DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
The Office acknowledges the receipt of Applicant's election without traverse of Group I, claims 1-4, 6 and 8-10 and the corresponding sequences of SEQ ID NO: 26 and Motif No. 2 (SEQ ID NO: 134), along with Type II cross-talk blocking element, in the reply filed on June 18, 2026 is acknowledged.
Claim status
Claims 1-11, are pending. Claims 5, 7 and 11, are withdrawn. Claims 1-4, 6 and 8-10, are examined in the instant application.
Priority
This application is claiming the benefit of Provisional Application No.
63268625 filed February 28, 2022.
Information Disclosure Statement
Initialed and dated copy of Applicant’s information disclosure statement (IDS) filed on March 28, 2025 is attached to the instant Office Action. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Drawings
The drawings are objected to because:
Figures 8-10, the y axis is missing a label as to what is being measured.
Figure 9 Sample No. 5 from the right is missing a sequence identifier. It looks like SEQ ID NO: 38 is missing.
Figure 11, the labels on the motifs are missing and difficult to read.
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Specification
The disclosure is objected to because of the following:
In page 39, Ex. 3, lines 12-13, the recitation of “5-IV-7” is incorrect. According to the specification this DNA fragment was selected in the patent US 7,655,786 B2. However, “5-IV-7” is not found in US 7,655,786 B2 and seems to be an error. Does Applicant mean to say “5-IV-1”? The same issue applies to Ex. 10 line 27, tables 9, 11 and 26.
In page 38 line 28, the recitation of “Cytation5” is missing a space before “5”. Additionally, Cytation is a trademark and missing a trademark symbol.
In page 38 lines 28 and 31, the recitation of “BioTek” is a registered trademark and is missing the symbol. The same thing applies to the recitation “Gen5”. See also pg. 51 Ex. 8.
Applicant is reminded of the proper content of an abstract of the disclosure.
A patent abstract is a concise statement of the technical disclosure of the patent and should include that which is new in the art to which the invention pertains. The abstract should not refer to purported merits or speculative applications of the invention and should not compare the invention with the prior art.
If the patent is of a basic nature, the entire technical disclosure may be new in the art, and the abstract should be directed to the entire disclosure. If the patent is in the nature of an improvement in an old apparatus, process, product, or composition, the abstract should include the technical disclosure of the improvement. The abstract should also mention by way of example any preferred modifications or alternatives.
Where applicable, the abstract should include the following: (1) if a machine or apparatus, its organization and operation; (2) if an article, its method of making; (3) if a chemical compound, its identity and use; (4) if a mixture, its ingredients; (5) if a process, the steps.
Extensive mechanical and design details of an apparatus should not be included in the abstract. The abstract should be in narrative form and generally limited to a single paragraph within the range of 50 to 150 words in length.
See MPEP § 608.01(b) for guidelines for the preparation of patent abstracts.
This application does not contain an abstract of the disclosure as required by 37 CFR 1.72(b).
Applicant’s Abstract is the cover of the WIPO document. An abstract on a separate sheet is required.
Claim Rejections - 35 USC § 112(Improper Markush Group)
Claims 1-4, 6 and 8-10, are rejected on the basis that it contains an improper Markush grouping of alternatives. See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). A Markush grouping is proper if the alternatives defined by the Markush group (i.e., alternatives from which a selection is to be made in the context of a combination or process, or alternative chemical compounds as a whole) share a “single structural similarity” and a common use. A Markush grouping meets these requirements in two situations. First, a Markush grouping is proper if the alternatives are all members of the same recognized physical or chemical class or the same art-recognized class, and are disclosed in the specification or known in the art to be functionally equivalent and have a common use. Second, where a Markush grouping describes alternative chemical compounds, whether by words or chemical formulas, and the alternatives do not belong to a recognized class as set forth above, the members of the Markush grouping may be considered to share a “single structural similarity” and common use where the alternatives share both a substantial structural feature and a common use that flows from the substantial structural feature. See MPEP § 2117.
The claims recite many SEQ ID NOs that do not share any primary structural identity. In the absence of structural similarity, structure/function cannot be shared. For example, Table 26 on pages 75-96, Applicant list different species of genes not sharing structure-function relationship such as SEQ ID NO: 26 (ZM-T2S2C5 CTB) and SEQ ID NO:236 (Intergenic region from Brachypodium distachyon) which lack substantial structural similarity. Additionally, the amino acids on Table 13 are structurally and functionally different that the nucleic acids listed on Table 26. Type II CTB’s encompasses ad infinitum species of CTB’s that are structurally and functionally different than the sequences listed in Tables 13 and 26. As such, the Markush groups recited in the claims are improper.
