Prosecution Insights
Last updated: July 17, 2026
Application No. 18/836,796

POLYNUCLEOTIDES WITH SELECTION MARKERS

Non-Final OA §102§103§112
Filed
Aug 08, 2024
Priority
Feb 09, 2022 — GB 2201662.0 +3 more
Examiner
LOUNTOS, GEORGE THEMISTOCLIS
Art Unit
1652
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Revvity Discovery Limited
OA Round
1 (Non-Final)
0%
Grant Probability
At Risk
1-2
OA Rounds
1y 3m
Est. Remaining
0%
With Interview

Examiner Intelligence

Grants only 0% of cases
0%
Career Allowance Rate
0 granted / 2 resolved
-60.0% vs TC avg
Minimal +0% lift
Without
With
+0.0%
Interview Lift
resolved cases with interview
Typical timeline
3y 2m
Avg Prosecution
28 currently pending
Career history
23
Total Applications
across all art units

Statute-Specific Performance

§101
1.7%
-38.3% vs TC avg
§103
56.9%
+16.9% vs TC avg
§102
24.1%
-15.9% vs TC avg
§112
1.7%
-38.3% vs TC avg
Black line = Tech Center average estimate • Based on career data from 2 resolved cases

Office Action

§102 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claims Status Claims 1-5, 7-11, 14-15, 20, 29, 43-44, 53-54, 61, and 69 are pending. Claims 6, 12-13, 16-19, 21-28, 30-42, 45-52, 55-60, 62-68, and 70-85 are canceled. Election/Restrictions Applicant’s election of Group I, claims 1-5, 7-11, 14-15, 20, and 29 in the reply filed on 06/08/2026 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)). Applicant’s election of: Species Group I: SEQ ID NO: 24 Species Group II: (Applicant did not select a species). in the reply filed on 06/08/2026 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)). Claims 43, 44, 53, 54, 61, and 69 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected subject matter, there being no allowable generic or linking claim. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)). Information Disclosure Statement The information disclosure statement (IDS) submitted on 08/08/2024 is acknowledged. The submission is in compliance with the provision of 37 CFR 1.97. Accordingly, the information disclosure statement has been considered. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 5, 8, 15, and 29 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. With regards to claim 5, the claim recites “a first direction”. The claim does not recite any other directions thus the claim is rendered indefinite. With regards to claim 8, the claim recites “glutamine synthetase sequence codes for a glutamine synthetase protein”. It is unclear how the sequence of the glutamine synthetase can code for another amino acid sequence thus the claim is rendered indefinite. With regards to claim 29, the claim recites “glutamine synthetase sequence comprises or is complementary to SEQ ID NO: 26”. SEQ ID NO: 26 is a nucleic acid sequence. It is unclear how the glutamine synthetase can comprise or is complementary to a nucleic acid sequence thus the claim is rendered indefinite. The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1 and (claims 2-5, 7-11, 14-15, 20, and 29 dependent from) are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. Claim 1 is directed to all possible polynucleotides comprising: a selection cassette, wherein the selection cassette comprises: an HSVMin promoter sequence and a selection marker sequence, wherein the HSVMin promoter sequence is from 120 to 160 nucleotides long and comprises:(a) SEQ ID NO: 14 or SEQ ID NO: 24,(b) a sequence complementary to SEQ ID NO: 14 or SEQ ID NO: 24,(c) a sequence comprising at least 80% sequence identity to SEQ ID NO: 14 or SEQ ID NO: 24 or (d) a sequence comprising at least 80% sequence identity to a sequence complementary to SEQ ID NO: 14 or SEQ ID NO: 24 over a span of at least 100 nucleotides. There is no disclosure of any particular structure (genotype) to function/activity (phenotype) relationship in the disclosed species. Describing the relationship between sequence (genotype) and function (phenotype) lies at the heart of understanding biology. Currently, this is possible only locally in a narrow mutational neighborhood around a wild-type sequence rather than globally from any sequence. Direct experimental characterization of genotype-phenotype mapping has been demonstrated however, existing technology limits experimental exploration to only a tiny fraction of all possible sequences (see Sarkisyan et al., Nature, Vol. 533, pg. 397-401; published 2016 , PMID: 27193686 and Lagator et al. eLife, 11:e64543, published January 