Prosecution Insights
Last updated: August 06, 2026
Application No. 18/847,982

SOYBEAN JAG1 GENE MUTATIONS

Non-Final OA §101§102§103
Filed
Sep 17, 2024
Priority
Mar 21, 2022 — provisional 63/269,663 +1 more
Examiner
TAMUKONG, YVETTE BIH
Art Unit
1662
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Inari Agriculture Technology Inc.
OA Round
1 (Non-Final)
100%
Grant Probability
Favorable
1-2
OA Rounds
0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 100% — above average
100%
Career Allowance Rate
2 granted / 2 resolved
+40.0% vs TC avg
Minimal +0% lift
Without
With
+0.0%
Interview Lift
resolved cases with interview
Fast prosecutor
1y 8m
Avg Prosecution
16 currently pending
Career history
17
Total Applications
across all art units

Statute-Specific Performance

§101
11.5%
-28.5% vs TC avg
§103
34.6%
-5.4% vs TC avg
§102
15.4%
-24.6% vs TC avg
§112
34.6%
-5.4% vs TC avg
Black line = Tech Center average estimate • Based on career data from 2 resolved cases

Office Action

§101 §102 §103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Priority 3/21/2022. Acknowledgment is made of applicant’s claim for priority to U.S. Provisional Application No. 63/269,663, filed March 21, 2022. The effective filing date is 3/21/2022. Status of the Claims Amendments dated 05/12/2025 are entered Claims 1-19, and 25-39 are cancelled. Claims 20-24 and 40 are pending and are examined herein. Information Disclosure Statement The information disclosure statements (IDS) submitted on 01/08/2025 and 01/05/2026 are acknowledged and are being considered by the Examiner. Claim Objections Claim 20 is objected to because of the following informalities: The claim recites “sequence of SEQ ID NO: 7, 15, 17, 19, 21, 23, 25, 27, 29, 31, 32, 33, 34, or 35 or an allelic variant thereof” instead of “sequence of SEQ ID NO: 7, 15, 17, 19, 21, 23, 25, 27, 29, 31, 32, 33, 34, 35 or an allelic variant thereof.” Appropriate correction of the above informalities is required. Claim Rejections - 35 USC § 101 Claims 20-21 are rejected under 35 U.S.C. 101 because the claimed invention is directed to non-statutory subject matter. The claims do not fall within at least one of the four categories of patent eligible subject matter because the claimed invention is directed to a judicial exception (i.e., a law of nature, a natural phenomenon including products of nature, or an abstract idea) without significantly more. All dependent claims are included in these rejections unless they contain a limitation that overcomes the deficiencies of the parent claim from which they depend. The rationale for this determination is explained below. The claims are listed below for reference within this document. Claim 20 is drawn to the polynucleotide comprising the sequence of SEQ ID NOs: 7, 15, 17, 19, 21, 23, 25, 27, 29, 31, 32, 33, 34, 35 or an allelic variant thereof or the polynucleotide encoding the polypeptide comprising the amino acid sequence of SEQ ID NO: 12, 13, 14, 22, 24, 26, 28, 30, or an allelic variant thereof. Claim 21 is drawn to a biological sample comprising the polynucleotide of claim 20 The