To overcome this rejection, Applicant may set forth each alternative (or grouping of patentably indistinct alternatives) within an improper Markush grouping in a series of independent or dependent claims and/or present convincing arguments that the group members recited in the alternative within a single claim in fact share a single structural similarity as well as a common use.
Claim Rejections - 35 USC § 112 (Indefinite)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 2 and 3 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
In regard to claim 2, the recitation of Table 13 is not permitted. See MPEP 2173.05(s), which states:
“Where possible, claims are to be complete in themselves. Incorporation by reference to a specific figure or table “is permitted only in exceptional circumstances where there is no practical way to define the invention in words and where it is more concise to incorporate by reference than duplicating a drawing or table into the claim. Incorporation be reference is a necessity doctrine, not for applicant’s convenience.” Ex parte Fressola, 27 USPQ2d 1608, 1609 (Bd. Pat. App. & Inter. 1993) (citations omitted).”
There is no evidence that the information from Table 13 cannot be reproduced in claim 2. It is suggested the recitation of “described in Table 13” be deleted.
In regard to claim 3, the recitation of “Type I or Type II” is unclear. The specification defines these terms solely by their function “enhancer blocking” or “silence barrier” rather than by their structure, while also inconsistently referring them as “Type I or Type II insulators.” Do Type I/II CTB and Type I/II insulators comprises the same function and structure?
Claim Rejections - 35 USC § 112(a)(Written Description)
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-4, 6 and 8-10, are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Applicant’s disclosure is as follows.
Applicant described that “more than 800 putative insulator elements were identified by computational search and 40 CTBs or CTB pairs are being tested in the protoplast system for validation” (pg. 56, lines 9-11, and Figs 9-10). The specification describes example 7 as testing cross-talk blocker (CTB) sequences in maize to identify which element act as effective silence barriers by preventing the “down-regulation of one or both genes in a gene stack vector configuration consisting of two tandemly oriented expression cassettes” (pg. 45 lines 7-16). SEQ ID NO: 26 is described to have an expression 60-70% of the single gene control (Table 5), showing negative effects of reduction in expression compared to the control .
The claim encompasses a recombinant polynucleotide constructs with a polynucleotide sharing at least 80% identity with at least 100 contiguous nucleotides to SEQ ID NO: 26, SEQ ID NO: 134, or any Type II cross-talk blocking element.
The claimed invention lacks adequate written description for the following reasons. Claims 1-4, 6 and 8-10, are directed to a recombinant polynucleotide construct comprising at least two cassettes, wherein each cassette comprises a promoter operably linked to a heterologous gene; and at least one cross-talk blocking element; wherein the cross-talk blocking element comprises a polynucleotide sharing at least 80% identity with at least 100 contiguous nucleotides of SEQ ID NO: 26, SEQ ID NO: 134, or any Type II cross blocking element, wherein the function is not taught.
The Applicant does not describe (1) a polynucleotide having at least 80% sequence identity with at least 100 contiguous nucleotides of SEQ ID NO: 26; (2) if motif 2 (SEQ ID NO: 134) listed in Table 13 confers activity; (3) the Type II cross-talk blocking element as broadly claimed.
(1) The Applicant does not describe a polynucleotide having at least 80% sequence identity with at least 100 contiguous nucleotides of SEQ ID NO: 26. The Applicant has only described SEQ ID NO: 26 having around a 0.3. enhancer blocking capability (Fig. 10). Along with testing if the CTB sequence could prevent mutual down-regulation that occurs when two gene cassettes are place next to each other in a single vector, which described an expression of 60-70% of the single gene control (Table 5), showing negative effects of reduction in expression compared to the control.
Furthermore, Applicant has not adequately described what 100 contiguous nucleotides would result in a functional recombinant construct.
Moreover, while one skilled in the art can generate a population of sequences having at least 80% identity to SEQ ID NO: 26. This requires the specification to describe said nucleic acid sequences.
However, the specification does not describe a nucleic acid sequence having at least 80% identity to SEQ ID NO: 26, let alone one that is 100 contiguous nucleotides, which leads to a functional recombinant construct.
A nucleic acid sequence having at least 80% identity to SEQ ID NO: 26 would have 24 nucleic acid substitutions relative to SEQ ID NO: 26.
These polynucleotide would encompass 324 distinct gene variants. In the absence of describing where in the sequence of SEQ ID NO:26 such variations can be sustained, one of skill in the art would not be led to believe that Applicant possesses this vast genus of claimed polynucleotides of SEQ ID NO: 26, and lead to producing a functional construct let alone a polynucleotide sequence having at least 80% sequence identity to 100 contiguous nucleotides of SEQ ID NO: 26.
