DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Restriction/Election
In response to the communication received on January 25th, 2026, from Seiko Okada, the election of Group II, claims 7-8, 10-13, 16, 18-19, and 21, without traversal, is acknowledged. Applicants have further added a new claim, claim 32, which is directed to Group II.
Priority
Applicant’s claim for the benefit of a prior-filed application no. GB2201443.5 filed 02/04/2022 and PCT/GB2023/050203 filed 01/30/2023 under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged.
Thus, the earliest possible priority for the instant application is February 4th, 2022.
Information Disclosure Statement
The information disclosure statements (IDS) submitted on 1/30/2025 and 1/30/2026 were considered, initialed, and attached hereto. A signed copy of the list of references cited is included with this Office Action.
Status of Claims
Claims 7-8, 10-13, 16, 18-19, 21-22, and 32 filed 01/25/2026 are pending and are examined herein.
Claim Objections
In claims 7, and 8, 10-13, 16, 18-19, 21-22, and 32 depending therefrom, “TSNA” is used as abbreviation. It is suggested to insert a definition for TSNA without bringing in new matter, immediately before the first appearance of “TSNA” in claim 7; and to enclose the appearance of “TSNA” in parentheses (in claim 7 only).
In claim 10, and claim 11 depending therefrom, “PON” is used as abbreviation. It is suggested to insert a definition for PON without bringing in new matter, immediately before the first appearance of “PON” in claim 10; and to enclose the appearance of “PON” in parentheses (in claim 10 only).
Claim Interpretation
The term "modifying" or "modified" recited in claim 7 (and claims 8, 10-13, 16, 18-19, 21-22, and 32 depending therefrom) as used herein means a plant (e.g. a tobacco plant) or nucleic acid sequence that has been altered or changed by any means, as defined in the instant disclosure [pg. 10, lns. 32-35].
The term “modulated” as recited in claim 7 (and claims 8, 10-13, 16, 18-19, 21-22, and 32 depending therefrom) is defined as either increasing or decreasing in the instant disclosure [pg. 31, ln. 15]. Thus, modulated may refer to decreasing, increasing, or any change.
The term “unmodified plant” as recited in claim 7 (and claims 8, 10-13, 16, 18-19, 21-22, and 32 depending therefrom) is defined as a plant which has not been modified according to the present invention in which all relevant features are the same, as defined in the instant disclosure [pg. 11, lns. 10-14].
The broadest reasonable interpretation of claim 7 is a tobacco plant, plant part, or cell thereof that has had any modification (natural or artificial) to the plant that increases or decreases any activity or expression of any CYP94 cytochrome P450. The tobacco plant additionally comprises decreased alkaloid and/or TSNA precursor content in comparison to an unmodified plant, cell, or cell culture. There is no claim limitation necessitating that these two features must occur concurrently (i.e., not necessarily a nexus) or that decrease in alkaloid content is as a result of the modification, thus, they may occur in the same plant at different times and may be unrelated.
The term “plant propagation material” as recited in claim 8 is taken to mean any plant matter taken from a plant from which further plants may be produced. This may be a seed, plant calli or plant clumps, as defined in the specification [pg. 44, lns. 32-35; pg. 45, lns. 1-3].
The SEQ ID Nos. listed in claim 32 are interpreted to be from Nicotiana tabacum. Examples 1 and 2 do not specify the species of tobacco and the sequence listing (XML file) filed 08/01/2024 denotes the organism of the species as “unidentified.” The instant disclosure states that, “suitably, the protein for use according to the present invention may be encoded by a polynucleotide sequence from Nicotiana tabacum” [pg. 18, lns. 1-2], before listing SEQ ID Nos. 1-3 [pg. 18, lns. 3-13]. Thus, the SEQ ID Nos. are interpreted to be from the cultivated Nicotiana tabacum, and not a wild tobacco species.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 7-8 and 10-13 are rejected under 35 U.S.C. 101 because the claimed invention is directed to non-statutory subject matter. The claims do not fall within at least one of the four categories of patent eligible subject matter because the claimed invention is directed to a judicial exception (i.e. a law of nature or a natural phenomenon) without significantly more.
Claims 7-8 and 10-13 are determined to be directed to subject matter that is naturally occurring. The rationale for this determination is explained below.
The claims are drawn to a tobacco plant, part thereof, cell or cell culture having been modified to modulate or decrease the activity or expression of a CYP94 cytochrome P450 that also comprises decreased alkaloid or TSNA precursor content as compared to an unmodified plant.
The instant disclosure teaches that cytochrome P450 proteins are responsible for the oxidative inactivation of bioactive forms of the phytohormone jasmonic acid (JA). Jasmonate is considered to be the primary signaling hormone responsible for induction of alkaloid biosynthesis. The catabolic degradation of the bioactive JA derivative, jasmonoyl isoleucine (JA-Ile), is conducted by the cytochrome P450 proteins of the CYP94 family [pg. 9, lns. 1-5]. In Arabidopsis thaliana, CYP94C1 is responsible for the final carboxylation of JA-Ile and for the inactivation of JA. The Applicants have tested this in a homologue in tobacco.
Luo, J. et al. (2016, “COI1-Regulated Hydroxylation of Jasmonoyl-L-isoleucine Impairs Nicotiana attenuata’s Resistance to the Generalist Herbivore Spodoptera litura,” J. Agric. Food Chem. 64: 2822−2831) teaches four CYP94B3 homologues in the wild tobacco plant Nicotiana attenuata [Abstract], demonstrating that this family is found naturally in the wild. A tobacco plant may be modified, meaning altered or changed in any way resulting in the modulation (e.g. increase or decrease) of activity or expression of a CYP94 cytochrome P450, with the plant additionally comprising decreased alkaloid content. A modification may be a natural response to an insect damage, wherein the jasmonate signaling pathway would be activated, JA-Ile would accumulate, and CYP94 expression would increase to speed up degradation of JA-Ile as a negative feedback loop to terminate the response.
