Prosecution Insights
Last updated: May 29, 2026
Application No. 18/839,397

Methods and Compositions for Short Stature Plants Through Manipulation of Gibberellin Metabolism to Increase Harvestable Yield

Non-Final OA §101§102§112
Filed
Aug 16, 2024
Priority
Feb 22, 2022 — provisional 63/312,703 +1 more
Examiner
JOHNSON, EMILY KATHARINE
Art Unit
1662
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Monsanto Technology LLC
OA Round
1 (Non-Final)
100%
Grant Probability
Favorable
1-2
OA Rounds
6m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 100% — above average
100%
Career Allowance Rate
2 granted / 2 resolved
+40.0% vs TC avg
Minimal +0% lift
Without
With
+0.0%
Interview Lift
resolved cases with interview
Typical timeline
2y 4m
Avg Prosecution
15 currently pending
Career history
19
Total Applications
across all art units

Statute-Specific Performance

§101
8.7%
-31.3% vs TC avg
§103
65.2%
+25.2% vs TC avg
§102
21.7%
-18.3% vs TC avg
§112
4.4%
-35.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 2 resolved cases

Office Action

§101 §102 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Restriction/Election In response to the communication received on March 12th, 2026, from Thomas Hiesberger, the election of Group IV, claims 50-51, 53-55, 59, 63-65, and 69, is acknowledged. Because Applicants did not distinctly and specifically point out supposed errors in the restriction requirement, the election of Group IV has been treated as an election without traverse. See MPEP § 818.03(a). Applicants have further elected the species of (a) SEQ ID NOs. 36 and 168, and (b) 28 and 29 of claim 51, and SEQ ID NO. 30 of claim 59 with traverse. Applicant argues that there would be no undue search burden. Applicant is respectfully reminded that the assertion of a search burden in a lack of unity of invention practice under PCT Rule 13.1 and 13.2 is irrelevant, therefore demonstration of a search burden is not required. However, upon further consideration and as a courtesy to the Applicant, the species of SEQ ID NOs. 36, 168, 28-29 and 30 are examined herein. Priority Applicant’s claim for the benefit of a prior-filed PRO 63/312,703 filed February 22nd, 2022 and PCT/US2023/062985 filed February 22nd, 2023 under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Thus, the earliest possible priority for the instant application is February 22nd, 2022. Information Disclosure Statement The information disclosure statements (IDS) submitted on 05/09/2025, 08/16/2024, 06/04/2025, 07/18/2025, 08/27/2025, 11/04/2025, 01/02/2026, and 03/20/2026, were considered, initialed, and attached hereto. A signed copy of the list of references cited is included with this Office Action. Status of Claims Claims 1-5, 14-15, 21-23, 32-34, 36-38, 50-51, 53-55, 59, 63-65, 69, 71-72, 75-77, 79-81, 84, 86-87, 89-91, 93-97, 99-100, 107-108, and 113 filed July 7th, 2025 are pending. Claims 1-5, 14-15, 21-23, 32-34, 36-38, 71-72, 75-77, 79-81, 84, 86-87, 89-91, 93-97, 99-100, 107-108, and 113 are withdrawn. Claims 50-51, 53-55, 59, 63-65, and 69 are examined herein. Claim Interpretation Claim 51 recites the guide RNA molecule comprises a guide sequence that is at least 95% complementary to at least 10 consecutive nucleotides of SEQ ID NO. 36, 28 and/or 29 or a sequence complementary thereto. This is taken to mean a sequence that is identical to SEQ ID NO. 36, as a sequence that is complementary to a complementary sequence would be identical. Claim Rejections - 35 USC § 112(b) The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claim 50-51, 53-55, 59, 63-65, and 69 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. The term “near” in claim 50 is a relative term which renders the claim indefinite. The term “near” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. Merriam-Webster defines “near” as at, within, or to a short distance. In this context, it is unknown how many nucleotides (or cM) would be considered a short distance from the recited locus. As currently claimed, the recombinant DNA construct comprises a transcribable DNA sequence encoding a non-coding guide RNA molecule that is at least 95% identical or complementary to at least 10 consecutive nucleotides of a target DNA sequence at or near the genomic locus of an endogenous GA3 oxidase gene of a corn or cereal plant. Near the genomic locus is unclear, particularly as the target sequence is undefined in claim 50, as is the actual genomic locus. Does “near” mean only 10 nucleotides from the locus? Or could the target sequence be over 100 nucleotides from the locus and still perform the same function? Does it mean 1 cM or 5 cM? The location or range for the location to fall within is indefinite and it is unclear if the guide sequence would actually align with the target sequence as claimed. Claims 51 and 59 further define the guide RNA molecule and the endogenous GA3 oxidase gene, but do not clarify the relatively of the term “near.” Claims 55 and 69 additionally recite a homology sequence with some complementary portion to a target DNA sequence at or near the genomic locus of the endogenous GA3 oxidase gene of the corn or cereal plant. Claim Rejections - 35 USC § 112(a) The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Written Description Claims 50-51, 53-55, 59, 63-65, and 69 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. The claims are broadly drawn to a recombinant DNA construct comprising a transcribable DNA sequence encoding a non-coding guide RNA molecule, wherein the guide RNA comprises a guide sequence that is at least 95% identical or complementary to at least 10 consecutive nucleotides of a target DNA sequence at or near the genomic locus of an endogenous GA3 oxidase gene of a corn or cereal plant. The claims are further drawn to specific guide sequences and compositions comprising the recombinant DNA molecule. The claims are drawn to the recombinant DNA construct, wherein the guide RNA molecule is a CRISPR RNA or a single-chain guide RNA, the construct comprises a sequence complementary to a PAM sequence present in the genome of the cereal plant immediately adjacent to the target DNA sequence at or near the genomic locus, and/or the endogenous GA3 oxidase gene encodes a protein that is at least 80% identical to SEQ ID NO. 30. The instant disclosure describes miRNA-expressing constructs targeting GA3 oxidase genes for suppression [Example 16]. Table 14 provides the miRNA targeting sequence and the cDNA sequence complementary to the miRNA targeting sequence. In addition to the suppression constructs, the instant disclosure describes several genome-edited mutations in the endogenous GA20 oxidase genes in corn to test the phenotypic effect of knocking out each gene [pg. 131, ¶2]. The instant disclosure describes a series of single-chain guide RNA encoding targeting constructs and a list of the gRNA constructs that were tested which may be used for genome editing of one or both of the GA20_oxidase _3 and oxidase_5 genes with a RNA-guided endonuclease. The instant disclosure describes the gene CDS coordinates for the specific targets, which are around 20 nucleotides in length. The instant disclosure does not describe gRNA constructs tested for genome editing of the GA3 oxidase genes. The instant disclosure does not describe guide RNA comprising a guide sequence that is 95% identical or complementary to 10 consecutive nucleotides of a target sequence for the GA20 oxidase genes. The instant disclosure does not describe genome-edited mutation in an endogenous GA3 oxidase gene using sgRNA to target a GA3 oxidase gene. As shown in the art, a guide RNA sequence of around 17-20 nucleotides is generally used to target a gene. Lv, J. et al. (2019, “The length of guide RNA and target DNA heteroduplex effects on CRISPR/Cas9 mediated genome editing efficiency in porcine