DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claim Status
Claims 1-18 are pending.
Claims 1-18 are examined on the merits.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1-3 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a judicial exception (i.e., a law of nature, a natural phenomenon, or an abstract idea) without significantly more.
The claims are directed to an isolated nucleic acid molecule which comprises the compositions of matter “has at least 95% sequence identity to SEQ ID NO:1 or a portion thereof”. Therefore, claim 1 is directed to compositions of matter which is one of the four categories under 35 U.S.C. 101. (Step 1: YES)
The claim is then analyzed to determine whether it is directed to any judicial exception.
Claim 1 is directed to an isolated nucleic acid molecule, wherein the nucleic acid molecule has at least 95% sequence identity to SEQ ID NO:1 or a portion thereof. As indicated in the Specification (paragraph 0044), nucleotide sequence SEQ ID NO: 1 is rice LOG1 which encode a polypeptide sequence SEQ ID NO:2. The specification does not expressly state whether SEQ ID NO:1 is a genomic DNA or a cDNA; however, in view of the accompanying encoded amino acid sequence disclosure, SEQ ID NO:1 is reasonably interpreted as a coding sequence (i. e., cDNA or exon-only coding region) under the broadest reasonable interpretation.
As interpreted under the broadest reasonable interpretation, the phase “or a portion thereof” encompasses an isolated DNA fragment corresponding to a subsequence of SEQ ID NO:1, including fragments that are identical to naturally occurring sequence present in the rice genome (e.g.. an exon region or other genomic segments). Such naturally occurring DNA fragments are products of nature.
Therefore, the claimed isolated nucleic acid molecule is directed to a natural phenomenon which is a judicial exception (Step 2A: YES).
The claim is then analyzed to determine whether the claim as a whole amount to significantly more than the exception. Claim 1 is drawn to the nucleic acid molecule per se (including naturally occurring fragments) and do not recite any additional limitations that integrated the product of nature into a practical application. Therefore, the claim as whole does not amount to significantly more than the judicial exception.
The dependent claims 2 and 3 are rejected for the same reasons as claim 1, because they are directed to an isolated nucleic acid molecule defined solely by sequence identity to SEQ ID NO:1 (or a portion thereof), which encompasses naturally occurring DNA fragments (a product of nature), and the claims do not recite additional elements that amount to significantly more than the judicial exception.
Therefore, the claimed invention in claims 1-3 are directed to a judicial exception and therefore not patent-eligible.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 6-9, 15, 17 and 18 rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 6 is rejected as indefinite for the recitation “A rice plant….. comprising a genomic mutation in an endogenous nucleic acid molecule having at least 95% sequence identity to SEQ ID NO:1 ….”, while SEQ ID NO: 1 is a cDNA sequence (see below from rice genomic search data). A cDNA is an in vitro-derived sequence corresponding to processed mRNA, and typically lacks introns and other genomic context, and thus does not clearly define an ”endogenous” genomic nucleic acid molecule in the rice genome. Accordingly, it is unclear what endogenous genomic locs is encompassed by “having at least 95% sequence identity to SEQ ID NO:1”, including whether the comparison is to an endogenous genomic sequence including introns; or an endogenous mRNA transcript. Because the claim uses SEQ ID NO:1 (cDNA) to define an “endogenous” nucleic acid molecule without specifying the corresponding genomic sequence, transcripts, or locus, the metes and bounds of the claimed “endogenous nucleic acid molecule” are not reasonably certain.
Dependent claims 7-9 are included in this rejection because they do not include additional limitations to resolve the ambiguity.
Claim 15 is rejected as indefinite for the recitation “….a desired phenotypic trait…”. The use of “a desired phenotypic trait” is subjective and lacks objective boundaries, the claim does not specify what trait is “desired”, nor any test or threshold for determining whether the second plant “contains” it, so the metes and bounds of the claim cannot be determined with reasonable certainty.
Dependent claims 17 and 18 are included in this rejection because they do not include additional limitations to resolve the ambiguity.
SEQ ID NO:1 alignment pulls out LOC_Os01g51210
PNG
media_image1.png
731
975
media_image1.png
Greyscale
PNG
media_image2.png
539
975
media_image2.png
Greyscale
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 1-3 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by US-20140325709-A1 (Gunnar Plesch et. al., Application filed 2011-09-22, Published 2014-10-30).
Claims 1-3 recites an isolated nucleic acid molecule, wherein the nucleic acid molecule has at least 95% (Claim 1); has at least 99% (claim 2) sequence identity to SEQ ID NO:1; is SEQ ID NO:1 (claim 3); or a portion thereof.