After the signal is attenuated, the alkaloid content may return to a basal state, depending on the damage or stress level. For example, Yahyazadeh, M. et al. (2021, “The complexity of sound quantification of specialized metabolite biosynthesis: The stress related impact on the alkaloid content of Catharanthus roseus,” Phytochemistry, 187:112774) teaches that after stress induction in Catharantus roseus, the entire alkaloid content per plant increased within the first two weeks, but there was no significant difference amongst the drought treatment plants and the control plants thereafter [Abstract].
Alkaloid content depends on many factors, including nutrient availability, UV light, genetic factors, and plant development stage. Sun, B. et al. (2018, “Variations of Alkaloid Accumulation and Gene Transcription in Nicotiana tabacum,” Biomolecules, 8(114)) teaches that developmental stage plays a large role in alkaloid accumulation, particularly in nicotine, myosmine, and anabasine [Table 4; Abstract]. Sun teaches that alkaloid content in N. tabacum leaves increased along with plant growth and was also dependent on the tobacco variety [pg. 8, ¶2]. Nicotine in particular was shown to be highest in the upper leaves maturing stage [Table 3]. Tassew, Z. et al. (2015, “Levels of nicotine in Ethiopian tobacco leaves,” SpringerPlus, 4:649) further teaches that nicotine content varies across tobacco plants of the same species, even depending on leaf position on the stalk [Abstract].
As in the claim interpretation above, the modulation of CYP94 cytochrome P450 activity and decreased alkaloid and/or TSNA content in a tobacco plant as compared to an unmodified plant do not need to occur concurrently. A tobacco plant modified by insect stress would have increased CYP94 cytochrome P450 expression as part of a negative feedback system to decrease alkaloid production that was initially increased due to the modification. The tobacco plant may return to a similar level as an unmodified plant after signal attenuation, and may naturally have less alkaloid than an unmodified tobacco plant with higher alkaloid content due to factors like less UV light from shading of other plants, natural variation in leaf positioning, a slightly different growth stage, etc.
This judicial exception is not integrated into a practical application because CYP94 cytochrome P450 modification is found in nature and alkaloid content is shown to fluctuate naturally. The claims do not include additional elements that are sufficient to amount to significantly more than the judicial exception because there are no limitations that require human intervention.
Claim 8 recites a plant propagation material obtained from the tobacco plant, but according to the instant disclosure, plant propagation materially may be a seed derived from the plant, which may occur naturally (see claim interpretation).
Claim 10-11 add the limitation of the alkaloid being nicotine, or another select alkaloid, which, as shown above, is dependent on the plant developmental stage.
Claims 12 and 13 do not include additional elements as they are drawn to a plant grown from the tobacco plant or a leaf from the plant, which may occur naturally.
Examiner notes that claims 16, 18-19, 21-22, and 32 do recite additional elements that amount to significantly more than the judicial exception because they specify that the leaf or plant is processed in some manner, indicating human influence. Claim 32 recites specific SEQ ID Nos. for the CYP94 cytochrome P450. The sequences do include additional elements as the SEQ ID Nos. appear to belong to Nicotiana tabacum, a cultivated tobacco species (see claim interpretation).
Claim Rejections - 35 USC § 112(a)
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Written Description
Claims 7-8, 10-13, 16, 18-19, 21-22, and 32 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The claims are broadly drawn to a tobacco plant or any part thereof having been modified in any way to modulate or decrease the activity or expression of a CYP94 cytochrome P450 to decrease alkaloid and/or TSNA precursor content as compared to an unmodified plant.
The instant disclosure describes the knockout of Nitab4.5_0007257g0030.2 encoding a CYP94 cytochrome P450 decreasing alkaloid content in hairy roots of a tobacco plant. Nitab4.5_0007257g0030.2 has a genomic sequence of SEQ ID NO. 1, CDS of SEQ ID NO. 2, and amino acid sequence of SEQ ID NO. 3.
The instant disclosure does not describe any modification that can modulate or decrease the activity or expression of any CYP cytochrome P450 resulting in decreased alkaloid content and/or TSNA content in any part of a tobacco plant or a whole tobacco plant with the modifications, leaf thereof, or tobacco product/blend comprising the modified leaves. The instant disclosure does not describe that a functional variant, fragment, orthologue, or sequence with 80% identity to SEQ ID NOs. 1-3 may confer the same function.
Modifications, including mutations, insertions, deletions, and/or substitutions, can have varying
effects on gene expression. Ge, F. et al. (2024, “Review of Computational Methods and Database Sources
for Predicting the Effects of Coding Frameshift Small Insertion and Deletion Variations,” ACS
Publications, 9:2032-2047) teaches, for example, silent mutations may not change the protein structure and thus do not result in increased gene expression, while others, such as frameshift mutations, can cause
a premature stop codon resulting in a truncated protein that is not functional [pg. 2032, col. 1, ¶1]. As the
Applicant only provides the example of the knockout mutation; any type of modification is not reduced to practice. Further, as the claims are broad, modification may encompass natural modification (see claim interpretation). Undue experimentation would be required to be required to confirm that the structure of the mutation or modification performs the function of modulating or decreasing expression and/or activity of a CYP94 cytochrome P450 resulting in decreased alkaloid and/or TSNA content. The instant disclosure lacks sufficient variety of species to reflect the variance within the genus of modification.