For example, a Blast search on SEQ ID NO: 26 produces ZERO results—or, as shown in the sequence alignment below, provides only two hits. How is one skilled in the art supposed to identify sequences or conduct alignments to determine which species in the claimed genus of sequences will retain CTB function.
PNG
media_image1.png
502
544
media_image1.png
Greyscale
GenCore version 6.5.3
Copyright (c) 1993 - 2026 Biocceleration Ltd.
OM nucleic - nucleic search, using oligo model
Run on: June 30, 2026, 19:09:39 ; Search time 84 Seconds
(without alignments)
32269.661 Million cell updates/sec
Title: US-18-841-562-26
Perfect score: 118
Sequence: 1 ccacgagagagatgtttgga..........gaaaaatatcctttgcgaat 118
Scoring table: OLIGO_NUC
Gapop 0.0 , Gapext 0.0
Searched: 30490237 unique seqs, 11485811532 residues
Word size : 100
Total number of hits satisfying chosen parameters: 2
Minimum DB seq length: 1
Maximum DB seq length: 40000
Post-processing: Listing first 500 summaries
Database : N_Geneseq_202608:*
SUMMARIES
%
Result Query Filing
No. Score Match Length ID Date Dups Description
-------------------------------------------------------------------------------------------------------------
1 118 100.0 118 BNR06335 -- 0 Zea mays ZM-T2S2C5 CTB DNA, SEQ 26.
2 118 100.0 20881 BNR06471 -- 0 PHP101207 DNA, SEQ 162.
ALIGNMENTS
RESULT 1
BNR06335
ID BNR06335 standard; DNA; 118 BP.
XX
AC BNR06335;
XX
DT 26-OCT-2023 (first entry)
XX
DE Zea mays ZM-T2S2C5 CTB DNA, SEQ 26.
XX
KW ds; gene regulation; plant; transgenic plant.
XX
OS Zea mays.
XX
CC PN WO2023164563-A2.
XX
CC PD 31-AUG-2023.
XX
CC PF 23-FEB-2023; 2023WO-US063146.
XX
PR 28-FEB-2022; 2022US-0268625P.
XX
CC PA (DUPO ) PIONEER HI-BRED INT INC.
XX
CC PI Abbitt SE, Anand A, Bhyri P, Chilcoat ND, Deschamps S, Diehn S;
CC PI Frerichs J, Gordon-Kamm WJ, Jia Y, Kumar S, May GD, Mohanty A;
CC PI Nott A, Sardesai N, Sims LE, Wu XE;
XX
DR WPI; 2023-936626/074.
XX
CC PT New recombinant polynucleotide construct useful e.g. for modulating
CC PT expression of transgene in plant cell, comprises cassettes comprising
CC PT promoter operably linked to heterologous gene and cross-talk blocking
CC PT element.
XX
CC PS Claim 1; SEQ ID NO 26; 116pp; English.
XX
CC The present invention relates to a novel recombinant polynucleotide
CC construct useful for modulating the expression of a transgene in a plant
CC cell. The recombinant polynucleotide construct comprises cassettes
CC comprising promoter operably linked to heterologous gene and cross-talk
CC blocking element. The cross-talk blocking element comprises a
CC polynucleotide which corresponds to (see BNR06310-BNR06576). The
CC invention further relates to: (1) a plant cell comprising the recombinant
CC polynucleotide construct; (2) a transgenic plant comprising the
CC recombinant polynucleotide construct in at least one cell; and (3) a
CC method for modulating the expression of at least one transgene in a plant
CC cell. The invention also relates to compositions and methods are provided
CC for the improved expression and regulation of transgenes in plants,
CC including a method of identifying gene expression gene cross-talk
CC blocking and modulating elements, as well as the compositions of said
CC elements.
XX
SQ Sequence 118 BP; 37 A; 17 C; 33 G; 31 T; 0 U; 0 Other;
Query Match 100.0%; Score 118; Length 118;
Best Local Similarity 100.0%;
Matches 118; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CCACGAGAGAGATGTTTGGATAAGGTCCATTAGAAATTTACGTGGGCCTGGAATAGGGCT 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 CCACGAGAGAGATGTTTGGATAAGGTCCATTAGAAATTTACGTGGGCCTGGAATAGGGCT 60
Qy 61 TACATAAACATTGGGCTGATCGAGAGTGCAGATGTTGAGAAAAATATCCTTTGCGAAT 118
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 61 TACATAAACATTGGGCTGATCGAGAGTGCAGATGTTGAGAAAAATATCCTTTGCGAAT 118
RESULT 2
BNR06471
ID BNR06471 standard; DNA; 20881 BP.