cells,” J. Vet Sci., 20(3):e23) teaches that guide RNAs of 17 nucleotides or longer were sufficient to direct the Cas9 protein to cleave the target DNA sequence for a targeted gene [Abstract]. Lv teaches that 15 nucleotides or shorter guide RNAs had loss of function, suggesting that the length of gRNA as compared to the target sequence is a key factor in maintaining high efficiency of the CRISPR/Cas9 system. The instant claims recite a guide sequence that is at least 95% identical or complementary to at least 10 consecutive nucleotides of a target DNA sequence. The instant claims then further recite that the guide RNA molecule is a crRNA or a sgRNA. The claims suggests that a guide sequence that is 9 or 10 nucleotides long would be able to effectively target a DNA sequence to obtain the same function of a guide RNA molecule. However, as shown above, a truncated guide RNA nucleotide sequence of this length is not suggested in the art as the guide RNAs may have loss-of-function. Additionally, the specification does not reduce to practice gRNA sequences less than 19 or 20 in Table 15 for a GA20 oxidase genes and does not reduce to practice any gRNA sequences for a GA3 oxidase gene, only the miRNA suppression constructs of Example 16. As such, a guide RNA comprising a guide sequence that is at least 95% identical or complementary to 10 consecutive nucleotides of a target DNA sequence at or near the genomic locus of an endogenous GA3 oxidase gene does not provide enough structure to perform the function as claimed. One of ordinary skill in the art would not expect such an unpredictable structure to reliably and efficiently act as a guide sequence to the target sequence of an endogenous GA3 oxidase gene without potential loss-of-function or off target effects. Additionally, although the Applicant provided gRNA sequences for the GA20 oxidase gene, no examples are provided for a GA3 oxidase gene. Thus, the specification lacks sufficient variety of species to reflect the variance within the genus of the claimed guide sequence with only 9 or 10 consecutive nucleotides identical or complementary to a target DNA sequence at or near the genomic locus of an endogenous GA3 oxidase gene. Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claims 50-51, 53-55, 59, 63-65, and 69 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Allen, E. et al., “Methods and Compositions for Short Stature Plants Through Manipulation of Gibberellin Metabolism to Increase Harvestable Yield,” US Patent Application Publication No. US 20180051295 A1, filed August 17th, 2017, published February 22nd, 2018 (see, IDS 4/4 filed 05/09/2025 and IDS filed 08/16/2024). The applied Allen reference has a common inventor, Slewinski, T. and common assignee, Monsanto, with the instant application. Based upon the earlier publication date of the reference, it constitutes prior art under 35 U.S.C. 102(a)(1) and does not qualify for an exception under 102(b)(1)(A). Claim 50 recites a recombinant DNA construct comprising a transcribable DNA sequence encoding a non-coding guide RNA molecule, wherein the guide RNA comprises a guide sequence that is at least 95% identical or complementary to at least 10 consecutive nucleotides of a target DNA sequence at or near the genomic locus of an endogenous GA3 oxidase gene of a corn or cereal plant. Claim 51 recites a composition comprising the recombinant DNA molecule of claim 50, wherein the guide RNA molecule comprises a guide sequence that is at least 95% complementary to at least 10 consecutive nucleotides of SEQ ID NO: 36 Claim 53 recites a composition comprising the recombinant DNA molecule of claim 50, further comprising an RNA-guided endonuclease. Claim 54 recites the composition of claim 53, wherein the RNA-guided endonuclease in the presence of the guide RNA molecule causes a double strand break or nick at or near the target DNA sequence in the genome of the corn