Modulating or decreasing any CYP94 cytochrome P450 would not necessarily comprise decreased alkaloid and/or TSNA precursor content. Applicants concede that CYP94C1 in Arabidopsis is thought to be responsible for the inactivation of JA, but that the results of the instant disclosure have unexpectedly demonstrated the opposite effect for the closest homologue in tobacco i.e. that decreasing CYP94 activity and/or expression decreases alkaloid content and thus likely jasmonate signaling [pg. 9, lns. 3-5]. Yang, D. et al. ("Tobacco cytochrome C gene NtCYP94B3s and application thereof in improving content of tobacco jasmonic acid," Publication No. CN 112094855 A, published 12/18/2020, translation included in file wrapper) teaches the tobacco cytochrome gene NtCYP94B3s and the application thereof in improving the content of tobacco jasmonic acid [Abstract]. Yang teaches modulated expression of the tobacco endogenous gene NtCYP94B3 by silencing the gene in the tobacco plant, so that the JA and JA-IIe contents of the tobacco leaf are obviously improved. The content of 12OH-JA-Ile is significantly reduced compared to the WT plant [pg. 3, ¶6]. Thus, jasmonate signaling was not decreased with CYP94B3 silencing, as is speculated in the instant disclosure [pg. 9, lns. 3-5].
Futher, Chen teaches that jasmonic acid mediates many aspects of plant defense responses including nicotine biosynthesis [Abstract]. Chen teaches that jasmonic acid regulates nicotine biosynthetic gene expression through the MYC2 and the jasmonate ZIM‐domain (JAZ) repressors system [pg. 2, col. 1, ¶3]. In the absence of JA, the JAZs bind to MYC2 and form a repression complex, blocking MYC2 from activating nicotine biosynthetic genes. Chen teaches that JA signaling could be attenuated by hydrolysis of JA‐Ile by p450 enzymes CYP94B3 and CYP94C1 [pg. 2, col. 2, ¶3].
Thus, modulating (which encapsulates increasing or altering according to the claim interpretation above) or decreasing a CYP94 cytochrome P450 in any way may not result in a decrease in alkaloid content. In fact, decreasing CYP94 cytochrome P450 through RNAi or T-DNA mutation may increase jasmonic acid, defense responses, and thus increase alkaloid production, such as nicotine. A representative number of species was not described to represent the entire genus of modulating or decreasing the activity or expression of a CYP cytochrome P450. Example 2 in the instant disclosure simply states that homologues of SEQ ID NO. 3 were tested but does not provide additional data to support the claimed invention.
Example 1 of the instant disclosure states that the alkaloid content in the hairy roots was decreased with the knockout mutation, but does not reduce to practice decreased alkaloid content in the tobacco plant, plant part, or harvested leaf thereof. The art teaches that hairy root culture generation to transformed plant has several challenges. Lui, C. et al. (2025, “Reprogramming Hairy Root Cultures: A Synthetic Biology Framework for Precision Metabolite Biosynthesis,” Plants (Basel), 14(13):1928) teaches that scalability, specificity of metabolite biosynthesis, long-term genetic and metabolic stability, and reproducibility of culture performance under varied conditions may prove difficult for hairy root culture [pg. 16, ¶1].
The claims and the instant disclosure provide no guidance with respect to the regeneration of tobacco plants or leaves from hairy roots. The specification lacks sufficient variety of species to reflect the potential variance between hairy roots and any other part of the tobacco plant. It is not clear that the structure in the regenerated plants would have the same function of decreased alkaloid content.
As is known in the art, fragments of biological sequences can sometimes retain functional properties, but they do not always perform the exact same role as the whole sequence. Dib, L. et al. (2012, “Protein Fragments: Functional and Structural Roles of Their Coevolution Networks,” PLoS ONE 7(11): e48124) teaches that fragments along a protein sequence may form functional motifs necessary to the function claimed, without which, the truncated portion may not function [Abstract; pg. 2, col. 1, ¶2]. The Applicant does not provide working examples of a fragment of a sequence or a variant functioning in the method as claimed.
Due to the functional unpredictability of paralogs, and fragments and variants thereof, and breadth of the potential fragments and variants, one of ordinary skill in the art would not be able to make and/or use the full scope of the claimed invention with only reasonable experimentation. Undue experimentation would be required to ensure that all variants and fragments of the claimed sequences still maintained the functionality of the sequences. Examiner notes that amending the claims to recite with more specificity the full length of the SEQ ID NOs. might help to overcome this rejection with regard to claim 32.
Scope of Enablement
Claims 7, 8, 10-13, 16, 18-19, 21-22, and 32 rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for reducing alkaloid content of tobacco hairy roots with homozygous knock-out mutations in Nitab4.5_0007257g0030.2 encoding a CYP94 cytochrome P450, does not reasonably provide enablement for a tobacco plant or any part thereof having been modified in any way to modulate or decrease the activity or expression of any CYP94 cytochrome P450 resulting in decreased alkaloid and/or TSNA precursor content in comparison to a control plant. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make the invention commensurate in scope with these claims.
The claims broadly encompass a tobacco plant or any part thereof and any modification to alter the activity or expression of a CYP94 cytochrome P450 comprising decreased alkaloid and/or TSNA precursor content as compared to an unmodified plant.
The specification provides little guidance over the breadth of the pending claims, providing only two examples to support the claims. Example 1 discloses gene editing of Nitab4.5_0007257g0030.2 which encodes a CYP94 cytochrome P450. Gene editing was used to knock out Nitab4.5_0007257g0030.2 in hairy roots and reversed phase high performance liquid chromatography with tandem mass spectrometry (LC-MS/MS) was used to determine relative content of pyridine alkaloids in hairy roots with the knockout mutations. One figure was provided (Fig. 1) to support the alkaloid content decrease with the mutation, however, this appears to be only data shown in hairy roots, not in any other part of a tobacco plant. Example 2 simply states that “the effects of the homologues of SEQ ID NO. 3, namely those listed in table 1, are tested in assays as described in the above example.” There are no working examples for any other homologues of Nitab4.5_0007257g0030.2 that would indicate to the skilled artisan that a mutation of the homologues in Table 1 or otherwise would result in reduced alkaloid content. No data is provided to support reduced alkaloid content in any tobacco plant organ or cell with the exception of hairy roots. The singular modification that was enabled is the knockout mutation of Nitab4.5_0007257g0030.2. There is no teaching as to other modifications that may modulate or decrease the activity of a CYP94 cytochrome P450 so as to decrease alkaloid or TSNA precursor content.