instantly claimed polynucleotide, which includes an allelic variant thereof, appears to be a naturally occurring sequence. The polynucleotide, which includes an allelic variant thereof, is present in both cultivated soybean Glycine Max and wild soybean Glycine soja plants ( see description column of ABSS sequence search results snippet below). Likewise, a biological sample comprising the polynucleotide of claim 20 would also be naturally occurring (i.e., a glycine max plant bearing the polynucleotide). Applicant recites in paragraph 0014 of the specification that “the phrase "biological sample" refers to either intact or non-intact… soybean plant tissue.” Thus, wild soybean plants existing in the wild or parts torn by herbivores are equivalent to the biological sample of claim 21. PNG media_image1.png 600 1048 media_image1.png Greyscale A claim that focuses on use of a natural principle must also include additional elements or steps to show that the inventor has practically applied, or added something significant to, the natural principle itself (Mayo Collaborative Services v. Prometheus Laboratories, Inc., 566 U.S. __, 132 S.Ct. 1289,101 USPQ2d 1961 (2012), at 1966). To show integration, the additional elements or steps must relate to the natural principle in a significant way to impose a meaningful limit on the claim scope. The claimed inventions do not rise to a level that is markedly different in structure from what exists in nature. They are merely the recitation of a naturally occurring sequence in a naturally occurring intact wild soybean plant or herbivore collected tissues. Thus, the claimed inventions are not patent-eligible pursuant to the Supreme Court decision in Ass'n. for Molecular Pathology v. Myriad Genetics (formerly v. USPTO), 653 F.3d 1329, 99 USPQ2d 1398 (Fed. Cir. 2011), cert. granted, judgment vacated and remanded to the Court of Appeals for the Federal Circuit, No. 11-725, 80 U.S.L.W. 3380, 2012 BL 72224 (U.S. Mar. 26, 2012), reversed, ---- S.Ct. ----, 106 USPQ2d 1972, 1974-75 (2013). See “The 2019 Revised Patent Subject Matter Eligibility Guidance”, issued January 7, 2019, available from the USPTO website at https://www.govinfo.gov/content/pkg/FR-2019-01-07/pdf/2018-28282.pdf. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claims 20-21 are rejected under 35 U.S.C. 102(a)(1) as being clearly anticipated over Jeong (Jeong et al. "Ln Is a Key Regulator of Leaflet Shape and Number of Seeds per Pod in Soybean." The Plant Cell 24.12 (2012): 4807-4818., published 12/14/2012) taken with the evidence of GenBank Accession JX119212.1 (“Glycine max cultivar V94-5152 JAG1 (Ln) gene, complete cds”, Published 03/05/2013). The claims are listed below for reference within this document. 20. A polynucleotide comprising the sequence of SEQ ID NO: 7, 15, 17, 19, 21, 23, 25, 27, 29, 31, 32, 33, 34, or 35 or an allelic variant thereof or encoding the polypeptide comprising the amino acid sequence of SEQ ID NO: 12, 13, 14, 22, 24, 26, 28, 30, or an allelic variant thereof. 