26, 2022, PMID: 35080492). Regarding the level of skill and knowledge in the art of mutagenesis of polynucleotides/promoters and effects on gene expression, gene expression is one of the most fundamental processes of life and tuning expression levels underpins complex biological functions. Computational and theoretical attempts to predict the relationship between genotype (polynucleotide/promoter sequence) and its phenotype (gene expression levels) have adopted broad approaches. Bioinformatics identifies promoters based on sequence homology but does not predict gene expression from them (see Lagator et al. eLife, 11:e64543, published January 26, 2022, PMID: 35080492). In sum, there is a lack of generalizable and predictive theoretical and biological understanding of the relationship between promoter genotype and its function (gene expression phenotype) (see Lagator et al. eLife, 11:e64543, published January 26, 2022, PMID: 35080492). Given this lack of additional representative of species encompassed by the claims, Applicants have failed to sufficiently describe the claimed invention, in such full, clear, concise, and exact terms that a skilled artisan would recognize Applicants were in possession of the claimed invention. Applicant is referred to the revised guidelines concerning compliance with the written description requirement of U.S.C. 112, first paragraph, published in the Official Gazette and also available at www.uspto.gov. Claim 1 (and claims 2-5, 7-11, 14-15, 20, and 29 dependent from) are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for a polynucleotide comprising: a selection cassette, wherein the selection cassette comprises:an HSVMin promoter sequence and a selection marker sequence, wherein the HSVMin promoter sequence is 140 nucleotides long and comprises:(a) SEQ ID NO: 14 or SEQ ID NO: 24 does not reasonably provide enablement for all possible polynucleotides comprising: a selection cassette, wherein the selection cassette comprises: an HSVMin promoter sequence and a selection marker sequence, wherein the HSVMin promoter sequence is from 120 to 160 nucleotides long and comprises:(a) SEQ ID NO: 14 or SEQ ID NO: 24,(b) a sequence complementary to SEQ ID NO: 14 or SEQ ID NO: 24,(c) a sequence comprising at least 80% sequence identity to SEQ ID NO: 14 or SEQ ID NO: 24 or (d) a sequence comprising at least 80% sequence identity to a sequence complementary to SEQ ID NO: 14 or SEQ ID NO: 24 over a span of at least 100 nucleotides. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention commensurate in scope with these claims. Factors to be considered in determining whether undue experimentation is required, are summarized in In re Wands (858 F.2d 731, 8 USPQ 2nd 1400 (Fed. Cir. 1988)) as follows: (1) the quantity of experimentation necessary, (2) the amount of direction or guidance presented, (3) the presence or absence of working examples, (4) the nature of the invention, (5) the state of the prior art, (6) the relative skill of those in the art, (7) the predictability or unpredictability of the art, and (8) the breadth of the claim(s). Claim 1 is so broad as to encompass all possible polynucleotides comprising: a selection cassette, wherein the selection cassette comprises: an HSVMin promoter sequence and a selection marker sequence, wherein the HSVMin promoter sequence is from 120 to 160 nucleotides long and comprises:(a) SEQ ID NO: 14 or SEQ ID NO: 24,(b) a sequence complementary to SEQ ID NO: 14 or SEQ ID NO: 24,(c) a sequence comprising at least 80% sequence identity to SEQ ID NO: 14 or SEQ ID NO: 24 or (d) a sequence comprising at least 80% sequence identity to a sequence complementary to SEQ ID NO: 14 or SEQ ID NO: 24 over a span of at least 100 nucleotides. The claims rejected under this section of U.S.C. 112, first paragraph, place minimal structural limits on the required variant nucleotide sequences encompassed by the claims. Since the nucleotide sequence of a promoter has an effect on gene expression, its sequence determines its structural (genotype) and functional properties (phenotype), predictability of which changes can be tolerated in a promoter’s nucleotide sequence and obtain the desired activity requires a knowledge of and guidance with regard to which nucleotides in the sequence, if any, are tolerant of modification and which are conserved (i.e. expectedly intolerant to modification), and detailed knowledge of the ways in which the