Biswas, D. et al. (2023, “Hairy root culture: a potent method for improved secondary metabolite production of Solanaceous plants,” Front. Plant Sci. 14:1197555) teaches that hairy roots are primarily generated by Agrobacterium-mediated transformation infection at a wound site, resulting in rapid growth [Abstract]. Hairy roots often have high transformation efficiency and mirror the chemical profile of the plant’s own roots. Zhu, Y. et al. (2024, “Plant hairy roots: Induction, applications, limitations and prospects,” Industrial Crops & Products, 219) teaches that hairy roots as compared to leaves may not regenerate to whole transgenic plants and may require a species-specific method for generating a transgenic plant. Additionally, some regenerated transgenic plants obtained by A. rhizogenes-mediated genetic transformation will show Ri phenotypes (phenotypes from co-cultivation and natural transformation using rhizogenic agrobacteria) or hairy root phenotypes such as loss of apical dominance, altered leaf morphology, shortening of internodes, early flowering, premature leaf senescence, and changes in flower shape [pg. 12, col. 2, ¶2].
Zhu teaches that content of secondary metabolites in plants is usually low and tissue-specific (e.g., present in tissues such as stems, leaves, flowers, fruits, and seeds), which makes the hairy roots not the best platform for the biosynthesis of some secondary metabolites [pg. 12, col. 1, ¶4]. While Tong, A. et al. (2025, “DNA methylation valley as a distinguishing feature occurs in root-specific expressed nicotine-related genes in Nicotiana attenuate,” Front. Plant Sci., 16:1647622) teaches that most nicotine-related genes are synthesized exclusively in the roots [Abstract]. The content of nicotine or any alkaloid and/or TSNA precursor would be unpredictable in the whole plant or part thereof aside from the hairy roots enabled in the instant specification.
As shown above, the alkaloid content and/or TSNA precursor content in the transgenic tobacco plant, plant or crop bred or frown from the tobacco plant, harvested leaf, or processed leaf, may not predictably have the same result as the hairy roots with the Nitab4.5_0007257g0030.2 knockout shown in Example 1 of the instant specification. Undue levels of experimentation would be required in order to practice the claimed invention. The instant specification does not provide adequate guidance on what alternative modifications may be made to the CYP94 cytochrome P450 other than the mutation. The instant specification does not disclose any other part of the tobacco plant with the exception of hairy roots with the mutation. The skilled artisan would be required to identify alternative mutations and generate transgenic plants therefrom to determine if the tobacco plant comprises decreased alkaloid/TSNA content. In light of the unpredictability and lack of direction provided, one of ordinary skill in the art would not have had reasonable expectation of success in making the claimed invention.
Examiner notes that claim 32 does provide SEQ ID NOs. for the proposed CYP94 cytochrome P450. However, this does not overcome the scope of enablement rejection for the scope of the modifications possible and the regenerated tobacco plant from the transformed hairy roots due to the variants and fragments of the SEQ ID NOs. as claimed.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 7-8, 10-13, 16, 18-19, and 21-22 are rejected under 35 U.S.C. 103 as being unpatentable over Luo, J. et al. (2016), “COI1-Regulated Hydroxylation of Jasmonoyl-L-isoleucine Impairs Nicotiana attenuata’s Resistance to the Generalist Herbivore Spodoptera litura,” J. Agric. Food Chem. 64: 2822−2831, in view of Paschold, A. et al. (2007), “Co(i)-ordinating defenses: NaCOI1 mediates herbivore-induced resistance in Nicotiana attenuata and reveals the role of herbivore movement in avoiding defenses,” The Plant Journal, 51(1):79-91, and Hart, R. et al. US. Patent Application No. US 20210360960 A1, published 11/25/2021.
Claim 7 recites a tobacco plant or part thereof or a tobacco cell or cell culture, having been modified to modulate or decrease the activity or expression of a CYP94 cytochrome P450, and comprising decreased alkaloid and/or TSNA precursor content in comparison to an unmodified plant or unmodified cell or cell culture.
Claim 8 recites a plant propagation material obtained from the tobacco plant according to claim 7, the plant propagation material comprising modulated or decreased activity or expression of a CYP94 cytochrome P450, and decreased alkaloid and/or TSNA precursor content in comparison to a plant propagation material obtained from an unmodified tobacco plant.
Claim 10 recites the tobacco plant or part thereof or tobacco cell or cell culture according to claim 7, wherein the content of one or more alkaloids selected from nicotine, nornicotine, PON, anabasine, myosmine, and anatabine is modulated or decreased.
Claim 11 recites the tobacco plant or part thereof or tobacco cell or tobacco cell culture according to claim 10, wherein the nicotine content is decreased.
Claim 12 recites a plant or a crop bred or grown from the tobacco plant or part thereof or tobacco cell or cell culture according to claim 7, the plant or the crop comprising modulated or decreased activity or expression of a CYP94 cytochrome P450, or decreased alkaloid and/or TSNA precursor content in comparison to a plant or a crop bred or grown from an unmodified tobacco plant or part thereof or an unmodified tobacco cell or cell culture.