21. A biological sample comprising the polynucleotide of claim 20. Jeong teaches that “Ln Is a Key Regulator of Leaflet Shape and Number of Seeds per Pod in Soybean" and the “sequence data from [Jeong’s] article can be found in the GenBank/EMBL data libraries under the following accession numbers: Gm-JAG1 (JX119212…)” (title; page 4817, col 1). GenBank Accession No. JX119212.1 provides evidence that the above sequence of Jeong shares 99.9 sequence identity with the sequence of SEQ ID NO: 33 (i.e., a polynucleotide comprising the sequence of SEQ ID NO: 7, 15, 17, 19, 21, 23, 25, 27, 29, 31, 32, 33, 34, or 35 or an allelic variant thereof)(see sequence alignment below). The soybean plant and parts thereof of Jeong will read on the biological sample of the instant claims. ALIGNMENT OF SEQ ID NO:33 WITH JX119212.1 FROM JEONG LOCUS JX119212 13617 bp DNA linear PLN 05-MAR-2013 DEFINITION Glycine max cultivar V94-5152 JAG1 (Ln) gene, complete cds. ACCESSION JX119212 VERSION JX119212.1 KEYWORDS . SOURCE Glycine max (soybean) ORGANISM Glycine max Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; fabids; Fabales; Fabaceae; Papilionoideae; 50 kb inversion clade; NPAAA clade; indigoferoid/millettioid clade; Phaseoleae; Glycine; Glycine subgen. Soja. REFERENCE 1 (bases 1 to 13617) AUTHORS Jeong,N., Suh,S.J., Kim,M.H., Lee,S., Moon,J.K., Kim,H.S. and Jeong,S.C. TITLE Ln is a key regulator of leaflet shape and number of seeds per pod in soybean Query Match 99.5%; Score 2424; Length 13617; Best Local Similarity 99.9%; Matches 2435; Conservative 0; Mismatches 0; Indels 1; Gaps 1; Qy 1 GGGGGCGGGGGGAGATAAGAGAGAGAGAGAGAGTGGCAGAGGAACTGATAGAGAACTTTC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5672 GGGGGCGGGGGGAGATAAGAGAGAGAGAGAGAGTGGCAGAGGAACTGATAGAGAACTTTC 5731 Qy 61 AAAGCTCTTTATCTTCTACCATCACTCAACCAGCCTCTATATTGCAGTCTCAAACTGAAA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5732 AAAGCTCTTTATCTTCTACCATCACTCAACCAGCCTCTATATTGCAGTCTCAAACTGAAA 5791 Qy 121 GTCTAAATTTTTTTGTAAAAAGCTTTAGTTTTATCCCTACCCCCACCCCATCTGAAAGAA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5792 GTCTAAATTTTTTTGTAAAAAGCTTTAGTTTTATCCCTACCCCCACCCCATCTGAAAGAA 5851 Qy 181 AGAGTGTTTGCCTCACATCATTTTTCCCCTTTCTGTCTCTCTCTCTGTCGGTACCATGTA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5852 AGAGTGTTTGCCTCACATCATTTTTCCCCTTTCTGTCTCTCTCTCTGTCGGTACCATGTA 5911 Qy 241 GGTCTTCCCCCACTACTACACCTTCACACCCTTCTTTTCTTCCTCCTCTTTCTCCTTCTC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5912 GGTCTTCCCCCACTACTACACCTTCACACCCTTCTTTTCTTCCTCCTCTTTCTCCTTCTC 5971 Qy 301 TAAACCCTTTAACTTTCTCTCTCTTATGACTTTGTTGTTCCTTTACAGGAGACCAGAACG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5972 TAAACCCTTTAACTTTCTCTCTCTTATGACTTTGTTGTTCCTTTACAGGAGACCAGAACG 6031 Qy 361 AAACCCCTTAGATCTTAACAATTTGCCCGATGAGTACTCTAGAGATGGCAAACAAGTCCT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 6032 AAACCCCTTAGATCTTAACAATTTGCCCGATGAGTACTCTAGAGATGGCAAACAAGTCCT 6091 Qy 421 CGAAGA-CATACCTCTTCATCCGGTAAACTTCATGATCATACCAATATATATATATATGC 479 |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 6092 CGAAGACCATACCTCTTCATCCGGTAAACTTCATGATCATACCAATATATATATATATGC 6151 Qy 480 ACGCTGAAATATCAAAGGAACACTTTTTTTTTCTTTCTATTTACCGAATTCTATTTCACA 