DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Preliminary amendment
The preliminary amendment filed on 08/28/2024 is noted. Claim 3 was amended, New claim 5 was added .
Claims 1-5 are pending and considered.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1-2 and 4 are rejected under 35 U.S.C. 102 (a) (1) as being anticipated by Wang et al. (NANOBIOTECHNOLOGY, first published on line 08, Sept. 2021, https://doi.org/10.1002/wnan.1754Digital Object Identifier (DOI).
Aptamers are oligomers of artificial ssDNA, RNA, XNA, or peptide that bind a specific target molecule, or family of target molecules. They exhibit a range of affinities. Aptamers are used in biological lab research and medical tests. If multiple aptamers are combined into a single assay, they can measure large numbers of different proteins in a sample. They can be used to identify molecular markers of disease.
Prior to the current Application was filed, Wang et al. describe the most recent advances in Gold nanoparticle (AuNP)-based testing for detecting any interested target analyte, particularly they teach that such AuNP-based viral detection applications have been involved using aptamers by passive adsorption and covalent conjugation are the two most commonly used strategies to conjugate ligands such as antibodies, proteins, aptamers, or DNA/RNA oligos to AuNPs. For example, in the lateral flow aptamer assay rely on high-quality antibodies or aptamers for antigen binding and detection. For example, Microfluidic electrochemical aptasensor for norovirus detection. In this method, nucleic acid molecule aptamers is used for detecting norovirus. Bt-Atp-Fc, biotin and ferrocene tagged aptamer, Grp-AuNPs, etc. colorimetry and fluorescent related secondary ELISA assay rather than PCR or rtPCR DAN or RNA conjugated /or related Aptamers is further involved (Fig. 12). Wang et al. also concluded that as shown in Figure 12, screen-printed carbon electrode was modified with a graphene-AuNPs composite, which was further functionalized through streptavidin-biotin binding with aptamer tagged with ferrocene as a redox probe. Using differential pulse voltametric analysis, a detection limit of 100 pM with a detection range from 100 pM to 3.5 nM for norovirus was obtained. The testing time of the proposed microfluidic electrochemical aptasensor was less than 35 min, which is faster than conventional ELISA and PCR analysis. With a specific aptamer, sensitivity and specificity can be further enhanced. There are many PCR or rtPCR and/or ELISA assays are made either alone or in combination with one or more Aptamer(s) conjugated to AuNP detections (See Tables 1-3).
In addition, they discuss considerations for the design of AuNP-based SARS-CoV-2 testing application. Finally, they specially highlight and propose important parameters to consider for the future development of effective AuNP-based testings that would be critical for not only this COVID-19 pandemic, but also potential future outbreaks. In this detective system, the biological sample, which is suspected to comprise the viral RNA , S protein of SARS-Cov2 virus , or viral specific IgG or IgM under the investigation are mixed with a AuNP, which is conjugated with variety of detective agent, (See section of 2.1.3 LSPR assay and Figs. 1-8). In particular, many viruses including the SARS-Cov-2 spike protein, are used this aptamer AuNP conjugated detection system for capturing the molecule (See Table 1-3 and Fig.s 1-19
For instance, Wang et al. present at TABLE 2 that FDA-approved gold nanoparticle-based serology tests for SARS-CoV-2 under EUA designation (as of January 17, 2021) belong to the AuNP-Aptamer assays (See Table 2).
Moreover, Wang et al. also teach at section of 3.2 : Design of target molecules, they teach using AuNP Aptamer system to detect spick protein and its gene (Section 3.2 and TABLE 3), which include using both nucleic acids and antibody against spike protein RBD domain.
Wang et al. also disclose that many samples and detection systems, are presented in a PBS buffered saline, wherein PBS saline inherently comprises sodium chloride at concentration of 136.893 mM as evidenced by AAT Bioquest, searched by 2026, pages 1-4).
Hence, the cited reference both explicitly and implicitly teaches claims 1-2 and 4.
Claims 1-2 and 4 are rejected under 35 U.S.C. 102 (a) (1) as being anticipated by Abubakar et al. (ACS Applied Bio Materials, May 6, 2022, (5), pp. 2421-2430).