or cereal plant. Claim 55 recites a composition comprising the recombinant DNA molecule of claim 50, further comprising a recombinant DNA donor template comprising at least one homology sequence or homology arm, wherein the at least one homology sequence or homology arm is at least 70% complementary to at least 20 consecutive nucleotides of a target DNA sequence, wherein the target DNA sequence is a genomic sequence at or near the genomic locus of the endogenous GA3 oxidase gene of the corn or cereal plant. Claim 59 recites the recombinant DNA construct of claim 50, wherein the transcribable DNA sequence is operably linked to a plant-expressible promoter. Claim 63 recites a DNA molecule or vector comprising the recombinant DNA construct of claim 50. Claim 64 recites a bacterial or host cell comprising the recombinant DNA construct of claim 50. Claim 65 recites a corn or cereal plant, plant part or plant cell comprising the recombinant DNA construct of A corn or cereal plant, plant part or plant cell comprising the recombinant DNA construct of claim 50. Claim 69 recites a composition comprising a first DNA molecule or vector and a second DNA molecule or vector, wherein the first DNA molecule or vector comprises the recombinant DNA construct encoding a guide RNA molecule that targets an endogenous GA3 oxidase gene of a corn or cereal plant of claim 50, and the second DNA molecule or vector comprises a second recombinant DNA construct encoding a RNA-guided endonuclease. Regarding claim 50, Allen teaches compositions and methods for altering gibberellin (GA) content in corn or other cereal plants [Abstract]. Methods and compositions are also provided for altering the expression of genes related to gibberellin biosynthesis through suppression, mutagenesis and/or editing of specific subtypes of GA20 or GA3 oxidase genes. Modified plants have reduced gibberellin levels and improved characteristics, such as reduced plant height and increased lodging resistance. Allen teaches modified plants with reduced gibberellin levels and improved characteristics, such as reduced plant height and increased stem diameter relative to a wild-type to improve lodging resistance [¶211]. Allen teaches Embodiment 165, wherein a recombinant DNA construct comprising a transcribable DNA sequence encoding a non-coding guide RNA molecule, wherein the guide RNA molecule comprises a guide sequence that is at least 95%, at least 96%, at least 97%, at least 99% or 100% complementary to at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides of a target DNA sequence at or near the genomic locus of an endogenous GA oxidase gene of a corn or cereal plant [¶390]. Allen teaches that plants or plant cells may be transformed with a transcribable DNA sequence encoding a non-coding RNA molecule that targets at least one GA20 oxidase gene and/or at least one GA3 oxidase gene for suppression (i.e., endogenous GA3 oxidase gene) [¶211]. Regarding claim 51, Allen teaches that GA oxidase genes in other cereal plants having the greatest sequence identity/similarity to the GA20 oxidase_3, GA20 oxidase_4, GA20 oxidase_5, GA3 oxidase_1, and/or GA3 oxidase_2 genes in corn that are shown to produce a short stature, semi-dwarf phenotype and other beneficial traits when suppressed with a recombinant DNA suppression construct, may also be targets for suppression to produce transgenic cereal plants having similar semi-dwarf and/or lodging resistance phenotypes [¶189]. Allen teaches that a non-coding RNA molecule targeting the GA3 oxidase_1 gene for suppression may comprise a sequence that is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or 100% complementary to at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, or at least 27 consecutive nucleotides of SEQ ID NO: 36 [¶122]. SEQ ID NO. 36 of Allen is identical to SEQ ID NO. 36 of the instant application (see, alignment below). Query Match 100.0%; Score 