XX
AC BNR06471;
XX
DT 26-OCT-2023 (first entry)
XX
DE PHP101207 DNA, SEQ 162.
XX
KW NOS gene; UBI1 gene; ds; gene regulation; plant; plasmid;
KW transgenic plant; vector.
XX
OS Zea mays.
OS Arabidopsis thaliana.
OS Escherichia phage P1.
OS Oryza sativa.
OS Sorghum bicolor.
OS Solanum tuberosum.
OS Synthetic.
XX
CC PN WO2023164563-A2.
XX
CC PD 31-AUG-2023.
XX
CC PF 23-FEB-2023; 2023WO-US063146.
XX
PR 28-FEB-2022; 2022US-0268625P.
XX
CC PA (DUPO ) PIONEER HI-BRED INT INC.
XX
CC PI Abbitt SE, Anand A, Bhyri P, Chilcoat ND, Deschamps S, Diehn S;
CC PI Frerichs J, Gordon-Kamm WJ, Jia Y, Kumar S, May GD, Mohanty A;
CC PI Nott A, Sardesai N, Sims LE, Wu XE;
XX
DR WPI; 2023-936626/074.
XX
CC PT New recombinant polynucleotide construct useful e.g. for modulating
CC PT expression of transgene in plant cell, comprises cassettes comprising
CC PT promoter operably linked to heterologous gene and cross-talk blocking
CC PT element.
XX
CC PS Claim 1; SEQ ID NO 162; 116pp; English.
XX
CC The present invention relates to a novel recombinant polynucleotide
CC construct useful for modulating the expression of a transgene in a plant
CC cell. The recombinant polynucleotide construct comprises cassettes
CC comprising promoter operably linked to heterologous gene and cross-talk
CC blocking element. The cross-talk blocking element comprises a
CC polynucleotide which corresponds to (see BNR06310-BNR06576). The
CC invention further relates to: (1) a plant cell comprising the recombinant
CC polynucleotide construct; (2) a transgenic plant comprising the
CC recombinant polynucleotide construct in at least one cell; and (3) a
CC method for modulating the expression of at least one transgene in a plant
CC cell. The invention also relates to compositions and methods are provided
CC for the improved expression and regulation of transgenes in plants,
CC including a method of identifying gene expression gene cross-talk
CC blocking and modulating elements, as well as the compositions of said
CC elements. The DNA comprises a RB, LOXP, NOS promoter, ZM-WUS2, IN2
CC terminator, FMV enhancer, PCSV ENH, MMV ENH, UBI1ZM PRO, UBI1ZM 5' UTR,
CC UBI1ZM intron T :ZMODP2, OS-T28 terminator, ZM-T2S2C5 CTB, ZM-HSP17.7
CC PRO, MO-CRE exon 1, ST-LS1 intron 2, MO-CRE exon 2, PINII terminator,
CC LOXP, SB-UBI PRO, SB-UBI intron 1, ZSGREEN1, OS-UBI terminator, SB-ALS
CC PRO, ZM-ALS, SB-UBI terminator and LB.
XX
SQ Sequence 20881 BP; 4934 A; 5333 C; 5172 G; 5442 T; 0 U; 0 Other;
Query Match 100.0%; Score 118; Length 20881;
Best Local Similarity 100.0%;
Matches 118; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CCACGAGAGAGATGTTTGGATAAGGTCCATTAGAAATTTACGTGGGCCTGGAATAGGGCT 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 8979 CCACGAGAGAGATGTTTGGATAAGGTCCATTAGAAATTTACGTGGGCCTGGAATAGGGCT 9038
Qy 61 TACATAAACATTGGGCTGATCGAGAGTGCAGATGTTGAGAAAAATATCCTTTGCGAAT 118
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 9039 TACATAAACATTGGGCTGATCGAGAGTGCAGATGTTGAGAAAAATATCCTTTGCGAAT 9096
Search completed: June 30, 2026, 19:11:03
Job time : 84 secs
(2) In regard to claim 2, the Applicant has not described motif 2 (SEQ ID NO: 134) listed in Table 13. Besides disclosing the amino acid sequence, the Applicant has not adequately described the function of said motif or if said motif produces a functional construct. The Applicant does not describe a representative number of species producing a functional construct, let alone with multiple motifs. The specification does not describe which motifs are required to produce said construct or where in the construct these motifs are needed to be placed to produce said construct.