Abubakar et al. teach that” In this work, we report a facile synthesis of graphene oxide–gold (GO–Au) nanocomposites by electrodeposition. The fabricated electrochemical immunosensors are utilized for the dual detection of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) antigen and SARS-CoV-2 antibody. The GO–Au nanocomposites has been characterized by UV–vis spectroscopy, X-ray diffraction (XRD), transmission electron microscopy (TEM), cyclic voltammetry (CV), differential pulse voltammetry (DPV), and electrochemical impedance spectroscopy (EIS) for its biosensing properties. The linear detection range of the SARS-CoV-2 antigen immunosensor is 10.0 ag mL–1 to 50.0 ng mL–1, whereas that for the antibody immunosensor ranges from 1.0 fg mL–1 to 1.0 ng mL–1. The calculated limit of detection (LOD) of the SARS-CoV-2 antigen immunosensor is 3.99 ag mL–1, and that for SARS-CoV-2 antibody immunosensor is 1.0 fg mL–1 with high sensitivity. The validation of the immunosensor has also been carried out on patient serum and patient swab samples from COVID-19 patients. The results suggest successful utilization of the immunosensors with a very low detection limit enabling their use in clinical samples. Further work is needed for the standardization of the results and translation in screen-printed electrodes for use in portable commercial applications.
In particular, the antibody to the spike protein (S protein) or antibody of the S Protein are loaded onto the AuNP (See Scheme 1).
In sections 2.7-3.8for detection of clinical samples for the presence of antibody or antigen of Spike protein of SARS-CoV2 is respectively conducted . In particular the antibody to the spike protein is loaded by chemical conjugated to a AuNP , then the presence of S protein is detected (See Fig 5a-b).
They concluded in the Conclusion that they have developed GO–Au nanocomposites-based electrochemical immunosensor platforms for dual detection of SARS-CoV-2 antigen and SARS-CoV-2 antibody. The synthesized GO–Au nanocomposites shows excellent features like high conductivity, good biocompatibility, and high surface functionality. Furthermore, characterization techniques determined the average particle size of the AuNPs to be 12.1 nm, which corresponds to high surface area. The electrochemical studies revealed that the proposed immunosensor platforms have high sensitivity for the detection of SARS-CoV-2 antigen and antibody. The SARS-CoV-2 antigen immunosensor showed excellent sensitivity in the linear range of 10 ag mL–1 to 50 ng mL–1 with LOD of 3.99 ag mL–1, and the SARS-CoV-2 antibody immunosensor exhibit LOD of 1 fg mL–1 in the linear range of 1 fg mL–1 to 1 ng mL–1. Furthermore, the detection results for both fabricated immunosensors showed a good correlation with patient serum and swab samples as well. Additionally, the fabricated immunosensors have great potential in the development of POC devices for detection of the SARS-CoV-2 virus in near future.
The cited reference anticipates claims 1-2 and 4 by either ELISA assay using antibody as aptamers (Section 3.8) or by oligomer primers as aptamers for doing RT-PCR. The obtained results confirmed the formation of the GO–Au nanocomposites as shown in Figure 1 as well as use PBS saline to prepare the samples that inherently comprises sodium chloride at concentration of 136.893 mM as evidenced by AAT Bioquest, searched by 2026, pages 1-4).
Therefore, the cited reference anticipates claims 1-2 and 4.
Claim Rejections - 35 USC § 103
` The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 1-5 are rejected under 35 U.S.C. 103 as obvious over claims 3 and 5 by Wang et al. (NANOBIOTECHNOLOGY, first published on line 08, Sept. 2021, https://doi.org/10.1002/wnan.1754Digital Object Identifier (DOI) and Song et al. (ACS Analytical Chemistry published on June 18, 2020, Vol. 92 (14), pages 9895-9900).
The claimed subject matter is directed to a method for detecting an analyte contained in a sample, the method comprising the following (1) and (2) steps: (1) mixing the sample and a salt with a gold-nanoparticle-labeled aptamer in which gold nanoparticles are bound to an aptamer capable of binding to the analyte; and (2) judging that the sample contains the analyte in a case where there is no aggregation of the gold-nanoparticle-labeled aptamer in a mixture obtained by (1). wherein the analyte can be a SARS-CoV-2 spike protein.
Wang et al. describe the most recent advances in Gold nanoparticle (AuNP)-based testing for detecting any interested target analyte, particularly they teach that such AuNP-based viral detection applications have been involved using aptamers by passive adsorption and covalent conjugation are the two most commonly used strategies to conjugate ligands such as antibodies, proteins, aptamers, or DNA/RNA oligos to AuNPs. For example, in the lateral flow aptamer assay rely on high-quality antibodies or aptamers for antigen binding and detection. For example, Microfluidic electrochemical aptasensor for norovirus detection. In this method, nucleic acid molecule aptamers is used for detecting norovirus. Bt-Atp-Fc, biotin and ferrocene tagged aptamer, Grp-AuNPs, etc. colorimetry and fluorescent related secondary ELISA assay rather than PCR or rtPCR DAN or RNA conjugated /or related Aptamers is further involved (Fig. 12). Wang et al. also concluded that as shown in Figure 12, screen-printed carbon electrode was modified with a graphene-AuNPs composite, which was further functionalized through streptavidin-biotin binding with aptamer tagged with ferrocene as a redox probe. Using differential pulse voltametric analysis, a detection limit of 100 pM with a detection range from 100 pM to 3.5 nM for norovirus was obtained. The testing time of the proposed microfluidic electrochemical aptasensor was less than 35 min, which is faster than conventional ELISA and PCR analysis. With a specific aptamer, sensitivity and specificity can be further enhanced. There are many PCR or rtPCR and/or ELISA assays are made either alone or in combination with one or more Aptamer(s) conjugated to AuNP detections (See Tables 1-3).
