DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claim Status
Claims 4-15, 17, and 18 are pending. Claims 4, 6-8, 10 and 15 are currently amended. Claims 1-3, and 16 are currently canceled. Claims 4-15, 17, and 18 are examined on the merits.
Response to Amendment
The rejections of claims 1-3 under 35 U.S.C. 101 are withdrawn in view of the cancelation to the claims.
The rejection of Claims 6-9, 15, 17 and 18 under 35 U.S.C. 112(b) are withdrawn in view of amendment to the claims.
The rejection of Claims 1-3 under 35 USC § 102(a)(1) is withdrawn in view of amendment to the claims.
The rejection of claim 16 under 35 USC § 103 is withdrawn in view of amendment to the claims.
The rejection of claims 4-5 under 35 USC § 103 is maintained and modified. Applicant amended claim 4 to recite “having at least 95% sequence identity to SEQ ID NO:1, wherein the transgenic rice plant exhibits increased grain weight and/or grain number per plant”, and therefore the rejection has been revised to additionally rely upon Kuroha (Takeshi Kuroha et. al., The Plant Cell (2009) Vol. 21: 3152–3169) for teaching this limitation.
The rejection of claims 6-15, 17, and 18 under 35 USC § 103 is maintained and modified in view of Applicant’s claim amendments and arguments.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 4-5 are rejected under 35 U.S.C. §103 as being unpatentable over Kurakawa (Takashi Kurakawa et. al., NATURE (2007) Vol 445, pp652-655), in view of Kuroha (2009).
Claim 4 is drawn to transgenic rice plant transformed with a nucleic acid molecule having at least 95% sequence identity to SEQ ID NO:1, wherein the transgenic rice plant exhibits increased grain weight and/or grain number per plant. Claim 5 is drawn to the transgenic rice plant of claim 4, wherein the nucleic acid molecule is operably linked to a promoter functional in rice plants.
Kurakawa teaches the rice LOG 1 nucleic acid sequence (LOC_Os01g51210), a cytokinin-activating enzyme, and discloses the LOG1 nucleic acid sequence (supplementary fig 2). Sequence comparation shows that Kurakawa’s disclosed LOG1 nucleotide sequence contains a region that is 100% identical to applicant’s SEQ ID NO:1. Such that SEQ ID NO:1 is a portion of Kurakawa’s disclosed LOG1 nucleic acid. Kurakawa further teaches that LOG functions in cytokinin activation and meristem development (page 652, left column; fig.1), and that mutation of LOG causes reduction in panicle size with abnormal branching patterns and defective floral organ development (page 652; fig. 1), which are reproductive-development traits associated with grain production.
Kurakawa does not teach a transgenic rice plant transformed with the claimed nucleic acid molecule and exhibiting increased grain weight and/or grain number per plant.
Kuroha teaches that LONELY GUY (LOG) cytokinin-activating enzymes function in the directed cytokinin activation pathway and that rice LOG was previously identified as a cytokinin-activating enzyme that works in rice shoot meristems (Abstract). Kuroha further teaches that Arabidopsis LOG genes are homologs of rice LOG (page 3154 fig.1) and that seven Arabidopsis LOG proteins had enzymatic activities equivalent to rice LOG (Abstract, Table 1). Kuroha also teaches that constitutive overexpression of Arabidopsis LOG genes under the CaMV 35S promoter produced larger mature viable seeds than wild type, and that 35Spro:LOG4 seeds were approximately twice the weight of wild-type seeds (page 3161 Fig 8K-8L). Kuroha further explains that the larger seed phenotype was attributable to enhanced cell division during embryo development and that cytokinin activity in the ovule-bearing sporophyte is a determinant of seed size (page 3164, right column, paragraph 3).
Accordingly, a POSITA would have been motivated to introduce Kurakawa’s LOG1 (LOC_Os01g51210) nucleic acid sequence into rice using routine rice transformation and promoter-driven expression methods to obtain a transgenic rice plant transformed with the nucleic acid molecule as recited in claim 4, and to operably link the nucleic acid to a promoter functional in rice as recited in claim 5, with reasonable expectation of increasing grain weight. A POSITA would have had such motivation and expectation because Kurakawa teaches that rice LOG1 is a cytokinin-activating enzyme involved in meristem and floral/panicle development, while Kuroha teaches that LOG-family cytokinin-activating enzymes are functional homologs across plants and that increased LOG expression increases active cytokinin activity and produces larger, heavier seed.