Claim 13 recites a product or a leaf produced from the tobacco plant or part thereof or a tobacco cell or cell culture according to claim 7, the product or the leaf comprising modulated or decreased activity or expression of a CYP94 cytochrome P450, or decreased alkaloid and/or TSNA precursor content in comparison to a product or a leaf produced from an unmodified tobacco plant or part thereof or an unmodified tobacco cell or cell culture.
Claim 16 recites a harvested leaf or a cut harvested leaf of the tobacco plant according to claim 7, or obtained from a plant propagated from a propagation material obtained from the tobacco plant according to claim 7, the harvested leaf or the cut harvested leaf comprising modulated or decreased activity or expression of a CYP94 cytochrome P450, or decreased alkaloid and/or TSNA precursor content in comparison to a harvested leaf or a cut harvested leaf obtained from an unmodified tobacco plant.
Claim 18 recites a processed leaf: obtained by processing the tobacco plant according to claim 7; obtained from a plant or a harvested leaf thereof, wherein the plant was propagated from the plant propagation material obtained from the tobacco plant according to claim 7; or obtained by processing a harvested leaf or a cut harvested leaf of the tobacco plant according to claim 7, the processed leaf comprising modulated or decreased activity or expression of a CYP94 cytochrome P450, or decreased alkaloid and/or TSNA precursor content in comparison to a processed leaf obtained by processing an unmodified tobacco plant or a harvested leaf or a cut harvested leaf thereof.
Claim 19 recites the processed leaf according to claim 18, wherein the leaf is processed by curing, fermenting, pasteurizing or a combination thereof, or wherein the leaf is a cut processed leaf.
Claim 21 recites cured tobacco material made from the tobacco plant or a part thereof according to claim 7, or a harvested leaf of the tobacco plant according to claim 7, or a processed leaf obtained by processing the tobacco plant or part thereof according to claim 7, the cured tobacco material comprising modulated or decreased activity or expression of a CYP94 cytochrome P450, or decreased alkaloid and/or TSNA precursor content in comparison to a cut tobacco material made from an unmodified tobacco plant, a part thereof, a harvested leaf thereof, or a processed leaf thereof.
Claim 22 recites a tobacco blend comprising said cured tobacco material of claim 21.
Regarding claims 7, 10, and 11, Luo discloses that phytohormone JA-Ile is well-known as the key signaling molecule that elicits plant defense responses after insect herbivory [Abstract]. Oxidation of JA-Ile is catalyzed by the cytochrome P450s of the CYP94 family and results in the synthesis of 12-hydroxy-jasmonoyl-isoleucine (12OH-JA-Ile). COI1, the receptor of JA-Ile, appeared to transcriptionally control NaCYP94B3 like-1 and-2 and thus regulates the catabolism of its own ligand molecule, JA-Ile. JA-Ile functions as a signaling molecule and induces the production of many defenses including secondary metabolites and proteins, including nicotine (i.e. alkaloid) [pg. 2822, col. 2, ¶1]. Luo teaches that constructed vectors were transformed into Agrobacterium to specifically silence these NaCYP94B3s using the VIGS technology to generate VIGS-EV and VIGS-NaCYP94B3 like 1,-2,-3, and-4 plants [pg. 2826, col. 1, ¶3]. Luo teaches that, consistent with the decreased 12OH-JA-Ile levels in plants silenced in NaCYP94B3 like-1 or-2, the JA-Ile levels increased in these plant [pg. 2826, col. 2, ¶1]. Luo teaches that direct defense traits, namely, TPI activity, nicotine contents, and HGL-DTGs levels, were all highly induced in VIGS NaCYP94B3s due to JA-Ile overproduction caused by blocking JA-Ile hydroxylation [pg. 2827, col. 2, ¶2].
Luo teaches JA, JA-Ile, and 12OH-JA-Ile accumulation patterns in WT and plants transformed with inverted repeat constructs, iraoc, irjar4/6, and ircoi1, which have impaired JA biosynthesis, JA-Ile biosynthesis, and JA perception, respectively. At 1 hour after a wounding treatment, JA levels in iraoc plants were strongly reduced to <3% of the WT levels and JA in ircoi1 plants was ~30% of the WT plants [pg. 2828, col. 1, ¶1]. Luo teaches that ircoi1 plants had decreased transcript levels of NaCYP94B3 like-1 and NaCYP94B3 like-2 (i.e. a tobacco plant having been modified to modulate or decrease the activity or expression of a CYP94 cytochrome P450).
Though the property of decreased nicotine (i.e. alkaloid) content would be inherent to the composition (ircoi1 mutant plant with impaired JA perception) as COI1 is a primary receptor for JA, which triggers the production of such metabolites, Luo does not explicitly teach that the ircoi1 plants had decreased alkaloid/nicotine content.
However, Paschold, teaches COI1 silenced by transformation with an inverted repeat construct (ir-coi1) in Nicotiana attenuata [Abstract]. The induction of TPI activity and the accumulation of nicotine in N. attenuata plants in response to herbivory is mediated by JA signaling [pg. 83, col. 1, ¶2]. Paschold teaches that ir-coi1 plants are male sterile and impaired in JA-elicited direct defense responses, such as nicotine, as compared to a WT control [Abstract; Fig. 3A, as shown below].
PNG
media_image1.png
544
720
media_image1.png
Greyscale
Luo and Paschold do not explicitly teach a motivation to decreased alkaloid content and/or TSNA, however, Hart teaches novel methods of curing tobacco to produce desirable smoke and flavor characteristics while reducing the undesirable decreasing the level of TSNAs and Harmful and Potentially Harmful Constituents (HPHCs) imparted during a conventional fire-curing process and tobacco products thereof [Abstract]. Hart teaches that HPHCs refers to a list established by the U.S. Federal Food and Drug Administration (FDA) by the Federal Food, Drug, and Cosmetic Act of chemicals and chemical compounds identified by the FDA as harmful and potentially harmful to humans [¶26]. This list comprises nicotine, nornicotine, and anabasine, among others.