(3) The Applicant has not adequately described the Type II cross-talk blocking element. The Applicant does not adequately describe the function of type 2 CTB’s or the structure. One skilled in the art cannot adequately produce a functional construct without the structure or the function to identify these type 2 CTB’s. Therefore, one of skill in the art would not be led to believe that Applicant possesses this vast genus of type 2 CTB’s.
Accordingly, there is lack of adequate description to inform a skilled artisan that Applicant was in possession of the claimed invention at the time of filing. See Written Description guidelines published in Federal Register/ Vol.66, No. 4/ Friday, January 5, 2001/ Notices; p. 1099-1111.
Claim Rejections - 35 USC § 112 (Enablement)
Claims 1-4, 6 and 8-10, are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention.
Enablement factors to consider include:
(A) The breadth of the claims;
(B) The nature of the invention;
(C) The state of the prior art;
(D) The level of one of ordinary skill;
(E) The level of predictability in the art;
(F) The amount of direction provided by the inventor;
(G) The existence of working examples; and
(H) The quantity of experimentation needed to make or use the invention based on the content of the disclosure. In re Wands, 858 F.2d 731,737, 8 USPQ2d 1400, 1404 (Fed. Cir. 1988).
Applicant’s disclosure is as set forth above. The claimed invention is not enabled for the following reasons.
(A) The breadth of the claims;
The breadth of the claims encompasses a recombinant polynucleotide constructs with a polynucleotide sharing at least 80% identity with at least 100 contiguous nucleotides to SEQ ID NO: 26, SEQ ID NO: 134, or any Type II cross-talk blocking element resulting in a functional construct.
(B) The nature of the invention;
The nature of the claimed invention is a recombinant polynucleotide construct that comprises at least two expression cassettes that utilizes a CTB resulting in improved heterologous gene expression.
(C) The state of the prior art;
The state of the prior art teaches generally on CTB’s and having multiple roles. However, the state of the prior art does not teach on SEQ ID NO:26, or a sequence having at least 80% sequence identity to 100 contiguous nucleotides to SEQ ID NO: 26 resulting in a functional construct. The state of the prior art does not teach a function for SEQ ID NO:26. The state of the prior art does not teach on SEQ ID NO: 134 or on the structures of Type II CTB’s resulting in a functional construct.
For example, a Blast search on SEQ ID NO: 26 produces ZERO results—or, as shown in the sequence alignment below, provides only two hits. How is one skilled in the art supposed to identify sequences or conduct alignments to determine which species in the claimed genus of sequences will function.
PNG
media_image1.png
502
544
media_image1.png
Greyscale
GenCore version 6.5.3
Copyright (c) 1993 - 2026 Biocceleration Ltd.
OM nucleic - nucleic search, using oligo model
Run on: June 30, 2026, 19:09:39 ; Search time 84 Seconds
(without alignments)
32269.661 Million cell updates/sec
Title: US-18-841-562-26
Perfect score: 118
Sequence: 1 ccacgagagagatgtttgga..........gaaaaatatcctttgcgaat 118
Scoring table: OLIGO_NUC
Gapop 0.0 , Gapext 0.0
Searched: 30490237 unique seqs, 11485811532 residues
Word size : 100
Total number of hits satisfying chosen parameters: 2
Minimum DB seq length: 1
Maximum DB seq length: 40000
Post-processing: Listing first 500 summaries
Database : N_Geneseq_202608:*
SUMMARIES
%
Result Query Filing
No. Score Match Length ID Date Dups Description
-------------------------------------------------------------------------------------------------------------
1 118 100.0 118 BNR06335 -- 0 Zea mays ZM-T2S2C5 CTB DNA, SEQ 26.
2 118 100.0 20881 BNR06471 -- 0 PHP101207 DNA, SEQ 162.
ALIGNMENTS
RESULT 1
BNR06335
ID BNR06335 standard; DNA; 118 BP.
XX
AC BNR06335;
XX
DT 26-OCT-2023 (first entry)
XX
DE Zea mays ZM-T2S2C5 CTB DNA, SEQ 26.
XX
KW ds; gene regulation; plant; transgenic plant.
XX
OS Zea mays.
XX
CC PN WO2023164563-A2.
XX
CC PD 31-AUG-2023.
XX
CC PF 23-FEB-2023; 2023WO-US063146.
XX
PR 28-FEB-2022; 2022US-0268625P.
XX
CC PA (DUPO ) PIONEER HI-BRED INT INC.
XX
CC PI Abbitt SE, Anand A, Bhyri P, Chilcoat ND, Deschamps S, Diehn S;
CC PI Frerichs J, Gordon-Kamm WJ, Jia Y, Kumar S, May GD, Mohanty A;
CC PI Nott A, Sardesai N, Sims LE, Wu XE;
XX
DR WPI; 2023-936626/074.