The claimed invention in claims 4-5 as a whole is prima facie obvious over the combined teachings of the prior arts above.
Claims 6-14 are rejected under 35 U.S.C. §103 as being unpatentable over Kurakawa (2007) in view of Wang-2020 (Changgui Wang et. al., Plant Molecular Biology (2020) 102:373–388).
Claim 6 is drawn to a rice plant, or part thereof, comprising a genomic mutation in an endogenous nucleic acid molecule encoding an amino acid sequence having at least 95% sequence identity to SEQ ID NO:2, wherein the genomic mutation confers reduced expression of the endogenous nucleic acid molecule and results in the plant exhibiting increased grain weight and/or grain number per plant. Claim 7 further requires at least 99% sequence identity to SEQ ID NO:2. Claim 8 further requires the amino acid sequence shown in SEQ ID NO:2. Claim 9 further requires that the genomic mutation comprises an insertion, a deletion or a substitution.
The amino acid sequence of SEQ ID NO: 2 is the protein encoded by SEQ ID NO: 1 of the instant application. Under the broadest reasonable interpretation, claim 6 encompasses mutations in endogenous rice genes encoding proteins having at least 95% sequence identity to SEQ ID NO: 2, including rice LOG 1 nucleic acid sequence (LOC_Os01g51210) gene identified by Kurakawa.
For the same reasons set forth above with respect to claim 4, Kurakawa teaches rice LOG1/LOG-family cytokinin-activation genes and their involvement in meristem and reproductive development, including panicle architecture and floral organ development.
Wang-2020 teaches using CRISPR-Cas9 genome editing technology to create OsLOGL5 knock-out mutations (Page 375 last paragraph, 378 first paragraph). Wang-2020 further teaches “mutations such as insertion, deletion, or substitution of at least one nucleotide were produced, which resulted in the early termination of the coding sequence, translation frame-shift and/or deletion of at least one amino acid residues” (page378, last paragraph). Wang-2020 additionally teaches that modification of the rice cytokinin-activation enzyme-like gene OsLOG5 increased grain-yield traits including grain number and thousand-seed weight under multiple filed conditions (page 373, abstract; page 378-378).
A POSITA would have been motivated to apply the genome-editing approaches taught by Wang-2020 to the endogenous LOG/LOGL-family gene taught by Kurakawa in order to obtain rice plants having reduced expression of the endogenous gene and to evaluate resulting plants for improved grain-related traits, including increased grain weight and/or gain number per plant, with a reasonable expectation of success because Wang-2020 demonstrates the modification of a related LOG/LOGL-family gene affects grain-yield trats in rice.
Accordingly, the claimed invention in claims 6-9 as a whole is prima facie obvious over the combined teachings of the prior arts above.
Claim 10 is drawn to a method of making a mutant rice plant, comprising the steps of: a) inducing mutagenesis in rice cells; b) obtaining one or more plants from the cells; and c) identifying at least one of the plants that contains a mutation in an endogenous gene encoding a polypeptide having a wild-type sequence of SEQ ID NO:2 that regulates grain weight and/or grain number per plant, wherein the at least one of the plants that contains the mutation exhibits increased grain weight and/or grain number per plant.
For the same reasons set forth above with respect to claims 6-9, Kurakawa teaches rice LOG/LOGL-family cytokinin-activation genes and their involvement in meristem and reproductive development, including panicle architecture and floral organ development. Kurakawa further teaches the rice contains a LOG/LOGL gene family including LOG1 (LOC_Os01g51210) and OsLOGL5 (LOC_Os03g64070) (page 653, paragraph 2).
Wang-2020 teaches that CRISPR-edited variants at the 3’end of the OsLOGL5 (LOC_Os03g64070) coding sequence resulted in normal plant morphology but increased grain yield under well-watered, drought, normal nitrogen, and low nitrogen field conditions, including test across multiple locations (page 373, abstract). Wang-2020 further teaches that OsLOGL5-edited plants significantly increased yield components including seed-setting rate, total grain number, full-filled grain number per panicle, and thousand-seed weight (e.g., under drought) (abstract).