539 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 6152 ACGCTGAAATATCAAAGGAACACTTTTTTTTTCTTTCTATTTACCGAATTCTATTTCACA 6211 Qy 540 ATCACACACCACCATGGGAAGCCTTTCACTTTTCACAGGAAACAAAGTTGAACACTGCCC 599 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 6212 ATCACACACCACCATGGGAAGCCTTTCACTTTTCACAGGAAACAAAGTTGAACACTGCCC 6271 Qy 600 GTGGTTTGTTACCCATCCCTGTGGTATATTCCTTGACCATGAAACAGTGTTCACCACACT 659 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 6272 GTGGTTTGTTACCCATCCCTGTGGTATATTCCTTGACCATGAAACAGTGTTCACCACACT 6331 Qy 660 TTTTTTTCCTCATTTTTTTATTCTTTTTGTTTTGTCCTTGTATACGTTTCTTTTCTTTTT 719 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 6332 TTTTTTTCCTCATTTTTTTATTCTTTTTGTTTTGTCCTTGTATACGTTTCTTTTCTTTTT 6391 Qy 720 TTGTTTCTTCTCCTTTTCCTCTTCTACTTCGTTATAGTATCTCTTAAAAGTTATGGAAAA 779 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 6392 TTGTTTCTTCTCCTTTTCCTCTTCTACTTCGTTATAGTATCTCTTAAAAGTTATGGAAAA 6451 Qy 780 AATAAAATAAGAAAAACATAAAAGTAGTTAGGTGATAGAATAGAACTTAAAAAAAAGAAA 839 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 6452 AATAAAATAAGAAAAACATAAAAGTAGTTAGGTGATAGAATAGAACTTAAAAAAAAGAAA 6511 Qy 840 AGTAGTTGTTTGGGGGCGAGCGGTAAGTTAATTAATTGAATTGATTTGATGGAGGATTTG 899 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 6512 AGTAGTTGTTTGGGGGCGAGCGGTAAGTTAATTAATTGAATTGATTTGATGGAGGATTTG 6571 Qy 900 GGTAATCGAGAATGGGGAGTTAAAGGCAAAGAAGGGTGTCATGGAAGTTGCTTTAATTGG 959 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 6572 GGTAATCGAGAATGGGGAGTTAAAGGCAAAGAAGGGTGTCATGGAAGTTGCTTTAATTGG 6631 Qy 960 ATGGTTATAGTTGCAGGTTGCAGGAAAAAGAAAAGCGGCGGGAAGGATGGAAAAGACGAG 1019 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 6632 ATGGTTATAGTTGCAGGTTGCAGGAAAAAGAAAAGCGGCGGGAAGGATGGAAAAGACGAG 6691 Qy 1020 TGTGGGAAGGTCTACGAGTGTAGATTTTGTTCCCTCAAGTTCTGCAAGTCTCAGGCTCTT 1079 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 6692 TGTGGGAAGGTCTACGAGTGTAGATTTTGTTCCCTCAAGTTCTGCAAGTCTCAGGCTCTT 6751 Qy 1080 GGGGGACACATGAACCGCCACCGCCAAGGCTAGTACCACCTATATTATTATACTTTATAT 1139 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 6752 GGGGGACACATGAACCGCCACCGCCAAGGCTAGTACCACCTATATTATTATACTTTATAT 6811 Qy 1140 TTTCTTCCTCTTTTCTTTTACCACTCCTTCTCACAAGAACCAAATCTCTTCTGGCCGTTA 1199 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 6812 TTTCTTCCTCTTTTCTTTTACCACTCCTTCTCACAAGAACCAAATCTCTTCTGGCCGTTA 6871 Qy 1200 ATGATTTGGCCATGAAAGCTTGTCATTTCAATCACAAAATGTTGTGTTGTTGGATTGCTG 1259 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 6872 ATGATTTGGCCATGAAAGCTTGTCATTTCAATCACAAAATGTTGTGTTGTTGGATTGCTG 6931 Qy 1260 AAATTCGATCATCGAGAGGGCCCCTTCAGCTGTTTTTTTTTTTTCTTTTTGCTTTGCTTT 1319 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 6932 AAATTCGATCATCGAGAGGGCCCCTTCAGCTGTTTTTTTTTTTTCTTTTTGCTTTGCTTT 6991 Qy 1320 ATTATTTGTTTTTGTGATTGTTTTGAGCAGAGAGGGAAACGGAGACGCTGAACCAGGCTC 1379 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 6992 ATTATTTGTTTTTGTGATTGTTTTGAGCAGAGAGGGAAACGGAGACGCTGAACCAGGCTC 7051 Qy 1380 GTCAACTGGTCTTTCGTTGTGATCATAACATTGCTGCACAAGGTGCCCCTCACTTAGGGT 1439 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7052 GTCAACTGGTCTTTCGTTGTGATCATAACATTGCTGCACAAGGTGCCCCTCACTTAGGGT 7111 Qy 1440 