Under BRI, claims 1-3 encompasses (1) a nucleic acid having the recited percent identity to the full-length SEQ ID NO:1, or (2) a nucleic acid having the recited percent identity to any contiguous subsequence (fragment) of SEQ ID NO:1 (“a portion thereof”). Thus, “a portion thereof” includes any fragment of SEQ ID NO :1 of sufficient length to permit a meaningful sequence-identity comparison and includes fragments corresponding to conserved regions shared among homologs from different species.
Accordingly, US-20140325709-A1 discloses a nucleic acid fragment from SEQ ID NO: 68631 from Hordeum vulgare with 100% identity to corresponding fragment (“portion” is marked with red box) of SEQ ID NO: 1, as demonstrated by sequence alignment (below).
Accordingly, all limitations of claims 1-3 are disclosed by US-20140325709-A1, and claims 1-3 are anticipated.
PNG
media_image3.png
621
975
media_image3.png
Greyscale
Claims 1-3 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Kurakawa (Takashi Kurakawa et. al., NATURE (2007) Vol 445, pp652-655).
Claims 1-3 recite an isolated nucleic acid molecule, wherein the nucleic acid molecule has at least 95% (Claim 1)/ at least 99% (claim 2) sequence identity to SEQ ID NO:1; is SEQ ID NO:1 (claim 3); or a portion thereof.
Kurakawa discloses the rice LOG 1 nucleic acid sequence (LOC_Os01g51210) (supplementary fig 2). Sequence comparation shows that Kurakawa’s disclosed LOG1 nucleotide sequence contains a region that is 100% identical to applicant’s SEQ ID NO:1. Such that SEQ ID NO:1 is a portion of Kurakawa’s disclosed LOG1 nucleic acid.
Regarding claim1, which recites an isolated nucleic acid molecule having at least 95% sequence identity to SEQ ID NO:1 or a portion thereof. Kurakawa discloses a nucleic acid molecule comprising a portion that is 100% identical to SEQ ID NO:1, thereby satisfying the “at least 95% identity” limitation.
Regarding claim 2, which further requires at least 99% sequence identity, Kurakawa discloses a nucleic acid molecule comprising a portion that is 100% identical to SEQ ID NO:1, thereby satisfying the “at least 99% identity” limitation.
Regarding claim 3, which recites that the nucleic acid molecules is SEQ ID NO:1 or a portion thereof, Kurakawa’s disclosed LOG1 nucleic acid includes a portion that SEQ ID NO:1 (as shown by the 100% identity alignment), and therefore discloses the claimed nucleic acid.
Accordingly, Kurakawa discloses each and every limitation of claims 1-3.
CLUSTAL O(1.2.4) multiple sequence alignment
LOC_Os01g51210 gatcgcaactttccgagagaagataacacagcgcacagaaaagagaagctgccaaacccg 60
SEQ ID NO:1 ------------------------------------------------------------ 0
LOC_Os01g51210 gccacctcctcctctcctctcctcccccatcgccttccccaatccgtcggcgaggccaag 120
SEQ ID NO:1 ------------------------------------------------------------ 0
LOC_Os01g51210 gcaggcaggaagccatgggcgacaacagcgccgccgcggcggccgtggccgcgccgcgcg 180
SEQ ID NO:1 --------------atgggcgacaacagcgccgccgcggcggccgtggccgcgccgcgcg 46
**********************************************
LOC_Os01g51210 gcaggttcggcaggatctgcgtcttctgcggcagcaacgccggcaaccgcgcggtgttcg 240
SEQ ID NO:1 gcaggttcggcaggatctgcgtcttctgcggcagcaacgccggcaaccgcgcggtgttcg 106
************************************************************
LOC_Os01g51210 gcgacgcggcgctccagctcgggcaggagctggtgtcgagagggatcgagttggtctacg 300
SEQ ID NO:1 gcgacgcggcgctccagctcgggcaggagctggtgtcgagagggatcgagttggtctacg 166
************************************************************
LOC_Os01g51210 gtggcggcagcgtcgggttgatgggcttgatcgcgcagacggttcttgatggcggctgcg 360
SEQ ID NO:1 gtggcggcagcgtcgggttgatgggcttgatcgcgcagacggttcttgatggcggctgcg 226
************************************************************
LOC_Os01g51210 gtgttctcggggtgattccaaaagcactcatgcccaccgagatatcaggtgcaagtgttg 420
SEQ ID NO:1 gtgttctcggggtgattccaaaagcactcatgcccaccgagatatcaggtgcaagtgttg 286
************************************************************
LOC_Os01g51210 gagaagtgaaaattgtgtctgacatgcatgagaggaaagctgagatggcacgccaatccg 480
SEQ ID NO:1 gagaagtgaaaattgtgtctgacatgcatgagaggaaagctgagatggcacgccaatccg 346
************************************************************
LOC_Os01g51210 atgccttcatcgctcttcctggagggtatggaacaatggaggagttgttagagatgataa 540