Given that Luo teaches an ircoi1 plant that has been modified and modulates or decreased transcript levels of NaCYP94B3 like-1 and-2; given that Paschold teaches that ircoi1 plants comprise decreased nicotine content; and given that Hart teaches that lower alkaloid, TNSA and/or nicotine content in tobacco is beneficial to human health, it would have been obvious to one of ordinary skill in the art at the time of filing to increase (or modulate) expression of a CYP94 cytochrome P450 in tobacco using the methods of Luo and Paschold, and thus reduce alkaloid content by blocking JA-elicited direct defense responses, such as nicotine, as taught by Paschold. One would have been motivated to lower the alkaloid and/or TSNA content as Hart teaches that these compounds are harmful or potentially harmful to humans. One having ordinary skill in the art would have reasonable expectation of success because modification to decrease activity or expression of a tobacco CYP94 cytochrome P450 was already known to the prior art as taught by Luo.
Regarding claims 8, 12-13, and 16, Paschold teaches generation of transgenic plants with ir-coi1 lines 1 and 2 [pg. 88, col. 1, ¶2]. Paschold teaches that the anther-carrying filaments of the male sterile lines were unable to dehisce and that after drying in a desiccator, they were able to open and release fertile pollen grains [pg. 88, col. 1, ¶2]. The fertile pollen grains were used to pollinate stigmas of open flowers resulting in viable seeds (i.e. a plant propagation material obtained from the tobacco plant). This method was used to generate homozygous progeny of both ir-coi1 lines (i.e. a plant grown from the tobacco plant or part thereof). For analysis of herbivory, detached leaves of ir-coi1 plants were used (i.e. a leaf produced from the tobacco plant; a harvested leaf or cut leaf of the tobacco plant) [pg. 88, col. 2, ¶6].
Regarding claims 18-19 and 21-22, Hart teaches a curing combination process to reduce harmful constituents in cured tobacco and includes cured tobacco having reduced polyaromatic hydrocarbons and TSNAs as compared to conventionally fire-cured tobacco (i.e. processing the tobacco plant or leaf harvested therefrom, wherein the leaf is processed by curing) [Abstract]. Also provided are tobacco products made with tobacco leaf cured using the disclosed processes (i.e. a tobacco blend comprising said cured tobacco material). Hart teaches that any modified or unmodified tobacco plant may be cured [¶64].
It would have been obvious to one of ordinary skill in the art at the time of filing to use the tobacco plant as taught by Luo and Paschold in the process of Hart to further reduce TSNAs in the tobacco product, as Hart teaches that the method may be conducted with any tobacco plant. One of ordinary skill in the art at the time of filing would have been motivated to do so to further reduce harmful constituents as taught by Hart for use in tobacco products. One would have reasonable expectation of success as the physical tobacco leaf as claimed would be able to be processed according to known methods, such as the ones taught by Hart.
Claim 32 is rejected under 35 U.S.C. 103 as being unpatentable over Paschold, Luo, and Hart as applied to claims 7-8, 10-13, 16, 18-19, and 21-22 above, and further in view of NCBI Reference Sequence: XM_016659890.1 (PREDICTED: cytochrome P450 94C1-like mRNA [Nicotiana tabacum], originally available 5/3/2016), and Heitz, T. et al. (2012, “Cytochromes P450 CYP94C1 and CYP94B3 Catalyze Two Successive Oxidation Steps of Plant Hormone Jasmonoyl-isoleucine for Catabolic Turnover,” The Journal of Biological Chemistry, 287(9):6296-6306) (as cited in IDS filed 1/30/2025).
Claim 32 recites the tobacco plant or part thereof or the tobacco cell or cell culture of claim 7, wherein the CYP94 cytochrome P450: a) comprises an amino acid sequence as set out in SEQ ID No. 3; or a functional variant or functional fragment or orthologue of SEQ ID No. 3.
Luo, Paschold, and Hart teach the tobacco plant of claim 7 having been modified to modulate the expression of a CYP94B3 and comprising decreased alkaloid content. Luo, Paschold, and Hart do not explicitly teach the tobacco plant or part thereof or the tobacco cell or cell culture of claim 7 wherein the CYP94 cytochrome P450 is encoded by a nucleotide sequence as set out in SEQ ID NO. 1. However, an NCBI BLAST search revealed a predicted cytochrome P450 94C1-like isoform X1 in Nicotiana tabacum (NCBI Reference Sequence: XM_016659890.1) with 100% alignment to SEQ ID NO. 1 (alignment shown below).
Luo does not teach that a P450 94C1 cytochrome in tobacco would be modulated with a coi1 mutant, however, Heitz teaches that along with CYP94B3, CYP94C1 catalyzes oxidation of JA-Ile, and that in coi1 mutants in Arabidopsis, CYP94B3 and CYP94C1 expression was nearly abolished.
It would have been prima facie obvious to one of ordinary skill in the art at the time of filing that the ir-coi1 plant of Luo with decreased transcript of CYP94B3, reduced JA synthesis, and reduced nicotine content, would similarly reduce CYP94C1-like. One would have reasonable expectation of success as Luo teaches that the N. attenuata CYP94 cytochrome P450s of were homologues of Arabodopsis AtCYP94B3 and AtCYP94B1, two enzymes hydroxylating JA-Ile [pg. 2825, col. 1, ¶1]. The four candidates, named NaCYP94B3 like-1,-2,-3, and-4, respectively, were obtained from a search of the N. attenuata genome using the protein sequences of the Arabidopsis CYP94 enzymes. The NaCYP94B3 like-1,-2,-3, and-4 protein sequences, together with other AtCYP94B3- and AtCYP94B1-like proteins from some Solanaceous species and all members of the Arabidopsis CYP94 subfamily were phylogenetically analyzed to show similarities and indicate that they have similar functionality [pg. 2825, col. 2, ¶1]. Thus, although the coi1 mutants with decreased expression of CYP94C1 were in Arabidopsis, as taught by Heitz, there would have been similar functionality to tobacco based on the analysis of Luo.