ATGCACCCATTACTTCCATGCAGCGATTCTCTTCCTATTTCTTCTTCTTGTTCAACATTT 1499 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7112 ATGCACCCATTACTTCCATGCAGCGATTCTCTTCCTATTTCTTCTTCTTGTTCAACATTT 7171 Qy 1500 ATATATTTCATTTCTCAAATACTTGTTTTTCTGTGGGTTCTTTAGCGTTTGTTAACGTTG 1559 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7172 ATATATTTCATTTCTCAAATACTTGTTTTTCTGTGGGTTCTTTAGCGTTTGTTAACGTTG 7231 Qy 1560 TTTTTTCAAGGTATAACACATAATATTTGGGTACTCAGCATGACACTGTTTGATACTGCG 1619 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7232 TTTTTTCAAGGTATAACACATAATATTTGGGTACTCAGCATGACACTGTTTGATACTGCG 7291 Qy 1620 ATTTATTTGTGATAATATTCAATTCAGATGCTGCCAAACAATAGGAACGGGGGGTTATCA 1679 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7292 ATTTATTTGTGATAATATTCAATTCAGATGCTGCCAAACAATAGGAACGGGGGGTTATCA 7351 Qy 1680 TCCCTCAGGAGACCCAACAGTGCCTCTAAGATTCCCAAGATACTTCTCAGGTTCATCCTC 1739 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7352 TCCCTCAGGAGACCCAACAGTGCCTCTAAGATTCCCAAGATACTTCTCAGGTTCATCCTC 7411 Qy 1740 AACTCACATGCCACCATCCCCGCCACCGCCGCCGCCACCGCAACGACCATACCTATACCC 1799 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7412 AACTCACATGCCACCATCCCCGCCACCGCCGCCGCCACCGCAACGACCATACCTATACCC 7471 Qy 1800 TTCACCTACGAGGCCAGTGTCATTTGGGTCATCACACTTCCCTCTCCAGCATGCAGTGAA 1859 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7472 TTCACCTACGAGGCCAGTGTCATTTGGGTCATCACACTTCCCTCTCCAGCATGCAGTGAA 7531 Qy 1860 CGATTACTATGTGGGCCACGTGATGAGTGGTGGCAGCCACGGACACTATGTTGGAGGAGA 1919 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7532 CGATTACTATGTGGGCCACGTGATGAGTGGTGGCAGCCACGGACACTATGTTGGAGGAGA 7591 Qy 1920 GAGCACAAGGAGTTACACGTGCATTGGTGCACCGGTGGGGCAAGGTGGCGGATTCGCTGG 1979 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7592 GAGCACAAGGAGTTACACGTGCATTGGTGCACCGGTGGGGCAAGGTGGCGGATTCGCTGG 7651 Qy 1980 TGGTAAGGAGGGGTCTGCAGTGCAGGAGGAAGGGTTGAGTACTTGGGGAAGGGGCTATTC 2039 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7652 TGGTAAGGAGGGGTCTGCAGTGCAGGAGGAAGGGTTGAGTACTTGGGGAAGGGGCTATTC 7711 Qy 2040 AGGTGCACAGGATCGTTTGGATCCTCCCTCAGCGATCAATCGGTTTCAAGATGGTTTCTA 2099 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7712 AGGTGCACAGGATCGTTTGGATCCTCCCTCAGCGATCAATCGGTTTCAAGATGGTTTCTA 7771 Qy 2100 AAGAGATGAGAGATTCTTTGTTTGAGTGGTTTTTGGTTTGTGTTATGTTTCTGTTATGTT 2159 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7772 AAGAGATGAGAGATTCTTTGTTTGAGTGGTTTTTGGTTTGTGTTATGTTTCTGTTATGTT 7831 Qy 2160 ATGTGGTATCATCATAAAGACACGCAATCCAGAGAGAGAGAGAGGTGGTTTTTGGTTTAT 2219 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7832 ATGTGGTATCATCATAAAGACACGCAATCCAGAGAGAGAGAGAGGTGGTTTTTGGTTTAT 7891 Qy 2220 CTACAGTAACCAGGGACAGCTTTTGAGCTCATGGACACGCTCAGCTACTTTGGCTTGGAG 2279 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7892 CTACAGTAACCAGGGACAGCTTTTGAGCTCATGGACACGCTCAGCTACTTTGGCTTGGAG 7951 Qy 2280 TTGTGGGTGGGATTTCTTCTCAACATCGCCTTTTGTATTGGTAGCTAGCTAGCTAGCTTG 2339 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7952 TTGTGGGTGGGATTTCTTCTCAACATCGCCTTTTGTATTGGTAGCTAGCTAGCTAGCTTG 8011 Qy 2340 GACAACCAGTTAGATTTGAACTGAAACTTTCCAAACTCCTTTTCCTTTGCATGCCAAATT 2399 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 8012 GACAACCAGTTAGATTTGAACTGAAACTTTCCAAACTCCTTTTCCTTTGCATGCCAAATT 8071 Qy 2400 ACAACCATTTTCCTTCTCAGTAATTTGTTCTTTCAA 2435 |||||||||||||||||||||||||||||||||||| Db 8072 ACAACCATTTTCCTTCTCAGTAATTTGTTCTTTCAA 8107 For these reasons, the teaching of Jeong taken with the evidence of GenBank Accession No. JX119212 anticipates the limitations of the instant claims. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. Claims 22-24 are rejected under 35 U.S.C. 103 as being unpatentable over Jeong (Jeong et al. "Ln Is a Key Regulator of Leaflet Shape and Number of Seeds per Pod in Soybean." The Plant Cell 24.12 (2012): 4807-4818., published 12/14/2012) taken with the evidence of GenBank Accession JX119212.1 (“Glycine max cultivar V94-5152 JAG1 (Ln) gene, complete cds”, Published 03/05/2013; teaching GenBank Accession JX119212.1) in view of Shiau (Shiau, Shi-yen et al. “Defatted and full-fat soybean meal as partial replacements for fishmeal in tilapia (Oreochromis niloticus×O. aureus) diets at low protein level.” Aquaculture 86 (1990): 401-407., published 05/01/1990). The claims are listed below for reference within this document. 22. The biological sample of claim 21, wherein the sample comprises soybean meal or soybean stover. 23. The biological sample of claim 22, wherein the soybean seed meal is defatted. 24. The biological sample of claim 22, wherein the soybean seed meal is non-defatted. The Teachings of Jeong are set forth above. Jeong does not explicitly teach that the sample comprises soybean meal or soybean stover. Shiau teaches soybean meal (i.e., the sample comprises soybean meal) (title). Shiau further teaches both “defatted and full-fat soybean meal” (i.e., wherein the soybean seed meal is defatted or wherein the soybean seed meal is non-defatted). Therefore, it would have been obvious to one of ordinary skill in the art before the filing date of the claimed invention to modify the teachings of Jeong, including JX119212.1, with those of Shiau by obtaining defatted or non-defatted soybean meal from the plants of Jeong et al, arriving at the claimed invention with a reasonable expectation of success. One would have been motivated to do this in order to harness the seeds per pod regulatory activity of the JAG1 gene as taught by Jeong toward the production of more defatted or non-defatted soybean meal for feeding fish, and given that Shiau taught “that either defatted soybean meal or full-fat soybean meal can be used to replace 30% fishmeal protein in a diet for [tilapia]” (abstract). Claim 40 is rejected under 35 U.S.C. 103 as being unpatentable over Inari ( U.S. Patent Application Publication No. 2019/0352655 A1, assigned to Inari Agricultural Technology Inc, Published 11/21/2019) in view of Korea (International Publication No. WO2013187554A1, Assigned to Korea Research Institute of Bioscience and Biotechnology KRIBB, Published 12/19/2013). The claim is listed below for reference within this document. 