promoters genotype relates to its function (phenotype. However, in this case the disclosure is limited to: (claim 1) a polynucleotide comprising: a selection cassette, wherein the selection cassette comprises: an HSVMin promoter sequence and a selection marker sequence, wherein the HSVMin promoter sequence is 140 nucleotides long and comprises:(a) SEQ ID NO: 14 or SEQ ID NO: 24. While recombinant and mutagenesis techniques are known, it is not routine in the art to screen for multiple substitutions or multiple modifications, as encompassed by the instant claims, and the positions within a polynucleotide or promoter where nucleotide modifications can be made with a reasonable expectation of success in obtaining the desired activity/utility are limited in any polynucleotide or promoter and the result of such modifications is unpredictable. In addition, one skilled in the art would expect any tolerance to modification for a given polynucleotide to diminish with each further and additional modification, e.g. multiple substitutions. The specification does not support the broad scope of the claims which encompass any possible: (claim 1): polynucleotides comprising: a selection cassette, wherein the selection cassette comprises: an HSVMin promoter sequence and a selection marker sequence, wherein the HSVMin promoter sequence is from 120 to 160 nucleotides long and comprises:(a) SEQ ID NO: 14 or SEQ ID NO: 24,(b) a sequence complementary to SEQ ID NO: 14 or SEQ ID NO: 24,(c) a sequence comprising at least 80% sequence identity to SEQ ID NO: 14 or SEQ ID NO: 24 or (d) a sequence comprising at least 80% sequence identity to a sequence complementary to SEQ ID NO: 14 or SEQ ID NO: 24 over a span of at least 100 nucleotides because the specification does not establish: (A) regions of the polynucleotide which may be modified affecting the polynucleotide of claim 1; (B) the general tolerance of polynucleotide of claim 1 to modification and extent of such tolerance; (C) a rational and predictable scheme for modifying any nucleotide of the polynucleotide of claim1 protein group with an expectation of obtaining the desired biological function; and (D) the specification provides insufficient guidance as to which of the essentially infinite possible choices is likely to be successful. Because of this lack of guidance, the extended experimentation that would be required to determine which substitutions would be acceptable to retain the required functions of the polynucleotide of claim 1 and the fact that the relationship between the sequence of a polynucleotide or promoter (genotype) and its phenotype are not well understood and are not predictable (see Lagator et al. eLife, 11:e64543, published January 26, 2022, PMID: 35080492). it would require undue experimentation for one skilled in the art to arrive at the majority of polynucleotides having the function of the polynucleotide of claim 1 of the claimed genus. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claims 1-3 and 10 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Ali et al. (FEBS OpenBio, vol. 8, pg. 1043-1060, published May 8, 2018, PMID: 29928582), hereinafter referred to as Ali. With regards to claim 1 and 10, Ali discloses an expression plasmid (polynucleotide) vector, GW-TKTSC-GFP cassette comprising a 134 nucleotide minimal TKTSC promoter comprising nucleotides of the 5’UTR of the TK gene and a selection marker sequence, NeoR/KanR (see Abstract pg. 1043 and Supplementary Materials, Plasmid Maps, pg. 5, see plasmid maps below). PNG media_image1.png 925 1131 media_image1.png Greyscale The 134 nucleotide TKTSC promoter disclosed by Ali has 81.3 % sequence identity to SEQ ID NO: 24 of the current instant application over a span of at least 100 nucleotides (See Ali Supplementary Materials, pg. 7 for promoter sequences, see alignment below). Query Match 81.3%; Score 113.8; DB 1; Length 134; Best Local Similarity 98.3%; Matches 115; Conservative 0; Mismatches 2; Indels 0; Gaps 0; Qy 24 AGCGTCTTGTCATTGGCGAATTCGAACACGCAGATGCAGTCGGGGCGGCGCGGTCCGAGG 83 | |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Db 3 ATCGTCTTGTCATTGGCGAATTCGAACACGCAGATGCAGTCGGGGCGGCGCGGTCCCAGG 62 Qy 84 TCCACTTCGCATATTAAGGTGACGCGTGTGGCCTCGAACACCGAGCGACCCTGCAGC 140 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 63 TCCACTTCGCATATTAAGGTGACGCGTGTGGCCTCGAACACCGAGCGACCCTGCAGC 119 With regards to claim 2, in addition to the teachings of Ali as applied to claim 