One would have been motivated to do such a mutant in Nicotiana tabacum instead of N. attenuata as Hart teaches that the methods for reducing harmful constituents may be done in Nicotiana tabacum [¶025].
Score
Expect
Identities
Gaps
Strand
3688 bits(1997)
0.0
1997/1997(100%)
0/1997(0%)
Plus/Plus
Query 43 ATCATGTGCTACAATAACCTAAAAACTATTATATAAGAATGCAATGCAATGCACTTAGCC 102
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1 ATCATGTGCTACAATAACCTAAAAACTATTATATAAGAATGCAATGCAATGCACTTAGCC 60
Query 103 CACCACTCCAATTCATGTTTTCTTTTGTGCATAGTCATTTTCTCTCTTTTCTCTATATCC 162
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 61 CACCACTCCAATTCATGTTTTCTTTTGTGCATAGTCATTTTCTCTCTTTTCTCTATATCC 120
Query 163 CATCTAGGAATTAAAGTTTTCTTTCCTCTAACAATGGAGTCACAAGTAAACCCTTTATTG 222
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 121 CATCTAGGAATTAAAGTTTTCTTTCCTCTAACAATGGAGTCACAAGTAAACCCTTTATTG 180
Query 223 CAGTTTTTGCAAGTTTCCATAGGCTActttctcttctcttttgccattgccttctctatt 282
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 181 CAGTTTTTGCAAGTTTCCATAGGCTACTTTCTCTTCTCTTTTGCCATTGCCTTCTCTATT 240
Query 283 ttctctcttttgctcttcttcttAAGACACAAGTTTTGGTGCACCTGTGACATTTGCCAT 342
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 241 TTCTCTCTTTTGCTCTTCTTCTTAAGACACAAGTTTTGGTGCACCTGTGACATTTGCCAT 300
Query 343 TGTTACTTAACATCTAGTTGGAGAAAAGAGTTCACTAATCTTGTTGATTGGTATGCTCAT 402
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 301 TGTTACTTAACATCTAGTTGGAGAAAAGAGTTCACTAATCTTGTTGATTGGTATGCTCAT 360
Query 403 CTTCTCCGAAATTCGCCATCTCAAACTATTCATATCCATGTTTTAGGTAATATTATCACA 462
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 361 CTTCTCCGAAATTCGCCATCTCAAACTATTCATATCCATGTTTTAGGTAATATTATCACA 420
Query 463 GCCAATCCAAGAAATGTTGAGTACATGCTTAAAACTAAATTCTTGAATTACCCTAAAGGC 522
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 421 GCCAATCCAAGAAATGTTGAGTACATGCTTAAAACTAAATTCTTGAATTACCCTAAAGGC 480
Query 523 AAACCATTTTCAATGATTCTTGGTGATCTTTTAGGGGATGGAATTTTCAATGTTGATGGA 582
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 481 AAACCATTTTCAATGATTCTTGGTGATCTTTTAGGGGATGGAATTTTCAATGTTGATGGA 540
Query 583 GATTTATGGACATTTCAAAGAAAAATGGCTAGTCTTGAACTTGGTAGTATGTCCATTAGG 642
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 541 GATTTATGGACATTTCAAAGAAAAATGGCTAGTCTTGAACTTGGTAGTATGTCCATTAGG 600
Query 643 TCATATGCATTTAACAATGTGAAAAATGAGATCAAATTCAGGCTTTTACCACTTTTATCC 702
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 601 TCATATGCATTTAACAATGTGAAAAATGAGATCAAATTCAGGCTTTTACCACTTTTATCC 660
Query 703 TCTATAGCTCAAGAAGATTTTAGAGGGACAAATTTGGATTTACAAGATGTTTTTAGAAGA 762
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 661 TCTATAGCTCAAGAAGATTTTAGAGGGACAAATTTGGATTTACAAGATGTTTTTAGAAGA 720
Query 763 TTTTCTTTTGATAATATATGTAAATTTTCTTTTGGTTTAGACCCTGGTTGTCTTGAACTA 822
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 721 TTTTCTTTTGATAATATATGTAAATTTTCTTTTGGTTTAGACCCTGGTTGTCTTGAACTA 780
Query 823 TCCCTTCCCCTTTCTCATTTTGCTCTATCTTTTGACTTGGCAACAAAATTGTCAGCAGAG 882
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 781 TCCCTTCCCCTTTCTCATTTTGCTCTATCTTTTGACTTGGCAACAAAATTGTCAGCAGAG 840
Query 883 AGGGCATTGGCAGCATCACCATTGATTTGGAAGATTAAAAGGCTTTTAGATATTGGAACA 942
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 841 AGGGCATTGGCAGCATCACCATTGATTTGGAAGATTAAAAGGCTTTTAGATATTGGAACA 900
Query 943 GAGAGAAAATTAAAGAAGGCCATTGAAAATATTGATGTTCTTGCAAGGGAAGTCATAAGG 1002
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 901 GAGAGAAAATTAAAGAAGGCCATTGAAAATATTGATGTTCTTGCAAGGGAAGTCATAAGG 960
Query 1003 CAAAAGAGAAAATTGGGCTATTCTAATCATCAAGATCTTTTATCAAGATTCATGGGCATT 1062
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 961 CAAAAGAGAAAATTGGGCTATTCTAATCATCAAGATCTTTTATCAAGATTCATGGGCATT 1020
Query 1063 ATTAACAATGAAAAATATTTAAGAGACATTGTGATAAGTTTCATTTTGGCGGGGCGTGAC 1122