1788; Length 1788; Best Local Similarity 100.0%; Matches 1788; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AATCCCAGCGTGCGTAATCTATTGCCCACATGCCGACGCCGTCGCACCTCAACAAGAACC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 AATCCCAGCGTGCGTAATCTATTGCCCACATGCCGACGCCGTCGCACCTCAACAAGAACC 60 Qy 61 CGCGCTACCTGGACTTCCGGGCGGCGCGGCGGGTGCCGGAGTCGCACGCCTGGCCGGGCC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 CGCGCTACCTGGACTTCCGGGCGGCGCGGCGGGTGCCGGAGTCGCACGCCTGGCCGGGCC 120 Qy 121 TGCACGACCACCCCGTCGTGGACGGCGGCGCGCCGGGCCCCGACGCCGTGCCGGTGGTGG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 TGCACGACCACCCCGTCGTGGACGGCGGCGCGCCGGGCCCCGACGCCGTGCCGGTGGTGG 180 Qy 181 ACCTGGGCGCCGCGGACCCGGCGCCGGCGCCGGCGGCGGCGGTGGCCCGCGCCGCCGAGC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 ACCTGGGCGCCGCGGACCCGGCGCCGGCGCCGGCGGCGGCGGTGGCCCGCGCCGCCGAGC 240 Qy 241 AATGGGGCGCGTTCCTGCTCACGGGCCACGGCGTCCCCGCGGACCTGCTGGCGCGCGTGG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 AATGGGGCGCGTTCCTGCTCACGGGCCACGGCGTCCCCGCGGACCTGCTGGCGCGCGTGG 300 Qy 301 AGGACCGGATCGCCACCATGTTCGCGCTGCCGGCCGACGACAAGATGCGCGCCGTGCGCG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 AGGACCGGATCGCCACCATGTTCGCGCTGCCGGCCGACGACAAGATGCGCGCCGTGCGCG 360 Qy 361 GGCCCGGCGACGCCTGCGGCTACGGCTCCCCGCCCATCTCCTCCTTCTTCTCCAAGTGCA 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 GGCCCGGCGACGCCTGCGGCTACGGCTCCCCGCCCATCTCCTCCTTCTTCTCCAAGTGCA 420 Qy 421 TGTGGTCCGAGGGCTACACCTTCTCGCCGGCCTCCCTCCGCGCCGACCTCCGCAAGCTCT 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 TGTGGTCCGAGGGCTACACCTTCTCGCCGGCCTCCCTCCGCGCCGACCTCCGCAAGCTCT 480 Qy 481 GGCCCAAGGCCGGCGACGACTACACCAGCTTCTGGTACGTTGCGTTGCGTGCTTGTGTGC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 GGCCCAAGGCCGGCGACGACTACACCAGCTTCTGGTACGTTGCGTTGCGTGCTTGTGTGC 540 Qy 541 GCGCACACCTGCCGACCGCGGCCACACCGTACGCAACCCACGCGTACGTACGTGCGCTAG 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 GCGCACACCTGCCGACCGCGGCCACACCGTACGCAACCCACGCGTACGTACGTGCGCTAG 600 Qy 601 CTACCTGCTTCGCTCGCTTCGCTCCTCTCGCCTCGCCATGCATATGCACGTACGGCCGTA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 CTACCTGCTTCGCTCGCTTCGCTCCTCTCGCCTCGCCATGCATATGCACGTACGGCCGTA 660 Qy 661 CAGGTACAGCAGCAGGTCACACGCACGAACGCACGCACGCACCAGCACCGATATGATACA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 CAGGTACAGCAGCAGGTCACACGCACGAACGCACGCACGCACCAGCACCGATATGATACA 720 Qy 721 TCATCGACGTGTCGTCCCCCCGTCTAAGGCCATGCATGCATGCAAGCACGCCTAGCTAGC 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 TCATCGACGTGTCGTCCCCCCGTCTAAGGCCATGCATGCATGCAAGCACGCCTAGCTAGC 780 Qy 781 CCTTTTGGCTTGCTAGCTGACGAGGGGAGCTAGGACGAGCATACTTACTGTGCGCGTCAT 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 CCTTTTGGCTTGCTAGCTGACGAGGGGAGCTAGGACGAGCATACTTACTGTGCGCGTCAT 840 Qy 841 GCTCAATTGCTCACACTATACTACTACTTGTTACTACAGTGATGTGATGGAGGAGTTCCA 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 GCTCAATTGCTCACACTATACTACTACTTGTTACTACAGTGATGTGATGGAGGAGTTCCA 900 Qy 901 CAAGCACATGCGCGCCCTCGCGGACAAGCTGCTGGAGCTGTTCCTCATGGCGCTGGGGCT 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 CAAGCACATGCGCGCCCTCGCGGACAAGCTGCTGGAGCTGTTCCTCATGGCGCTGGGGCT 960 Qy 961 CACCGACGAGCAGGCCAGCGCCGTCGAGGCCGAGCGGAGGATCGCCGAGACGATGACCGC 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 CACCGACGAGCAGGCCAGCGCCGTCGAGGCCGAGCGGAGGATCGCCGAGACGATGACCGC 1020 Qy 1021 CACCATGCATCTCAACTGGTGGGTATATATTATTGTCTGTCATGTTGTCGTCGTCGTACG 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1021 CACCATGCATCTCAACTGGTGGGTATATATTATTGTCTGTCATGTTGTCGTCGTCGTACG 1080 Qy 1081 CGTTGCGGTTGGGTGTACATGTATATAACACAAACAACAAAAAACTAACGCCGTGCCGAC 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1081 CGTTGCGGTTGGGTGTACATGTATATAACACAAACAACAAAAAACTAACGCCGTGCCGAC 1140 Qy 1141 GACGACGACGATCATCAGGTACCCGAGGTGCCCGGACCCGCGGCGCGCGCTGGGGCTGAT 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1141 GACGACGACGATCATCAGGTACCCGAGGTGCCCGGACCCGCGGCGCGCGCTGGGGCTGAT 1200 Qy 1201 CGCGCACACCGACTCGGGCTTCTTCACCTTCGTGATGCAGAGCCTCGTGCCCGGGCTGCA 