1, the expression plasmid (polynucleotide) comprises an expression cassette (see plasmid map for GW-TKTSC-GFP, supplementary materials, pg. 7) for expression of EGFP. With regards to claim 3, in addition to the teachings of Ali as applied to claim 1 above, Ali discloses that the expression plasmid (polynucleotide) contains a DNA segment of the plasmid DNA that comprises an expression cassette, selection cassette wherein the selection cassette comprises an HSVMin promotor sequence and a selection marker (CmR) (cargo region). (see Supplementary methods, GW-TKTSC-GFP plasmid map, pg. 5). Note that paragraph 0013 of the specification defines a cargo region as comprises : an expression cassette, selection cassette, wherein the selection cassette comprises an HSVMin promotor sequence and a selection marker). Therefore, claims 1-3 and 10 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Ali et al. (FEBS OpenBio, vol. 8, pg. 1043-1060, published May 8, 2018, PMID: 29928582). Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1-3, 5, 8, 10-11, 14-15 and 20 are rejected under 35 U.S.C. 103 as being unpatentable over DNA TWOPOINTO Inc (WIPO Publication 2020/231943 A1; published November 19, 2020), hereinafter referred to as DNA TWOPOINTO, in view of by Ali et al. (FEBS OpenBio, vol. 8, pg. 1043-1060, published May 8, 2018, PMID: 29928582), hereinafter referred to as Ali. With regards to claim 1 and 8, DNA TWOPOINTO teaches transposon vectors (polynucleotide) (see paragraph 0120, pg. 49) that comprise a glutamine synthetase as a selectable marker (see paragraph 0122, pg. 49) that can be under control of a weak HSV-TK promoter (selection cassette) in the presence of inhibitory 5’UTRs in order to attenuate GS expression and improve expression of the transposon-encoded genes (see paragraph 00363, pg. 159). DNA TWOPOINTO teaches that the HSV-TK promoter is a truncated HSV-TK promotor with SEQ ID NO: 976 that is 215 nucleotides long. DNA TWOPOINTO does not teach that the HSV-TK promoter is from 120-160 nucleotides long and comprises SEQ ID NO: 24 or has 80% sequence identity to SEQ ID NO: 24. However, Ali teaches an expression plasmid (polynucleotide) vector, GW-TKTSC-GFP cassette comprising a 134 nucleotide minimal TKTSC promoter comprising nucleotides of the 5’UTR of the TK gene ((see Abstract pg. 1043 and Supplementary Materials, Plasmid Maps, pg. 5, and Supplementary pg. 7 for promoter sequences). The 134 nucleotide TKTSC promoter taught by Ali comprises and has 81.3 % sequence identity to SEQ ID NO: 24 of the current instant application over a span of at least 100 nucleotides exhibits complementarity) (See Ali Supplementary Materials, pg. 7 for promoter sequences, see alignment below). Query Match 81.3%; Score 113.8; DB 1; Length 134; Best Local Similarity 98.3%; Matches 115; Conservative 0; Mismatches 2; Indels 0; Gaps 0; Qy 24 AGCGTCTTGTCATTGGCGAATTCGAACACGCAGATGCAGTCGGGGCGGCGCGGTCCGAGG 83 | |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Db 3 ATCGTCTTGTCATTGGCGAATTCGAACACGCAGATGCAGTCGGGGCGGCGCGGTCCCAGG 62 Qy 84 TCCACTTCGCATATTAAGGTGACGCGTGTGGCCTCGAACACCGAGCGACCCTGCAGC 140 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 63 TCCACTTCGCATATTAAGGTGACGCGTGTGGCCTCGAACACCGAGCGACCCTGCAGC 119 It would have been obvious to one of ordinary skill in the art of protein engineering to substitute to 134 nucleotide minimal TKTSC promoter taught by Ali for the HSV-TK promoter taught by DNA TWOPOINTO as an optional promoter for driving gene expression. One of ordinary skill in the art of protein engineering would be motivated to do so since Ali teaches that the 134 nucleotide TKTSC promoter is a functional promoter for TKTSC. One of ordinary skill in the art of protein engineering would have expectations of success in doing so from the combined teachings of DNA TWOPOINTO and Ali. With regards to claims 2-3 and 10-11, in addition to the teachings of DNA TWOPOINTO as applied to claim 1 above, DNA TWOPOINT0 discloses that the promoter is operably linked to a nucleic acid sequence in such a way as to enable expression of the nucleic acid sequence , or a promoter is provided in an expression cassette into which the nucleic acid sequence can be transcribed can be inserted (see Paragraph 001, pg. 21). Note that paragraph 0013 of the specification defines a cargo region as comprises : an expression cassette, selection cassette, wherein the selection cassette comprises an HSVMin promotor sequence