SEQ ID NO:1 atgccttcatcgctcttcctggagggtatggaacaatggaggagttgttagagatgataa 406
************************************************************
LOC_Os01g51210 cttggtcacaacttggaattcatgacaaaccagttgggttgctgaatgtggacggttact 600
SEQ ID NO:1 cttggtcacaacttggaattcatgacaaaccagttgggttgctgaatgtggacggttact 466
************************************************************
LOC_Os01g51210 atgatccgttgcttgcgctatttgataagggtgcggcagaaggatttattaaggccgatt 660
SEQ ID NO:1 atgatccgttgcttgcgctatttgataagggtgcggcagaaggatttattaaggccgatt 526
************************************************************
LOC_Os01g51210 gcagacaaataattgtttcggcaccgactgcgcatgagctgctgagaaagatggagcaat 720
SEQ ID NO:1 gcagacaaataattgtttcggcaccgactgcgcatgagctgctgagaaagatggagcaat 586
************************************************************
LOC_Os01g51210 acactcgttcacaccaggaggtagcgccacgtacaagctgggagatgtcagagcttggtt 780
SEQ ID NO:1 acactcgttcacaccaggaggtagcgccacgtacaagctgggagatgtcagagcttggtt 646
************************************************************
LOC_Os01g51210 atggaaagacaccagaggaatcgtagcataatctgctaatgtgacattgttcctgaagga 840
SEQ ID NO:1 atggaaagacaccagaggaatcgtag---------------------------------- 672
**************************
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 4-14 are rejected under 35 U.S.C. §103 as being unpatentable over Kurakawa (2007) as applied claim 1, in view of Wang-2020 (Changgui Wang et. al., Plant Molecular Biology (2020) 102:373–388).
Claim 1 as the teaching of Kurakawa is discussed above.
Claim 4 is interpreted as depend of claim1.
Claim 4 is drawn to transgenic rice plant transformed with the nucleic acid molecule of claim 1; claim 5 is drawn to the transgenic rice plant of claim 4, wherein the nucleic acid molecule is operably linked to a promoter functional in rice plants.
Kurakawa teaches the LOG1 (LOC_Os01g51210) nucleic acid includes a portion that is SEQ ID NO:1.
Kurakawa does not teach a transgenic rice plant transformed with the nucleic acid molecule of claim 1.
Wang-2020 further teaches Agrobacterium-mediated method for transformation and regeneration (page 384, paragraph 2). Wang-2020 further teaches that transforming a rice cytokinin-activation enzyme-like gene (OsLOGL5) for overexpression in rice using the 35S promoter of the cauliflower mosaic virus (CaMV 35S) (page 375, paragraph 2).
Accordingly, a POSATA would have been motivated to introduce Kurakawa’s LOG1 (LOC_Os01g51210) nucleic acid using the transformation and promoter-driven expression approaches taught by Wang-2020 to obtain transgenic rice plant transformed with the nucleic acid molecule as recited in claim 4, and to operably link the nucleic acid to a promoter functional in rice as recited in claim 5, with a reasonable expectation of success.
The claimed invention in claims 4-5 as a whole is prima facie obvious over the combined teachings of the prior arts above.
Claims 6-9 are drawn to a rice plant, or part thereof, comprising a genomic mutation in an endogenous nucleic acid molecule having at least 95% sequence identity to SEQ ID NO:1 and encoding a polypeptide, wherein the genomic mutation confers reduced expression of the endogenous nucleic acid molecule (claim 6); wherein the nucleic acid molecule has at least 99% sequence identity to SEQ ID NO: 1 (claim 7); wherein the nucleic acid molecule is SEQ ID NO:1 (claim 8); wherein the genomic mutation comprises an insertion, a deletion or a substitution (claim 9).
Wang-2020 teaches using CRISPR-Cas9 genome editing technology to create OsLOGL5 knock-out mutations (Page 375 last paragraph, 378 first paragraph).
Wang-2020 further teaches “mutations such as insertion, deletion, or substitution of at least one nucleotide were produced, which resulted in the early termination of the coding sequence, translation frame-shift and/or deletion of at least one amino acid residues” (page378, last paragraph). A POSITA would have understood that a CRISPR/Cas9 indel that creates a premature termination codon reduces functional expression of the endogenous gene by eliminating full-length protein production (and commonly reducing steady-state transcript via nonsense-mediated decay), thus meeting the limitation that the genomic mutation confers reduced expression of the endogenous nucleic acid molecule.