XX
CC PT New recombinant polynucleotide construct useful e.g. for modulating
CC PT expression of transgene in plant cell, comprises cassettes comprising
CC PT promoter operably linked to heterologous gene and cross-talk blocking
CC PT element.
XX
CC PS Claim 1; SEQ ID NO 26; 116pp; English.
XX
CC The present invention relates to a novel recombinant polynucleotide
CC construct useful for modulating the expression of a transgene in a plant
CC cell. The recombinant polynucleotide construct comprises cassettes
CC comprising promoter operably linked to heterologous gene and cross-talk
CC blocking element. The cross-talk blocking element comprises a
CC polynucleotide which corresponds to (see BNR06310-BNR06576). The
CC invention further relates to: (1) a plant cell comprising the recombinant
CC polynucleotide construct; (2) a transgenic plant comprising the
CC recombinant polynucleotide construct in at least one cell; and (3) a
CC method for modulating the expression of at least one transgene in a plant
CC cell. The invention also relates to compositions and methods are provided
CC for the improved expression and regulation of transgenes in plants,
CC including a method of identifying gene expression gene cross-talk
CC blocking and modulating elements, as well as the compositions of said
CC elements.
XX
SQ Sequence 118 BP; 37 A; 17 C; 33 G; 31 T; 0 U; 0 Other;
Query Match 100.0%; Score 118; Length 118;
Best Local Similarity 100.0%;
Matches 118; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CCACGAGAGAGATGTTTGGATAAGGTCCATTAGAAATTTACGTGGGCCTGGAATAGGGCT 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 CCACGAGAGAGATGTTTGGATAAGGTCCATTAGAAATTTACGTGGGCCTGGAATAGGGCT 60
Qy 61 TACATAAACATTGGGCTGATCGAGAGTGCAGATGTTGAGAAAAATATCCTTTGCGAAT 118
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 61 TACATAAACATTGGGCTGATCGAGAGTGCAGATGTTGAGAAAAATATCCTTTGCGAAT 118
RESULT 2
BNR06471
ID BNR06471 standard; DNA; 20881 BP.
XX
AC BNR06471;
XX
DT 26-OCT-2023 (first entry)
XX
DE PHP101207 DNA, SEQ 162.
XX
KW NOS gene; UBI1 gene; ds; gene regulation; plant; plasmid;
KW transgenic plant; vector.
XX
OS Zea mays.
OS Arabidopsis thaliana.
OS Escherichia phage P1.
OS Oryza sativa.
OS Sorghum bicolor.
OS Solanum tuberosum.
OS Synthetic.
XX
CC PN WO2023164563-A2.
XX
CC PD 31-AUG-2023.
XX
CC PF 23-FEB-2023; 2023WO-US063146.
XX
PR 28-FEB-2022; 2022US-0268625P.
XX
CC PA (DUPO ) PIONEER HI-BRED INT INC.
XX
CC PI Abbitt SE, Anand A, Bhyri P, Chilcoat ND, Deschamps S, Diehn S;
CC PI Frerichs J, Gordon-Kamm WJ, Jia Y, Kumar S, May GD, Mohanty A;
CC PI Nott A, Sardesai N, Sims LE, Wu XE;
XX
DR WPI; 2023-936626/074.
XX
CC PT New recombinant polynucleotide construct useful e.g. for modulating
CC PT expression of transgene in plant cell, comprises cassettes comprising
CC PT promoter operably linked to heterologous gene and cross-talk blocking
CC PT element.
XX
CC PS Claim 1; SEQ ID NO 162; 116pp; English.
XX
CC The present invention relates to a novel recombinant polynucleotide
CC construct useful for modulating the expression of a transgene in a plant
CC cell. The recombinant polynucleotide construct comprises cassettes
CC comprising promoter operably linked to heterologous gene and cross-talk
CC blocking element. The cross-talk blocking element comprises a
CC polynucleotide which corresponds to (see BNR06310-BNR06576). The
CC invention further relates to: (1) a plant cell comprising the recombinant
CC polynucleotide construct; (2) a transgenic plant comprising the
CC recombinant polynucleotide construct in at least one cell; and (3) a
CC method for modulating the expression of at least one transgene in a plant
CC cell. The invention also relates to compositions and methods are provided
CC for the improved expression and regulation of transgenes in plants,
CC including a method of identifying gene expression gene cross-talk
CC blocking and modulating elements, as well as the compositions of said
CC elements. The DNA comprises a RB, LOXP, NOS promoter, ZM-WUS2, IN2
CC terminator, FMV enhancer, PCSV ENH, MMV ENH, UBI1ZM PRO, UBI1ZM 5' UTR,
CC UBI1ZM intron T :ZMODP2, OS-T28 terminator, ZM-T2S2C5 CTB, ZM-HSP17.7
CC PRO, MO-CRE exon 1, ST-LS1 intron 2, MO-CRE exon 2, PINII terminator,
CC LOXP, SB-UBI PRO, SB-UBI intron 1, ZSGREEN1, OS-UBI terminator, SB-ALS
CC PRO, ZM-ALS, SB-UBI terminator and LB.