and a selection marker). With regards to claim 5 and 20, in addition to the teachings of DNA TWOPOINTO and Ali as applied to claim 1 above, DNA TWOPOINTO teaches that the transposon vector was co-transfected with a mature light chain sequence and a mature heavy chain sequence (see paragraph 0031, pg.145) (two expression cassettes). With regards to claim 14-15, in addition to the teachings of DNA TWOPOINTO as applied to claim 10 above, DNA TWOPOINTO teaches that the efficiency with which a polynucleotide may be integrated into the genome of a target cell can be increased by placing the polynucleotide in a transposon. Transposons comprise two ends that are recognized by a transposase. DNA TWOPOINTO discloses that the transposons are attractive because of their unlimited gene cargo capacity, but Mariner transposons such as Sleeping Beauty provide efficient methods for integrating heterologous DNA into mammalian cell genomes (see paragraph 007, pg. 2). Therefore, claims 1-3, 5, 8, 10-11, 14-15 and 20 are rejected under 35 U.S.C. 103 as being unpatentable over DNA TWOPOINTO Inc (WIPO Publication 2020/231943 A1; published November 19, 2020) in view of by Ali et al. (FEBS OpenBio, vol. 8, pg. 1043-1060, published May 8, 2018, PMID: 29928582). Claim 29 is rejected under 35 U.S.C. 103 as being unpatentable over over DNA TWOPOINTO Inc (WIPO Publication 2020/231943 A1; published November 19, 2020), hereinafter referred to as DNA TWOPOINTO, in view of Ali et al. (FEBS OpenBio, vol. 8, pg. 1043-1060, published May 8, 2018, PMID: 29928582), hereinafter referred to as Ali, as applied to claim 8 above, and further in view of Minshull et al. (WIPO Publication 2019/028273 A1; published February 7, 2019), hereinafter referred to as Minshull. The teachings of DNA TWOPOINTO as applied to claim 8 (and claim 1) are summarized above. Ali teaches a HSVMin promoter sequence that has complementarity to SEQ ID NO: 24 (see combined teachings of DNA TWOPOINTO and Ali as applied to claim 1 above). Neither DNA TWOPOINTO or Ali teach a glutamine synthase sequence that comprises or is complementary to SEQ ID NO: 26. However, Minshull teaches a polynucleotide sequence that encodes a glutamine synthetase, SEQ ID NO: 525, that comprises the sequence of SEQ ID NO: 26 of the current instant application (see paragraph 0031 and sequence alignment below). It would have been obvious to one of ordinary skill in the art of protein engineering before the effective filing date of the current instant application to use the polynucleotide encoding a glutamine synthetase taught by Minshull as the polynucleotide sequence for the glutamine synthetase in the selection marker taught by DNA TWOPOINTO. One of ordinary skill in the art would be motivated to do so since Minshull teaches that the sequence encodes a glutamine synthetase. One of ordinary skill in the art would have expectations of success in doing so from the combined teachings of DNA TWOPOINTO, Ali, and Minshull who provide all the guidance and teachings needed to do so. Therefore, claim 29 is rejected under 35 U.S.C. 103 as being unpatentable over DNA TWOPOINTO Inc (WIPO Publication 2020/231943 A1; published November 19, 2020), hereinafter referred to as DNA TWOPOINTO, in view of by Ali et al. (FEBS OpenBio, vol. 8, pg. 1043-1060, published May 8, 2018, PMID: 29928582), hereinafter referred to as Ali, as applied to claim 8 above, and further in view of Minshull et al. (WIPO Publication 2019/028273 A1; published February 7, 2019), hereinafter referred to as Minshull. Claims 1-5 and 7-10 are rejected under 35 U.S.C. 103 as being unpatentable over Shanghai Henlius Biotech Co. LTD (CN103509823A; published January 15, 2014), hereinafter referred to as Shanghai, in view of Ali et al. (FEBS OpenBio, vol. 8, pg. 1043-1060, published May 8, 2018, PMID: 29928582), hereinafter referred to as Ali. With regards to claim 1 and 10, Shanghai teaches a pHLX101 eukaryotic expression vector (polynucleotide) which includes a GS expression unit wherein the sequence of the GS expression unit includes a TK promoter gene sequence, a glutamine synthase gene sequence (selection marker, selection cassette), and an SV40 poly A gene sequence arranged sequentially in a 5’-3’ direction (see claim 1, pg. 1). Shanghai teaches a 172 nucleotide TK promoter sequence (SEQ ID NO: 1) (see pg. 14). Shanghai does not teach that the TK promoter sequence is from 120-160 nucleotides long or comprises at least 