In addition, they discuss considerations for the design of AuNP-based SARS-CoV-2 testing application. Finally, they specially highlight and propose important parameters to consider for the future development of effective AuNP-based testings that would be critical for not only this COVID-19 pandemic, but also potential future outbreaks. In this detective system, the biological sample, which is suspected to comprise the viral RNA , S protein of SARS-Cov2 virus , or viral specific IgG or IgM under the investigation are mixed with a AuNP, which is conjugated with variety of detective agent, (See section of 2.1.3 LSPR assay and Figs. 1-8). In particular, many viruses including the SARS-Cov-2 spike protein, are used this aptamer AuNP conjugated detection system for capturing the molecule (See Table 1-3 and Fig.s 1-19
For instance, Wang et al. present at TABLE 2 that FDA-approved gold nanoparticle-based serology tests for SARS-CoV-2 under EUA designation as of January 17, 2021) belong to the AuNP-Aptamer assays (See Table 2). Moreover, Wang et al. also teach at section of 3.2 : that target molecules uses AuNP Aptamer to detect spick protein as well as nucleic acid primer as well as antibody (Section 3.2 and TABLE 3)m all of them is to target spike protein RBD domain.
Wang et al. also disclose using said Aptamers to detect many samples using a PBS buffered saline, wherein PBS saline inherently comprises sodium chloride at concentration of 136.893 mM as evidenced by AAT Bioquest, searched by 2026, pages 1-4).
However, Wang e al. do not teach how to select Aptamers as a polynucleotide sequence, more specifically it is the one comprising the base sequence of the claimed SEQ ID NO: 1 and binding to the receptor binding domain (RBD) of the SARS-Cpv-2 spike protein,
Song et al. teach that an application of aptamers of nucleic acid aptamers targeting SARS-CoV-2 RBD. They have identified and selected two sequences (CoV2-RBD-1 and CoV2-RBD-4) that were optimized in length, resulting in hairpin-structured 51-base CoV2-RBD-1C and 67-base CoV2-RBD-4C aptamers. The optimized aptamers possess a high binding affinity against SARS-CoV-2 RBD, with respective Kd values of 5.8 nM and 19.9 nM. The CoV2-RBD-1C aptamer is shown in (Figure 4A, is 5′-CAG-CAC-CGA-CCT-TGT-GCT-TTG-GGA-GTG-CTG-GTC-CA-AGG-GCG-TTA-ATG-GA-CA-3′). The CoV2-RBD-4C aptamer is shown in (Figure 4E): 5′-ATC-CAG-AGT-GAC-GCA-GCA-TTT-CAT-CGG-GTC-CAA-AAG-GGG-CTG-CTC-GGG-ATT-GCG-GAT-ATG-GA-CAC-GT-3′), wherein the G-GGG-CTG-CTC-GGG-ATT-GCG-G is the one of the claimed SEQ ID NO: 1. GGGGCTGCTCGGGATTGCGGATATGG
Song et al. concluded the identified aptamers targeting SARS-CoV-2 RBD using an ACE2 competition-based selection strategy and a machine learning screening algorithm. Among the aptamer candidates, two sequences (CoV2-RBD-1 and CoV2-RBD-4) were optimized in length, resulting in hairpin-structured 51-base CoV2-RBD-1C and 67-base CoV2-RBD-4C aptamers. The optimized aptamers possess a high binding affinity against SARS-CoV-2 RBD, with respective Kd values of 5.8 nM and 19.9 nM. The results of molecular dynamics simulations (MDS) and experiments on competition suggest that aptamers bind to several amino acid residues of RBD that are key to ACE2 binding. Therefore, aptamers have the potential to inhibit or block the binding of SARS-CoV-2 RBD to ACE2, properties that could be used in the treatment of and prevention against SARS-CoV-2.
Therefore, it would have been obvious to be motivated by the cited references and combine the teachings by Wang et al. and Song et al. to arrive the claims method using the unexpected results. Hence the claimed invention as a whole is prima facie obvious absence unexpected results.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to BAO Q LI whose telephone number is (571)272-0904. The examiner can normally be reached M-F 8 am to 8 pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Michael Allen can be reached at 571-270-3497. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
BAO Q. LI
Examiner
Art Unit 1671
/BAO Q LI/Primary Examiner, Art Unit 1671
Prosecution Insights