Accordingly, a POSITA would have been motivated to induce mutagenesis in rice cells, obtain regenerated plants , and identify plants containing mutations in LOG/LOGL-family genes, including the endogenous gene encoding SEQ ID NO:2, for evaluation and selection of plants exhibiting increased grain weight and/or grain number per plant, with a reasonable expectation of success.
Claims 11-14 are drawn to the method of claim 10, wherein the rice cells are in a seed (claim 11); further comprising the steps of d) crossing the at least one of the plants that contains the mutation with a second rice plant; and e) selecting progeny of the cross that have the at least one mutation, wherein the progeny plant is homozygous for the at least one mutation (claim 12); further comprising the steps of collecting seed produced by the at least one progeny rice plant (claim 13); further comprising the step of growing a rice plant from the at least one progeny plant from the seed (claim 14).
Wang-2020 teaches producing genome-edited rice lines and advancing them through T0/T1/T2 generations with genotyping-based selection (page 378) to obtain stable (including homozygous) progeny. Such generation advancement and selection would have involved obtaining seed for genotyping and phenotypic evaluation (page 384, Materials and methods).
In view of Kurakawa’s teaching that LOG1 (LOC_Os01g51210) is the endogenous rice cytokinin-activation enzyme locus, and wang-2020’s teaching that genomic mutations (an insertion, a deletion or a substitution) can be introduced into endogenous cytokinin-activation enzyme-like genes to reduce expression in rice. A POSITA would have been motivated to apply Wang-2020’s genomic mutation approaches to the endogenous LOG nucleic acid molecule taught by Kurakawa to obtain rice plant (part thereof) comprising a genomic mutation that confers reduced expression of the endogenous nucleic acid molecules.
A person of ordinary skill in the art would have been motivated to induce mutagenesis in rice cell, regenerate plants, and screen for mutants in the gene having the wild-type sequence of SEQ ID NO:1 (a LOG/LOGL family member), in view of the bombinated teachings of Kurakawa and Wang-2020. Kurakawa teaches that rice LOG family genes encode cytokinin-activating enzymes and that mutation of a LOG family member alters inflorescence/meristem development (including panicle architecture and reproductive development), thereby identifying LOG/LOGL family genes as biologically important endogenous targets in rice whose modification predictably affects traits tied to grain production. Wang-2020 teaches that modifying a rice cytokinin-activation enzyme-like gene (OsLOGL5) by genome editing can increase grain yield and yield components under field conditions, demonstrating that LOG/LOGL family genes are credible targets for improving grain traits and providing a reasonable expectation of success that mutagenizing and screening LOG/LOGL family members would identify beneficial alleles. Accordingly, a POSITA would have reasonably expected that applying routine mutagenesis and selection steps, including (a) inducing mutagenesis, (b) obtaining plants from the treated cells, and (c) identifying plants with a mutation in the SEQ ID NO:1 LOG/LOGL gene, would yield at least one mutant plant exhibiting increased grain weight and/or grain number per plant.
The claimed invention in claims 11-14 as a whole is prima facie obvious over the combined teachings of the prior arts above.
CLUSTAL O(1.2.4) multiple sequence alignment
LOC_Os01g51210 gatcgcaactttccgagagaagataacacagcgcacagaaaagagaagctgccaaacccg 60
SEQ ID NO:1 ------------------------------------------------------------ 0
LOC_Os01g51210 gccacctcctcctctcctctcctcccccatcgccttccccaatccgtcggcgaggccaag 120
SEQ ID NO:1 ------------------------------------------------------------ 0
LOC_Os01g51210 gcaggcaggaagccatgggcgacaacagcgccgccgcggcggccgtggccgcgccgcgcg 180
SEQ ID NO:1 --------------atgggcgacaacagcgccgccgcggcggccgtggccgcgccgcgcg 46
**********************************************
LOC_Os01g51210 gcaggttcggcaggatctgcgtcttctgcggcagcaacgccggcaaccgcgcggtgttcg 240
SEQ ID NO:1 gcaggttcggcaggatctgcgtcttctgcggcagcaacgccggcaaccgcgcggtgttcg 106