80% of SEQ ID NO: 24. However, Ali teaches an expression plasmid (polynucleotide) vector, GW-TKTSC-GFP cassette comprising a 134 nucleotide minimal TKTSC promoter comprising nucleotides of the 5’UTR of the TK gene ((see Abstract pg. 1043 and Supplementary Materials, Plasmid Maps, pg. 5, and Supplementary pg. 7 for promoter sequences). The 134 nucleotide TKTSC promoter taught by Ali comprises and has 81.3 % sequence identity to SEQ ID NO: 24 of the current instant application over a span of at least 100 nucleotides exhibits complementarity) (See Ali Supplementary Materials, pg. 7 for promoter sequences, see alignment below). Query Match 81.3%; Score 113.8; DB 1; Length 134; Best Local Similarity 98.3%; Matches 115; Conservative 0; Mismatches 2; Indels 0; Gaps 0; Qy 24 AGCGTCTTGTCATTGGCGAATTCGAACACGCAGATGCAGTCGGGGCGGCGCGGTCCGAGG 83 | |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Db 3 ATCGTCTTGTCATTGGCGAATTCGAACACGCAGATGCAGTCGGGGCGGCGCGGTCCCAGG 62 Qy 84 TCCACTTCGCATATTAAGGTGACGCGTGTGGCCTCGAACACCGAGCGACCCTGCAGC 140 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 63 TCCACTTCGCATATTAAGGTGACGCGTGTGGCCTCGAACACCGAGCGACCCTGCAGC 119 It would have been obvious to one of ordinary skill in the art of protein engineering to substitute the 134 nucleotide minimal TKTSC promoter taught by Ali for the TK promoter taught by Shanghai as an optional promoter for driving gene expression. One of ordinary skill in the art of protein engineering would be motivated to do so since Ali teaches that the 134 nucleotide TKTSC promoter is a functional promoter for TK. One of ordinary skill in the art of protein engineering would have expectations of success in doing so from the combined teachings of Shanghai and Ali. With regards to claim 2-3, in addition to the combined teachings of Shanghai and Ali as applied to claim 1 above, Shanghai teaches an expression plasmid (polynucleotide) comprising one or more expression cassettes and that the polynucleotide comprises a cargo region comprising the selection cassette and one or more expression cassettes (see Figure 9, and plasmid map below). PNG media_image2.png 769 1122 media_image2.png Greyscale With regards to claims 4-5, Shanghai teaches a polynucleotide wherein one or more expression cassettes (HLX01-LC, SV0 POLYA) is oriented in a first direction and the selection cassette (ampicillin resistance gene) is oriented in a second direction, wherein the first direction and second direction are opposite directions (see Figure 9, plasmid map, and plasmid map above). With regards to claim 7, Shanghai teaches a polynucleotide that comprises a selection cassette that is between the first expression cassette (i.e, SV40 polyA) and a second expression cassette (i.e, CMV promoter) (see plasmid map, Figure 9 and plasmid map above). With regards to claim 8, in addition to the teachings of Shanghai and Ali as applied to claim 1 above, Shanghai teaches that the polynucleotide contains a GS sequence (glutamine synthetase) (see plasmid map Figure 9, and plasmid map above). With regards to claim 9, Shanghai teaches a polynucleotide further comprising a third expression cassette (XLX01-HC, SV40 poly A early, GS, SV40 poly A) (see plasmid map Figure 10, and plasmid map below). PNG media_image3.png 826 1297 media_image3.png Greyscale Therefore, claims 1-5 and 7-10 are rejected under 35 U.S.C. 103 as being unpatentable over Shanghai Henlius Biotech Co. LTD (CN103509823A; published January 15, 2014), hereinafter referred to as Shanghai, in view of Ali et al. (FEBS OpenBio, vol. 8, pg. 1043-1060, published May 8, 2018, PMID: 29928582), hereinafter referred to as Ali. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to GEORGE T LOUNTOS whose telephone number is (571)272-0502. The examiner can normally be reached Monday-Friday 8:00 am - 5:00 pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Robert Mondesi can be reached at 408-918-7584. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /GEORGE THEMISTOCLIS LOUNTOS/ Examiner, Art Unit 1652 /ROBERT B MONDESI/ Supervisory Patent Examiner, Art Unit 1652
Read full office action

Prosecution Timeline

Aug 08, 2024
Application Filed
Jun 30, 2026
Non-Final Rejection mailed — §102, §103, §112 (current)

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
0%
Grant Probability
0%
With Interview (+0.0%)
3y 2m (~1y 3m remaining)
Median Time to Grant
Low
PTA Risk
Based on 2 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month