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1201 CGCGCACACCGACTCGGGCTTCTTCACCTTCGTGATGCAGAGCCTCGTGCCCGGGCTGCA 1260 Qy 1261 GCTCTTCCGCCACGCCCCGGACCGGTGGGTGGCGGTGCCGGCCGTGCCGGGCGCCTTCGT 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1261 GCTCTTCCGCCACGCCCCGGACCGGTGGGTGGCGGTGCCGGCCGTGCCGGGCGCCTTCGT 1320 Qy 1321 CGTCAACGTGGGCGACCTCTTCCACATCCTCACCAACGGCCGGTTCCACAGCGTGTACCA 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1321 CGTCAACGTGGGCGACCTCTTCCACATCCTCACCAACGGCCGGTTCCACAGCGTGTACCA 1380 Qy 1381 CCGCGCCGTCGTGAACCGGGACCTCGACAGGATCTCGCTCGGCTACTTCCTCGGCCCGCC 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1381 CCGCGCCGTCGTGAACCGGGACCTCGACAGGATCTCGCTCGGCTACTTCCTCGGCCCGCC 1440 Qy 1441 GCCGCACGCCAAGGTGGCGCCGCTGCGCGAGGCCGTGCCGCCCGGCCGGGCCCCCGCGTA 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1441 GCCGCACGCCAAGGTGGCGCCGCTGCGCGAGGCCGTGCCGCCCGGCCGGGCCCCCGCGTA 1500 Qy 1501 CCGCGCCGTCACGTGGCCCGAGTACATGGGCGTCCGCAAGAAGGCCTTCACCACCGGCGC 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1501 CCGCGCCGTCACGTGGCCCGAGTACATGGGCGTCCGCAAGAAGGCCTTCACCACCGGCGC 1560 Qy 1561 CTCCGCGCTCAAGATGGTCGCCCTCGCCGCCGCCGCCGACCTCGACGACGACGGCGACGC 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1561 CTCCGCGCTCAAGATGGTCGCCCTCGCCGCCGCCGCCGACCTCGACGACGACGGCGACGC 1620 Qy 1621 CGCCGTCGTCCATCAGCAGCAGCAGCTAGTCGTCTCGTCGTAGCCGAGACCGATCGCCGG 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1621 CGCCGTCGTCCATCAGCAGCAGCAGCTAGTCGTCTCGTCGTAGCCGAGACCGATCGCCGG 1680 Qy 1681 AGACTGATGCTGATGATGATGCATATATACATGAGAGAAATCGTCGAGTAGACTAGCCGA 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1681 AGACTGATGCTGATGATGATGCATATATACATGAGAGAAATCGTCGAGTAGACTAGCCGA 1740 Qy 1741 TTGCAAAAGCAACCCCAGCTGCCGAAACCTGGCATATCGATCCCATTC 1788 |||||||||||||||||||||||||||||||||||||||||||||||| Db 1741 TTGCAAAAGCAACCCCAGCTGCCGAAACCTGGCATATCGATCCCATTC 1788 Regarding claim 53, Allen teaches a composition comprising the recombinant DNA construct of Embodiment 165 (a recombinant DNA construct comprising a transcribable DNA sequence encoding a non-coding guide RNA molecule, wherein the guide RNA molecule comprises a guide sequence that is at least 95%, at least 96%, at least 97%, at least 99% or 100% complementary to at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, or at least 25 consecutive nucleotides of a target DNA sequence at or near the genomic locus of an endogenous GA oxidase gene of a corn or cereal plant [¶390) [¶402] and further comprising a RNA-guided endonuclease [¶403]. Regarding claim 54, Allen teaches the composition comprising Embodiment 165, wherein an engineered site-specific nuclease that binds to a target site at or near the genomic locus of an endogenous GA oxidase gene of a corn or cereal plant and causes a double-strand break or nick at the target site [¶424]. Regarding claim 55, Allen teaches a composition comprising the recombinant DNA construct of Embodiment 165 [¶402] and further comprising a recombinant DNA donor template comprising at least one homology sequence or homology arm, wherein the at least one homology sequence or homology arm is at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 99% or 100% complementary to at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, at least 50, at least 60, at least 70, at least 80, at least 90, at least 100, at least 150, at least 200, at least 250, at least 500, at least 1000, at least 2500, or at least 5000 consecutive nucleotides of a target DNA sequence, wherein the target DNA sequence is a genomic sequence at or near the genomic locus of an endogenous GA oxidase gene of a corn or cereal plant [¶408]. Regarding claim 59, Allen teaches the recombinant DNA construct of Embodiment 165, wherein the transcribable DNA sequence is operably linked to a plant-expressible promoter [¶393]. Regarding claim 63, Allen teaches a DNA molecule comprising the recombinant DNA construct of Embodiment 165 [¶398]. Regarding claim 64, Allen teaches