XX
SQ Sequence 20881 BP; 4934 A; 5333 C; 5172 G; 5442 T; 0 U; 0 Other;
Query Match 100.0%; Score 118; Length 20881;
Best Local Similarity 100.0%;
Matches 118; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CCACGAGAGAGATGTTTGGATAAGGTCCATTAGAAATTTACGTGGGCCTGGAATAGGGCT 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 8979 CCACGAGAGAGATGTTTGGATAAGGTCCATTAGAAATTTACGTGGGCCTGGAATAGGGCT 9038
Qy 61 TACATAAACATTGGGCTGATCGAGAGTGCAGATGTTGAGAAAAATATCCTTTGCGAAT 118
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 9039 TACATAAACATTGGGCTGATCGAGAGTGCAGATGTTGAGAAAAATATCCTTTGCGAAT 9096
Search completed: June 30, 2026, 19:11:03
Job time : 84 secs
(D) The level of one of ordinary skill;
The level of one ordinary skill in the art is high.
(E) The level of predictability in the art
It is also unpredictable what sequence structure(s) within the 80% sequence identity to 100 contiguous nucleotides to SEQ ID NO: 26, would result in a functional construct. It is further unpredictable what that function is. It is unpredictable if SEQ ID NO: 134 would result in a functional construct, without a function to identify functionality. It is unpredictable as to what structures of Type II CTB’s or would result in a functional construct.
(F) The amount of direction provided by the inventor
The specification does not provide guidance as to what structures would result in a functional construct in claims 1-3.The specification provides no guidance as to what sequences having 80% sequence identity to 100 contiguous nucleotides to SEQ ID NO:26 would result in a functional construct. The specification does not provide guidance if SEQ ID NO: 134 would result in a functional construct. The specification does not provide guidance as to what Type II CTB’s would result in a functional construct or the structures of said Type II CTB’s.
(G) The existence of working examples
Applicant has no working example of a sequence having 80% sequence identity to 100 contiguous nucleotides to SEQ ID NO: 26. The Applicant has no working examples with SEQ ID NO: 134. The Applicant has no working examples of structures of Type II CTB’s.
(H) The quantity of experimentation needed to make or use the invention
While one skilled in the art can produce a population of sequences within the 80% sequence identity to 100 contiguous nucleotides to SEQ ID NO: 26 scope, undue experimentation is required to identify sequences within the 80% sequence identity to 100 contiguous nucleotides to SEQ ID NO: 26 resulting in a functional construct.
Additionally, it would require undue experimentation to identify what motifs and combinations of motifs would result in a functional construct. The same can be said for Type II CTB’s, wherein the structure is not disclosed or identifiable.
Claims 1-4, 6 and 8-10, are directed to a recombinant polynucleotide construct comprising at least two cassettes, wherein each cassette comprises a promoter operably linked to a heterologous gene; and at least one cross-talk blocking element; wherein the cross-talk blocking element comprises a polynucleotide sharing at least 80% identity with at least 100 contiguous nucleotides of SEQ ID NO: 26, SEQ ID NO: 134, or any Type II cross blocking element.
With regard embodiment (1), a sequence having 80% sequence identity to 100 contiguous nucleotides to SEQ ID NO: 26 resulting in a functional construct cannot be made without undue experimentation. No guidance or working example is disclosed for producing said sequence. The state of the prior art does not teach that there is only one sequence or one construct for conferring the function of a sequence having 80% sequence identity to 100 contiguous nucleotides to SEQ ID NO: 26. Thus, the structure of a sequence having 80% sequence identity to 100 contiguous nucleotides to SEQ ID NO: 26 cannot be predicted from Applicant’s disclosure or from the prior art. The disclosure of a sequence having 80% sequence identity to 100 contiguous nucleotides to SEQ ID NO: 26 does not allow one skilled in the art to make a sequence of having 80 contiguous nucleotides, and resulting in a functional construct. Therefore, “sequence having 80% sequence identity to 100 contiguous nucleotides to SEQ ID NO: 26” is not enabled.