Claim 10 is drawn to a method of making a mutant rice plant, comprising the steps of: a) inducing mutagenesis in rice cells; b) obtaining one or more plants from the cells; and c) identifying at least one of the plants that contains a mutation in a gene having a wild-type sequence as set forth in SEQ ID NO:1 and encoding a polypeptide that regulates grain weight and/or grain number per plant, wherein the at least one of the plants that contains the mutation exhibits increased grain weight and/or grain number per plant.
Kurakawa teaches that mutation of the rice LOG cytokinin-activating enzyme cause a severe reduction in panicle size with abnormal branching patterns and defective floral organ development (page 652, and fig 1), phenotypes that would be expected to related to spikelet/grain production, thereby linking LOG/LOG-like genes to grain/yield-related traits via panicle architecture and fertility.
Kurakawa teaches that rice contains a family of cytokinin-activating enzyme (LOG/LOGL) genes, “There are 10 genes that have high sequence similarity to LOG in the rice genome” which includes both LOG1 (LOC_Os01g51210) and OsLOGL5 (LOC_Os03g64070) (page 653, paragraph 2). Kurakawa further teaches LOG1 (LOC_Os01g51210) shows high expression in immature inflorescence, and shows low expression in shoot apex (Supplementary fig 3, also paste below). The expression profile indicates the gene is expressed in a reproductive tissue relevant to yield components. The size, structure, and developmental timing of the shoot apex (specifically transitioning into the inflorescence meristem) are directly responsible for determining inflorescence architecture, which in turn dictates grain number, size, and overall yield in cereal crops. Small differences in meristem activity during these early stages have massive impacts on final grain output Wang-2021(Chengyu Wang et. al., International Journal of Molecular Science (2021) 22, 3508pp1-21) (abstract and introduction).
Wang-2020 teaches that CRISPR-edited variants at the 3’end of the OsLOGL5 (LOC_Os03g64070) coding sequence resulted in normal plant morphology but increased grain yield under well-watered, drought, normal nitrogen, and low nitrogen field conditions, including test across multiple locations (page 373, abstract). Wang-2020 further teaches that OsLOGL5-edited plants significantly increased yield components including seed-setting rate, total grain number, full-filled grain number per panicle, and thousand-seed weight (e.g., under drought) (abstract), supporting OsLOGL5 involvement in seed development and grain filling.
Wang-2020 also teaches that the nucleotide sequences of LOG genes are very conserved and knowing the function of the 3′-end non-conserved region, whereas certain CRISPR edits (especially near the C-terminal/3’end) produced plants with increased grain yield under multiple field conditions (page 378 and 379).
Claims 11-14 are drawn to the method of claim 10, wherein the rice cells are in a seed (claim 11); further comprising the steps of d) crossing the at least one of the plants that contains the mutation with a second rice plant; and e) selecting progeny of the cross that have the at least one mutation, wherein the progeny plant is homozygous for the at least one mutation (claim 12); further comprising the steps of collecting seed produced by the at least one progeny rice plant (claim 13); further comprising the step of growing a rice plant from the at least one progeny plant from the seed (claim 14).
Wang-2020 teaches producing genome-edited rice lines and advancing them through T0/T1/T2 generations with genotyping-based selection (page 378) to obtain stable (including homozygous) progeny, which inherently involves collecting seeds for progeny plants and growing plants from that seed in subsequent generations for evaluation (page 384, Materials and methods).
In view of Kurakawa’s teaching that LOG1 (LOC_Os01g51210) is the endogenous rice cytokinin-activation enzyme locus, and wang-2020’s teaching that genomic mutations (an insertion, a deletion or a substitution) can be introduced into endogenous cytokinin-activation enzyme-like genes to reduce expression in rice. A POSITA would have been motivated to apply Wang-2020’s genomic mutation approaches to the endogenous LOG nucleic acid molecule taught by Kurakawa to obtain rice plant (part thereof) comprising a genomic mutation that confers reduced expression of the endogenous nucleic acid molecules.