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1021 ATTAACAATGAAAAATATTTAAGAGACATTGTGATAAGTTTCATTTTGGCGGGGCGTGAC 1080
Query 1123 ACCGTGGCCTCTGTATTAACAAGCATATTCTGGCTGCTAACGAGTCACCCTGACGTTGAA 1182
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1081 ACCGTGGCCTCTGTATTAACAAGCATATTCTGGCTGCTAACGAGTCACCCTGACGTTGAA 1140
Query 1183 TTAAGAATACGGGAAGAATTGAGTCGAATTATGCAACAAGATCAAGAGTTCTTGACGTTT 1242
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1141 TTAAGAATACGGGAAGAATTGAGTCGAATTATGCAACAAGATCAAGAGTTCTTGACGTTT 1200
Query 1243 GAACAAATAAATCAAATGCATTACTTGAATGCAGTGATTCATGAGAGCATGAGGCTATAT 1302
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1201 GAACAAATAAATCAAATGCATTACTTGAATGCAGTGATTCATGAGAGCATGAGGCTATAT 1260
Query 1303 CCACCCGTGCAATTTGATTCAAAATTTGCTAGTGAAAATGATGCTTTACCAGATGGCACA 1362
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1261 CCACCCGTGCAATTTGATTCAAAATTTGCTAGTGAAAATGATGCTTTACCAGATGGCACA 1320
Query 1363 TTTGTGGCTAAAAATGCAAGGGTAACATACCATGTGTATGCAATGGGAAGGATGGAAAAT 1422
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1321 TTTGTGGCTAAAAATGCAAGGGTAACATACCATGTGTATGCAATGGGAAGGATGGAAAAT 1380
Query 1423 ATATGGGGCCAAGATTATATGGATTTCAAGCCAGAACGTTGGCTAAAAAATGGTATATTT 1482
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1381 ATATGGGGCCAAGATTATATGGATTTCAAGCCAGAACGTTGGCTAAAAAATGGTATATTT 1440
Query 1483 TTTCAAGAGAGTCCTTTTAAATACCCTGTTTTTCAAGGTGGAGTTAGGGTGTGTTTAGGC 1542
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1441 TTTCAAGAGAGTCCTTTTAAATACCCTGTTTTTCAAGGTGGAGTTAGGGTGTGTTTAGGC 1500
Query 1543 AAGGAAATGGCACTAATGGAAATGAAGTGTGTAGTGGCTTCTATGGTACAACACTTCGAC 1602
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1501 AAGGAAATGGCACTAATGGAAATGAAGTGTGTAGTGGCTTCTATGGTACAACACTTCGAC 1560
Query 1603 GTTCGGGCCGTGGCGGCCGGCGGTGATATCATGTTCGATCCGGGGTTGACGGCCACCGTG 1662
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1561 GTTCGGGCCGTGGCGGCCGGCGGTGATATCATGTTCGATCCGGGGTTGACGGCCACCGTG 1620
Query 1663 AAAGGTGGGCTTCCGGTGGTCGTTAGGTGGAGGAGGTGCCTTTTGAATTTTTCTAGCTAG 1722
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1621 AAAGGTGGGCTTCCGGTGGTCGTTAGGTGGAGGAGGTGCCTTTTGAATTTTTCTAGCTAG 1680
Query 1723 TAATATGGCCCCGAATATGGTTCAACATGGAGATATTGGCTTTAGGTCTTTAATATTTCA 1782
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1681 TAATATGGCCCCGAATATGGTTCAACATGGAGATATTGGCTTTAGGTCTTTAATATTTCA 1740
Query 1783 CGTGGGTATGTTGCATTTGGCCTACATTGGGCAAGGTTGTTTCAGAATAGAAACATTCCA 1842
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1741 CGTGGGTATGTTGCATTTGGCCTACATTGGGCAAGGTTGTTTCAGAATAGAAACATTCCA 1800
Query 1843 TTTTCGGTAGATGAAAGTTGCGTCAATGCACACTAGGACAAGTTGCACCTATGTCCCCAC 1902
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1801 TTTTCGGTAGATGAAAGTTGCGTCAATGCACACTAGGACAAGTTGCACCTATGTCCCCAC 1860
Query 1903 CTATGAATTATGATAATCCTAGAAGAATATTTTTACTAGTATTGTTGGGGAATTGttttt 1962
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1861 CTATGAATTATGATAATCCTAGAAGAATATTTTTACTAGTATTGTTGGGGAATTGTTTTT 1920
Query 1963 tttttCCTCTTAAATTATACATTAATGTTATCAGCTCTCTTCATGGAATTTATCTTAGTT 2022
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1921 TTTTTCCTCTTAAATTATACATTAATGTTATCAGCTCTCTTCATGGAATTTATCTTAGTT 1980
Query 2023 TTTGGTAAATATTTATG 2039
|||||||||||||||||
Sbjct 1981 TTTGGTAAATATTTATG 1997
Conclusion
No claims allowed.
Contact Information
Any inquiry concerning this communication or earlier communications from the examiner should be directed to EMILY K. JOHNSON whose telephone number is (571)272-5761. The examiner can normally be reached Monday - Friday 7:30 am - 5:00 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at 571-270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/EMILY K JOHNSON/Examiner, Art Unit 1662
/BRATISLAV STANKOVIC/Supervisory Patent Examiner, Art Units 1661 & 1662