal patients, and cancer patients. However, many currently available antifungal treatments are simultaneously toxic to mammals due to the similarities in the enzymes and biochemical pathways of all eukaryotes. Therefore, a need exists to develop effective, non-toxic antifungal treatments [Fedorova, p2].
Fedorova conducted a study to identify small molecule inhibitors of group II introns, which are self-splicing ribozymes found in the mitochondrial genomes of plants, fungi, and yeast, but which are not present in mammals. These introns can be found in genes essential for cellular respiration, which is essential to pathogenic yeast’s ability to differentiate into biofilms, and thus make the introns an attractive therapeutic target [Fedorova, p2].
This study involved multiple experiments which included an analysis of splicing in S. cerevisiae. This experiment was conducted via qRT-PCR in which yeast cultures were mixed with either DMSO (no test compound), DMSO with a small molecule inhibitor (Intronistat A or B), or DMSO with Amphotericin B (a known antifungal treatment). After incubation, RNA was extracted, reverse-transcribed, and the cDNA quantified via real time PCR. The results were normalized and used to determine the relative levels of an indicated RNA species from the different conditions. Normalization occurred using the following formula [Fedorova, p11-12]:
∆
∆
C
T
=
(
C
T
C
O
X
1
t
o
t
a
l
o
r
u
n
s
p
l
i
c
e
d
-
C
T
A
C
T
1
o
r
P
G
K
1
)
t
e
s
t
c
o
m
p
o
u
n
d
(
C
T
C
O
X
1
t
o
t
a
l
o
r
u
n
s
p
l
i
c
e
d
-
C
T
A
C
T
1
o
r
P
G
K
1
)
D
M
S
O
As a result, Fedorova clearly demonstrates comparing RNA splicing in samples treated with a test compound to untreated samples in order to identify compounds that affect RNA splicing which represent an explored class of therapeutically useful agents, particularly in the treatment of fungal infections.
Therefore, it would have been obvious to one of ordinary skill in the art prior to the effective filing date of the claimed invention to modify the live-cell imaging technique of Vargas to include a comparison between a test mixture and a control mixture such that any change in fluorescent signal could be attributed to the addition of the test compound impacting splicing events thus allowing for the identification of therapeutically effective small molecules. A rationale to support a conclusion that a claim would have been obvious is that all the claimed elements were known in the prior art and one skilled in the art could have combined the elements as claimed by known methods with no change in their respective functions, and the combination would have yielded nothing more than predictable results to one of ordinary skill in the art. See KSR International Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395 (2007) (see MPEP §§ 2143, A. and 2143.02).
Regarding claims 15, 16, and 18-20, the purpose of Fedorova’s study was to screening compounds capable of treating fungal infections which are able to differentiate into biofilms due in part to splicing of introns found in cellular respiration genes. Fedorova states that biofilms contribute to pathogenic virulence as they are known to colonize medical implant surfaces and resist antifungal treatments. Therefore, this sequence-specific splicing would only occur in individuals with a fungal infection (i.e., an infectious disease) [Fedorova, p2].
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Kara N Kovach whose telephone number is (571)272-8134. The examiner can normally be reached Monday - Friday, 9am - 3pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Gary Benzion can be reached at (571) 272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/K.N.K./Examiner, Art Unit 1681
/SAMUEL C WOOLWINE/Primary Examiner, Art Unit 1681