A person of ordinary skill in the art would have been motivated to induce mutagenesis in rice cell, regenerate plants, and screen for mutants in the gene having the wild-type sequence of SEQ ID NO:1 (a LOG/LOGL family member), in view of the bombinated teachings of Kurakwa and Wang-2020,. Kurakawa teaches that rice LOG family genes encode cytokinin-activating enzymes and that mutation of a LOG family member alters inflorescence/meristem development (including panicle architecture and reproductive development), thereby identifying LOG/LOGL family genes as biologically important endogenous targets in rice whose modification predictably affects traits tied to grain production. Wang-2020 teaches that modifying a rice cytokinin-activation enzyme-like gene (OsLOGL5) by genome editing can increase grain yield and yield components under field conditions, demonstrating that LOG/LOGL family genes are credible targets for improving grain traits and providing a reasonable expectation of success that mutagenizing and screening LOG/LOGL family members would identify beneficial alleles. Accordingly, a POSITA would have reasonably expected that applying routine mutagenesis and selection steps, including (a) inducing mutagenesis, (b) obtaining plants from the treated cells, and (c) identifying plants with a mutation in the SEQ ID NO:1 LOG/LOGL gene, would yield at least one mutant plant exhibiting increased grain weight and/or grain number per plant.
The claimed invention in claims 6-14 as a whole is prima facie obvious over the combined teachings of the prior arts above.
Claims 15-18 are rejected under 35 U.S.C. §103 as being unpatentable over Kurakawa (2007), in view of Wang-2020 (2020), and further in view of Pandit (Elssa Pandit et. al., Agronomy (2021) 11, 1263.pp1-20).
Claim 15 is drawn to a method for producing a rice plant, comprising the steps of :a) providing a first rice plant and a second rice plant, the first rice plant having a mutation in an endogenous nucleic acid sequence having a wild-type sequence as set forth in SEQ ID NO:1 and encoding a polypeptide that regulates grain weight and/or grain number per plant, wherein the first plant exhibits higher grain weight under nighttime or daytime temperature stress, wherein the second plant contains a desired phenotypic trait; b) crossing the first rice plant with the second rice plant to produce one or more F 1 progeny plants; c) collecting seed produced by the F 1 progeny plants; and d) germinating the seed to produce rice plants exhibiting higher grain weight under nighttime or daytime temperature stress.
For the reasons set forth above with respect to claims 10-14, Kurakawa in view of Wang-2020 teaches and suggests a first rice plant having a mutation in a LOG/LOGL family gene (SEQ ID NO:1) associated with improved grain traits.
Wang-2020 teaches increased grain yield under multiple abiotic field stress (e. g., drought and nutrient stress) (abstract). Wang-2020 further teaches the drought-stress experiment occurred under field weather variability, including temperature/humidity (page 385, paragraph 3), and the yield improvement was observed under abiotic stress conditions occurring in the field, where temperature is a relevant environment factor (page 388, paragraph 1).
Pandit teaches conventional rice breeding practice of crossing a donor line with a recipient line to obtain F1 progeny, followed by collecting seed and germinating/growing plants from the seed in subsequent generations to combine a donor allele with other desired agronomic traits (page 2- 3, Materials and Methods; fig 1).
Claim 16 is drawn to the method of claim 15, wherein the desired phenotypic trait is selected from the group consisting of disease resistance; high yield; mechanical harvestability; maturation; and grain number per plant.
Pandit teaches the list of desired phenotypic traits such as: diseases resistance (page 2, paragraph 1), high yield (page 2, paragraph 1), plant height (mechanical harvestability ) (page 14, table 4), days to 50% flowering (maturation) (page 5, paragraph 1), grain number (page 4, table 1).
Claim 17 is drawn to the method of claim 15, further comprising the steps of collecting seed produced by the at least one progeny plant.
Claim 18 is drawn to the method of claim 17, further comprising the steps of growing a plant from the at least one progeny plant from the seed.
Therefore, Wang-2020’s field drought-stress results (performed under weather conditions including temperature and humidity) support that LOG/LOGL modification can improve grain yield in abiotic-stress field environments, motivating evaluation/introgression of such mutations for improved grain traits in rice grown under temperature-stress conditions.
A POSITA would have been motivated to provide a first rice plant having a mutation in the SEQ ID NO:1 LOG/LOGL-family gene and improved grain trait performance, cross it with a second rice plant having a desired phenotypic trait, and then collect and germinate seed to obtain progeny rice plants exhibiting higher grain weight under temperatures stress, as recited in claims 15-18, with reasonable expectation of success.
The claimed invention in claims 15-18 as a whole is prima facie obvious over the combined teachings of the prior arts above.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to YANXIN SHEN whose telephone number is (571)272-7538. The examiner can normally be reached Monday-Friday.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad A Abraham can be reached at (571)272-7058. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/YANXIN SHEN/ Examiner, Art Unit 1663
/WEIHUA FAN/ Primary Examiner, Art Unit 1663