a bacterial cell comprising the recombinant DNA construct of Embodiment 165 [¶400]. Regarding claim 65, Allen teaches a corn or cereal plant, plant part or plant cell comprising the recombinant DNA construct of Embodiment 165 [¶401]. Regarding claim 69, Allen teaches a composition comprising the recombinant DNA construct of Embodiment 165, comprising a first DNA molecule or vector and a second DNA molecule or vector, wherein the first DNA molecule or vector comprises the recombinant DNA construct encoding the guide RNA molecule, and the second DNA molecule or vector comprises the second recombinant DNA construct encoding the RNA-guided endonuclease [¶407]. Thus, Allen anticipates the claimed invention. Double Patenting A rejection based on double patenting of the “same invention” type finds its support in the language of 35 U.S.C. 101 which states that “whoever invents or discovers any new and useful process... may obtain a patent therefor...” (Emphasis added). Thus, the term “same invention,” in this context, means an invention drawn to identical subject matter. See Miller v. Eagle Mfg. Co., 151 U.S. 186 (1894); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Ockert, 245 F.2d 467, 114 USPQ 330 (CCPA 1957). A statutory type (35 U.S.C. 101) double patenting rejection can be overcome by canceling or amending the claims that are directed to the same invention so they are no longer coextensive in scope. The filing of a terminal disclaimer cannot overcome a double patenting rejection based upon 35 U.S.C. 101. Claims 50-51, 53-55, 59, 63-65, and 69 are provisionally rejected under 35 U.S.C. 101 as claiming the same invention as that of claims 125-130, 133-138, and 141 of co-pending Application No. 19/492,008 (reference application), “Methods and Compositions for Short Stature Plants Through Manipulation of Gibberellin Metabolism to Increase Harvestable Yield,” with the same common Inventors, Paciorek, T. and Slewinski, T., and same common Applicant, Monsanto. This is a provisional statutory double patenting rejection since the claims directed to the same invention have not in fact been patented. The instant claims are drawn to a recombinant DNA construct comprising a transcribable DNA sequence encoding a non-coding guide RNA molecule, wherein the guide RNA comprises a guide sequence that is at least 95% identical or complementary to at least 10 consecutive nucleotides of a target DNA sequence at or near the genomic locus of an endogenous GA3 oxidase gene of a corn or cereal plant. The claims are further drawn to the guide RNA molecule comprising a guide sequence that is at least 95% complementary to at least 10 consecutive nucleotides of SEQ ID NO: 36 or 168, or a sequence complementary thereto; and/or the guide RNA molecule comprises a guide sequence that is at least 95 complementary to at least 10 consecutive nucleotides of SEQ ID NO: 28 or 29, or a sequence complementary thereto. The claims are drawn to the composition comprising an RNA-guided endonuclease, wherein the RNA-guided endonuclease in the presence of the guide RNA molecule causes a double strand break in the genome of corn or cereal. The claims are drawn to further comprise a recombinant DNA donor template and the endogenous GA3 oxidase gene encodes a protein that is at least 80% identical to SEQ ID NO. 30, the guide RNA molecule is a cRNA or a sgRNA, the guide RNA comprises a sequence complementary to a PAM sequence in the genome of the cereal plant, or is operably linked to a plant expressible promoter. The claims are drawn to a corn or cereal plant, bacterial or host cell, and DNA molecule or vector comprising the construct, and a composition comprising the recombinant DNA construct and a second construct encoding a RNA-guided endonuclease. Conflicting claim 125 is drawn to a recombinant DNA construct comprising a transcribable DNA sequence encoding a non-coding guide RNA molecule, wherein