40. A guide RNA molecule comprising a Cas12 direct repeat element which is operably linked to the spacer RNA molecule encoded by SEQ ID NO: 2. Inari teaches that “Cpf1 endonuclease [also known as Cas12] and corresponding guide RNAs and PAM sites are disclosed in U.S. Patent Application Publication 2016/0208243 A1” (para 0053 and 0062) and that “a Cpf1 system requires only the Cpf1 nuclease and a crRNA to cleave the target DNA sequence.” (i.e., guide RNA molecule comprising a Cas12 direct repeat element)(para 0057). Inari also teaches that “the crRNA contains a “guide RNA”, typically a 20-nucleotide RNA sequence that corresponds to (i.e., is identical or nearly identical to, or alternatively is complementary or nearly complementary to) a 20-nucleotide target DNA sequence” (i.e., is operably linked to the spacer RNA molecule corresponding to a target sequence)(para 0055). Inari does not explicitly teach a spacer RNA molecule encoded by SEQ ID NO: 2. Korea teaches a soybean plant cell comprising an “ln gene consisting of a nucleotide sequence of SEQ ID NO: 1, which is produced by single nucleotide substitution in EAR motif of Ln (broad leaflet) gene from soybean (Glycine max)” (claims 1-3). Nucleotides 98-76 of SEQ ID NO: 1 of the Korea reference are 100% identical to Applicants' SEQ ID NO: 2 (i.e., nucleic acid molecule encoded by SEQ ID NO: 2) (see sequence alignment below). ALIGNMENT OF RICE SD1 GENE WITH REGIONS OF ERAGROSTIS TEF GENOME CHROMOSOMES 3A AND 3B FROM VANBUREN Title: US-18-847-982-2 Perfect score: 23 Sequence: 1 ccggatgaagaggtatggtcttc 23 Scoring table: IDENTITY_NUC Gapop 10.0 , Gapext 1.0 Searched: 1 seqs, 771 residues RESULT 1 NASEQ2_03232026_091149/c Query Match 100.0%; Score 23; DB 1; Length 771; Best Local Similarity 100.0%; Matches 23; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 CCGGATGAAGAGGTATGGTCTTC 23 ||||||||||||||||||||||| Db 98 CCGGATGAAGAGGTATGGTCTTC 76 Therefore, it would have been obvious to one of ordinary skill in the art before the filing of the claimed invention to combine and modify the teachings of Inari with to include the EAR motif of the ln gene taught by Korea (i.e., A guide RNA molecule comprising a Cas12 direct repeat element which is operably linked to the spacer RNA molecule encoded by SEQ ID NO: 2). One would have been motivated to do this in order to provide a superior “method of producing a plant with controlled number of seeds per pod by using the ln gene” (Korea, Abstract). Contact information Any inquiry concerning this communication or earlier communications from the examiner should be directed to YVETTE B TAMUKONG whose telephone number is (571)272-1040. The examiner can normally be reached M-Th 830-5 EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at (571) 270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /YVETTE BIH TAMUKONG/Examiner, Art Unit 1662 /MYKOLA V. KOVALENKO/Primary Examiner, Art Unit 1662
Read full office action

Prosecution Timeline

Sep 17, 2024
Application Filed
Apr 02, 2026
Non-Final Rejection mailed — §101, §102, §103 (current)

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
100%
Grant Probability
99%
With Interview (+0.0%)
1y 8m (~0m remaining)
Median Time to Grant
Low
PTA Risk
Based on 2 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month