************************************************************
LOC_Os01g51210 gcgacgcggcgctccagctcgggcaggagctggtgtcgagagggatcgagttggtctacg 300
SEQ ID NO:1 gcgacgcggcgctccagctcgggcaggagctggtgtcgagagggatcgagttggtctacg 166
************************************************************
LOC_Os01g51210 gtggcggcagcgtcgggttgatgggcttgatcgcgcagacggttcttgatggcggctgcg 360
SEQ ID NO:1 gtggcggcagcgtcgggttgatgggcttgatcgcgcagacggttcttgatggcggctgcg 226
************************************************************
LOC_Os01g51210 gtgttctcggggtgattccaaaagcactcatgcccaccgagatatcaggtgcaagtgttg 420
SEQ ID NO:1 gtgttctcggggtgattccaaaagcactcatgcccaccgagatatcaggtgcaagtgttg 286
************************************************************
LOC_Os01g51210 gagaagtgaaaattgtgtctgacatgcatgagaggaaagctgagatggcacgccaatccg 480
SEQ ID NO:1 gagaagtgaaaattgtgtctgacatgcatgagaggaaagctgagatggcacgccaatccg 346
************************************************************
LOC_Os01g51210 atgccttcatcgctcttcctggagggtatggaacaatggaggagttgttagagatgataa 540
SEQ ID NO:1 atgccttcatcgctcttcctggagggtatggaacaatggaggagttgttagagatgataa 406
************************************************************
LOC_Os01g51210 cttggtcacaacttggaattcatgacaaaccagttgggttgctgaatgtggacggttact 600
SEQ ID NO:1 cttggtcacaacttggaattcatgacaaaccagttgggttgctgaatgtggacggttact 466
************************************************************
LOC_Os01g51210 atgatccgttgcttgcgctatttgataagggtgcggcagaaggatttattaaggccgatt 660
SEQ ID NO:1 atgatccgttgcttgcgctatttgataagggtgcggcagaaggatttattaaggccgatt 526
************************************************************
LOC_Os01g51210 gcagacaaataattgtttcggcaccgactgcgcatgagctgctgagaaagatggagcaat 720
SEQ ID NO:1 gcagacaaataattgtttcggcaccgactgcgcatgagctgctgagaaagatggagcaat 586
************************************************************
LOC_Os01g51210 acactcgttcacaccaggaggtagcgccacgtacaagctgggagatgtcagagcttggtt 780
SEQ ID NO:1 acactcgttcacaccaggaggtagcgccacgtacaagctgggagatgtcagagcttggtt 646
************************************************************
LOC_Os01g51210 atggaaagacaccagaggaatcgtagcataatctgctaatgtgacattgttcctgaagga 840
SEQ ID NO:1 atggaaagacaccagaggaatcgtag---------------------------------- 672
**************************
Claims 15, and 17-18 are rejected under 35 U.S.C. §103 as being unpatentable over Kurakawa (2007), in view of Wang-2020 (2020), and further in view of Pandit (Elssa Pandit et. al., Agronomy (2021) 11, 1263.pp1-20).
Claim 15 is drawn to a method for producing a rice plant comprising the steps of: a) providing a first rice plant and a second rice plant, the first rice plant having a mutation in an endogenous nucleic acid sequence encoding a polypeptide having a wild-type sequence of SEQ ID NO:2 that regulates grain weight and/or grain number per plant, wherein the first plant exhibits higher grain weight under nighttime or daytime temperature stress, wherein the second plant contains a phenotypic trait selected from disease resistance; high yield; mechanical harvestability; maturation; and grain number per plant; b) crossing the first rice plant with the second rice plant to produce one or more F1 progeny plants; c) collecting seed produced by the F1 progeny plants; and d) germinating the seed to produce rice plants exhibiting higher grain weight under nighttime or daytime temperature stress.
For the reasons set forth above with respect to claims 10-14, Kurakawa in view of Wang-2020 teaches and suggests a mutating rice LOG/LOGL family genes and evaluating resulting plants for improve grain-related traits.
Wang-2020 teaches increased grain yield under multiple abiotic field stress (e. g., drought and nutrient stress) (abstract). Wang-2020 further teaches the drought-stress experiment occurred under field weather variability, including temperature/humidity (page 385, paragraph 3), and the field evaluations included environmental variability including temperature and humidity (page 385, paragraph 3), and Wang-2020 reports improved yield performance under abiotic field stress conditions.
Pandit teaches conventional rice breeding practice of crossing a donor line with a recipient line to obtain F1 progeny, followed by collecting seed and germinating/growing plants from the seed in subsequent generations to combine a donor allele with other desired agronomic traits (page 2- 3, Materials and Methods; fig 1).