Additionally, with regard to embodiment (2), SEQ ID NO:134, is not enabled for the same reasons set forth above. SEQ ID NO: 134 sequence without a working example or guidance a functional construct cannot be made without undue experimentation.
With regard to embodiment (3), an undisclosed Type II CTB structure or functional construct, is not enabled for the same reasons set forth above. A Type II CTB sequence of undisclosed structure cannot be made without undue experimentation.
Given the breadth of the claim, the state of the prior art, the lack of predictability, and the lack of guidance and working examples, notwithstanding a relatively high level of ordinary skill of those in the art, the amount of experimentation required to make the claimed invention would likely be extensive and undue.
Accordingly, weighing all the Wands factors based on the totality of the record as discussed above, the Office determines that it would require undue experimentation for a person of ordinary skill in the art to make and use the invention as claimed.
Claim Interpretation
In regard to claim 3, the Applicant claims that the cross-talk blocking element is a Type II CTB and does not claim a structure. The specification does not clearly define what is a Type II CTB disclosing that “For insulator II, the targeted genes were identified by the expected stable expression pattern across different tissue types” (Spec. pg. 37 lines 20-22). Therefore, the claim is interpreted as an insulator that is “expected” but not actually result in stable expression pattern across different tissue types.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claim 3, is rejected under 35 U.S.C. 102(a)(1) as being anticipated by Gan et al., (US 20060174370 A1).
In regard to claim 3, Gan et al. discloses on a recombinant polynucleotide construct comprising two expression cassettes each comprising a promoter operably linked to a heterologous gene and at least one cassette comprising an insulator (i.e. cross-talk blocking element), (see paragraph [0038] and figure 1).
Gan et al. discloses that “the insulator at the 5' end of the promoter should result in a relatively even level of GUS expression with no or little variation among all transgenic plants” (para. [0088]), and thus reads on a Type II CTB.
Therefore, the prior art anticipates the claimed invention.
Claim 3, is rejected under 35 U.S.C. 102(a)(1) as being anticipated by Hochul Yi et al. (US 7790874 B2 (A)).
With regard to claim 3, claim 1 of ‘874 is directed to a recombinant polynucleotide construct: comprising a gene expression modulating element operably linked to a heterologous promoter and a polynucleotide of interest, wherein said gene expression modulating element is SEQ. ID NO. 3, and said gene modulating element influences the expression of the polynucleotide of interest.
In regard to claim 3, Hochul Yi et al. discloses that the gene modulating element is defined as “ a polynucleotide that when it is combined with a polynucleotide of interest it does at least one of the following: a) stabilizes the polynucleotide of interest by decreasing or preventing the influence of other nearby DNA sequences b) increases the expression of the polynucleotide of interest or c) decreases the expression of the polynucleotide of interest. When referring to "gene expression modulating activity" the activity is the stabilization of, the increasing of, or the decreasing of the expression of the polynucleotide of interest. When referring to a stabilization in gene expression or an increase or decrease in gene expression, it is meant when compared to an appropriate control” (col. 1, lines 47-60). Therefore, both the gene expression modulating element and Type II CTB are interpreted to both have the same function.
Additionally, Hochul Yi et al. discloses that “the gene expression modulating element may be located at various positions. For example, the modulating element may be located before the promoter, within the promoter, after the promoter and before the coding region of the polynucleotide of interest or after the coding region of the polynucleotide of interest. The modulating elements can protect transgenes either from surrounding native influences or can be used to protect transgenes from interacting with each other in a multigene cassette. The modulating elements can be used to block the influence of enhancers. The modulating elements can be placed between two genes adjacent to each other for setting clear boundary between two promoters and prevent unwanted interference of gene expression. The non-coding intergenic DNA elements are useful for improving and solving current obstacles such as transcriptional interference, chromatin repression, expression variegation for high transformation efficiency and transgenic plants recovery.” (col. 5-6, lines 53-2), which encompasses the recombinant polynucleotide construct comprising two cassettes, wherein each cassette comprises a promoter operably linked to a heterologous gene; and at least one cross-talk blocking element; wherein the cross-talk blocking element is a Type I or Type II cross-talk blocking element.
Therefore, the prior art anticipates the claimed invention.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to CHRISTIAN JOSE ORDAZ whose telephone number is (703)756-1967. The examiner can normally be reached 8:30 am-5:00 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad A Abraham can be reached on (571) 270-7058. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free).
If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/C.J.O./Examiner, Art Unit 1663
/JASON DEVEAU ROSEN/Primary Examiner, Art Unit 1662
Prosecution Insights