the guide RNA molecule comprises a guide sequence that is at least 95% complementary to at least 10 consecutive nucleotides of a target DNA sequence upstream region, the promoter region, the transcribable DNA region, 5’ untranslated region, 3’UTR, and/or downstream region of an endogenous GA3 oxidase gene of a corn plant. Conflicting claim 126 is drawn to the construct of claim 125 wherein the guide RNA comprises a sequence that is at least 95% complementary at least 10 consecutive nucleotides of SEQ ID NOs. 36 and 168 (same SEQ ID NOs. as the instant application). Conflicting claim 127 is drawn to the construct of claim 125 or 126 wherein the guide RNA molecule comprises a guide sequence that is at least 95% complementary to at least 10 consecutive nucleotides of SEQ ID NOs. 28 and 29 (identical to SEQ ID NOs. 28 and 29 of the instant application). Conflicting claim 128 is drawn to the construct of claim 125-127, wherein the transcribable DNA sequence is operably linked to a plant-expressible promoter. Conflicting claim 129 is drawn to the construct of any one of claims 125-128, wherein the guide RNA molecule is a CRISPR RNA (crRNA) or a single-chain guide RNA (sgRNA). Conflicting claim 130 is drawn to the construct of any one of claims 125-129, wherein the guide RNA comprises a sequence complementary to a PAM sequence present in the gnome of the cereal plant. Conflicting claim 133 is drawn to the construct of claims 125-132, wherein the endogenous GA3 oxidase gene encodes a protein that is at least 80% identical to SEQ ID NO. 30 (identical to SEQ ID NO. 30 of the instant application). Conflicting claims 134-136 are drawn to a corn plant, a bacterial or host cell, and a DNA molecule or vector comprising the recombinant DNA construct of any one of claims 125-132. Conflicting claim 137 is drawn to a composition comprising the construct of any one of claims 125-132 further comprising a RNA-guided endonuclease. Conflicting claim 138 is drawn to a composition comprising the construct of any one of claims 125-132, wherein the composition further comprises a second recombinant DNA construct comprising a second transcribable DNA sequence encoding a RNA-guided endonuclease. Conflicting claim 141 is drawn to the composition of claim 138, further comprising a recombinant DNA donor template comprising at least one homology sequence or arm, wherein the at least one homology sequence or homology arm is at least 70% complementary to at least 20 consecutive nucleotides of a genomic sequence at or near the endogenous GA3 oxidase gene of a corn plant. The conflicting claims include the same recombinant DNA construct as instant claim 50 with the additional limitations of instant claims 51, 53-55, 59, 63-65, and 69. Therefore, one of ordinary skill in the art would readily recognize that the conflicting claims 125-130, 133-138, and 141 of the pending United States Patent Application No. 19/492,008 and the claims in the instant application are identical and are not patentably distinct. Conclusion No claims allowed. Contact Information Any inquiry concerning this communication or earlier communications from the examiner should be directed to EMILY K. JOHNSON whose telephone number is (571)272-5761. The examiner can normally be reached Monday - Friday 7:30 am - 5:00 pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at 571-270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /EMILY K JOHNSON/Examiner, Art Unit 1662 /BRATISLAV STANKOVIC/Supervisory Patent Examiner, Art Units 1661& 1662
Read full office action

Prosecution Timeline

Aug 16, 2024
Application Filed
Apr 30, 2026
Non-Final Rejection mailed — §101, §102, §112
May 05, 2026
Response Filed

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
100%
Grant Probability
99%
With Interview (+0.0%)
2y 4m (~6m remaining)
Median Time to Grant
Low
PTA Risk
Based on 2 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month