Claim 17 is drawn to the method of claim 15, further comprising the steps of collecting seed produced by the at least one progeny plant.
Claim 18 is drawn to the method of claim 17, further comprising the steps of growing a plant from the at least one progeny plant from the seed.
Therefore, Wang-2020 teaches that modification of a rice LOG/LOGL-family gene can improve grain-yield traits under multiple field conditions, including environmental variability involving temperature and humidity. Pandit teaches conventional rice breeding and introgression practices for combining donor alleles with desirable agronomic traits through crossing, seed collection, and germination of progeny plants.
Accordingly, a POSITA would have been motivated to cross a rice plant containing a LOG/LOGL-family mutation with a second rice plant having a desired agronomic trait, and to collect and germinate progeny seed for evaluation of grain-related traits under field conditions, as recited in claims 15 and 17-18.
The claimed invention in claims 15, and 17-18 as a whole is prima facie obvious over the combined teachings of the prior arts above.
Response to Applicant’s Remarks:
Applicant’s arguments have been considered but are not persuasive.
Argument 1: Kurakawa does not teach increased grain weight/grain number.
This argument is not persuasive. The rejection does not rely on Kurakawa alone for increased grain weight or grain number. Kurakawa is relied upon for teaching rice LOG/LOGL cytokinin-activation genes and their role in meristem/reproductive development. Wang-2020 is relied upon for teaching that modification of related rice LOG/LOGL-family gene, OsLOGL5, resulted in increased grain-yield traits, including grain number and thousand-deed weight. K
Argument 2: Wang-2020 is directed to OsLOGL5, not the claimed SEQ ID NO:2.
This argument is not persuasive. The rejection does not assert that OsLOGL5 is identical to SEQ ID NO: 2. Rather, Wang-2020 shows that a related LOG/LOGL-family cytokinin-activation gene was credible target for genome editing to improve grain traits. In view of Kurakawa’s teaching of rice LOG/LOGL-family genes, a POSITA would have been motivated to modify the claimed rice LOG/ LOGL-family genes using known genome-editing techniques with a reasonable expectation of improving grain-yield traits.
Argument 3: Multigene-family function is unpredictable.
This argument is not persuasive. The rejection does not rely on an assertion that all LOG/LOGL-family member necessarily have the same function or that every mutation would produce the claimed phenotype. The references provide a reason to pursue known rice mutagenesis/editing and phenotypic screening of LOG/LOGL-family genes. obviousness does not require certainty of success.
Argument 4: Gene redundancy/catalytic promiscuity could prevent phenotype.
This argument is not persuasive. Applicant’s general discussion of redundancy and catalytic promiscuity does not negate the specific teaching of Kurakawa and Wang-2020. Kurakawa identifies LOG/LOGL genes as biologically relevant cytokinin-activation genes, and Wang-2020 demonstrates that editing a LOG/LOGL-family gene affected grain-yield traits in rice. Thus, the cited art provides sufficient motivation to edit and screen related LOG/LOGL-family genes.
Argument 5: examiner provide no support for linking LOG mutation to grain traits.
This argument is not persuasive. Kurakawa teaches that LOG mutation affects panicle architecture and reproductive development, and Wang-2020 teaches increased grain-yield traits from manipulating OsLOGL5. These teachings support the conclusion that LOG/LOGL-family genes were credible targets for modifying grain-related traits.
Argument 6: Claims 15-18 are not obvious because temperature stress is not taught.
This argument is not persuasive. Wang-2020 teaches evaluating grain-yield conditions and expressly states that the imposed stress conditions depended on weather conditions, including temperature and humidity (p385, left column, paragraph 3). Wang further measured grain-related traits, including grain number, thousand-seed weigh, and grain yield, under those conditions. Therefore, Wang teaches evaluation of agronomic performance under temperature-related stress conditions. Combined with Pandit’s conventional crossing and progeny-generation methods, the claimed method would have been obvious to a POSITA.
Conclusion
No claims are allowed.
THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to YANXIN SHEN whose telephone number is (571)272-7538. The examiner can normally be reached Monday-Friday.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad A Abraham can be reached at (571)272-7058. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/YANXIN SHEN/Examiner, Art Unit 1663
/WEIHUA FAN/Primary Examiner, Art Unit 1663
Prosecution Insights