Prosecution Insights
Last updated: April 19, 2026
Application No. 18/853,217

PLANTS WITH IMPROVED PATHOGEN RESISTANCE

Non-Final OA §102§103§112
Filed
Oct 01, 2024
Examiner
MEADOWS, CHRISTINA L
Art Unit
1663
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Takii & Company Limited
OA Round
1 (Non-Final)
73%
Grant Probability
Favorable
1-2
OA Rounds
2y 10m
To Grant
99%
With Interview

Examiner Intelligence

Grants 73% — above average
73%
Career Allow Rate
43 granted / 59 resolved
+12.9% vs TC avg
Strong +26% interview lift
Without
With
+26.2%
Interview Lift
resolved cases with interview
Typical timeline
2y 10m
Avg Prosecution
34 currently pending
Career history
93
Total Applications
across all art units

Statute-Specific Performance

§101
8.8%
-31.2% vs TC avg
§103
27.2%
-12.8% vs TC avg
§102
16.2%
-23.8% vs TC avg
§112
42.0%
+2.0% vs TC avg
Black line = Tech Center average estimate • Based on career data from 59 resolved cases

Office Action

§102 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restriction Applicant's election with traverse of Group I (claims 1-8 and 15) in the reply filed on 12/29/2025 is acknowledged. The traversal is on the ground(s) that the International Search Authority found that claims 1-15 contain unity. It is noted that the United States Patent Office is not beholden to the decisions of the International Search Authority. The United States Patent Office has its own set of laws, statutes, and policies that govern the decision-making process for an application submitted at the USPTO. This Office action is still deemed proper and is therefore made FINAL. Status of Claims Claims 1-15 are pending. Claims 9-14 have been withdrawn for being directed to a non-elected invention(s). Claims 1-8 and 15 are examined in this Office action. Information Disclosure Statement Initialed and dated copy of Applicant’s information disclosure statements (IDS) filed on 10/01/2024 and 05/29/2025 are attached to the instant Office Action. The submissions are in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statements are being considered by the examiner. Specification The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code (at least at page 21, line 4; page 38, line 35; page 53, lines 4, 8, 10, 12, 13, and 14). Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01. Claim Objections Claim 1 is objected to because of the following informalities: the full name of the PUB17 protein should be written out the first time it is used in a claim. Claim 7 is objected to because claim 1, from which claim 7 depends, does not require the tomato plant or plant material to comprise a modified PUB17 allele; thus, the plant part of claim 7 is not required to comprise a modified PUB17 allele. Additionally, the definition of “plant part” provided in the instant Specification (page 23, lines 25-32) includes plant parts that would not comprise the modified PUB17 allele, such as an embryo. Appropriate correction is required. Claim Interpretation Instant sequence SEQ ID NO: 1 will be interpreted as the Solanum lycopersicum wild-type PUB17 allele which encodes instant sequence SEQ ID NO: 3, the wild-type PUB17 protein. Instant sequence SEQ ID NO: 2 will be interpreted as the MicroTom modified PUB17 allele with an A→T SNP at position 1477 of the coding region of the SlPUB17 allele, which encodes instant sequence SEQ ID NO: 4, the MicroTom modified PUB17 protein. Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Indefiniteness Claims 1, 4, 5, 6, and 15 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. All dependent claims are included in these rejections unless they include a limitation that overcomes the deficiencies of the parent claim. Claim 1 is rendered indefinite by the use of the term “PUB17”. Without a SEQ ID NO identifier, it is unclear what is meant by “PUB17”. Is it the endogenous SlPUB17? If so, how can it encompass an orthologue or homologue of SlPUB17 (SEQ ID NO: 1) as required by claim 4?. Or does “PUB17” broadly encompass all PUB17 proteins and orthologues and homologues thereof in the entire plant Kingdom? In regard to claim 4, it is unclear if the “70% identity” limitation applies to SEQ ID NO: 1 as well as orthologues/homologues of SEQ ID NO: 1, or if the “70% identity” limitation applies only to SEQ ID NO: 1. Claims 4 and 6 are also rendered indefinite by the use of parentheses around the terms (wild type PUB17 allele) and (wild type allele), respectively. The use of parentheses makes it unclear if (wild type PUB17 allele) or (wild type allele) is a requirement of the claim. Additionally, the terms (wild type PUB17 allele) and (wild type allele) encompass a different scope than does the term “SEQ ID NO: 1”. SEQ ID NO: 1 specifically identifies the SlPUB17 wild-type allele, whereas (wild type PUB17 allele) and (wild type allele) encompass all (wild type PUB17 allele) and (wild type allele) in the entire plant Kingdom. In regard to claims 5, 6, and 15, the term "preferably" renders the claims indefinite because it is unclear whether the limitation(s) following the term are part of the claimed invention. See MPEP § 2173.05(d). Written Description Claims 1-4, 7-8, and 15 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. All dependent claims are included in these rejections unless they include a limitation that overcomes the deficiencies of the parent claim. Claim 1 recites “[a] tomato plant or plant material having reduced level, activity, or expression of a Pub 17 protein conferring an increased resistance to a lesion-forming pathogen relative to a reference tomato plant or plant material”. Applicant has claimed an extremely large genus of all PUB17 proteins having reduced level, activity, or expression conferring an increased resistance to all lesion-forming pathogens. The instant Specification states that the “tomato plant or plant material may be transgenic or non-transgenic” (page 26, lines 33-34), and claim 1 does not require an endogenous PUB17 protein. Therefore, the recitation of “a PUB17 protein” in claim 1 is inclusive of all PUB17 proteins in the entire plant Kingdom. Karthik (Karthik et al., 2025, Plant and Cell Physiology, Vol. 66(8), pp. 1123-1136) describes that the PUB E3 ligase gene family has evolved significantly, leading to their considerable structural and functional diversity. PUB gene family has 64 members in Arabidopsis, 190 in B. napus, 74 in S. tuberosum, 77 in O. sativa, 67 in H. vulgare, and 64 in Medicago trunculata. In polyploid species, the number of PUBs increases significantly, with 213 in T. aestivum and 582 in Gossypium hirsutum. This diversity suggests the potential functional roles of the PUBs in growth and development and stress responses (Karthik, page 1133, Conclusions and Future Prospects, first paragraph). Thus, “a PUB17 protein” encompasses an extremely broad genus of PUB17 proteins. Furthermore, the instant Specification states that the lesion-forming pathogen is a fungus, virus, or oomycete, which encompasses numerous species from several genera as listed on pages 35-36. It is noted that at the time of filing the Applicant had only reduced to practice the reduced expression of the PUB17 protein of Solanum lycopersicum (instant sequence SEQ ID NO: 3 which is encoded by instant sequence SEQ ID NO: 1), which conferred resistance to the lesion-forming pathogens Botrytis cinerea and Alternaria solani. The instant Specification does not disclose the SlPUB17 allele (instant sequence SEQ ID NO: 1) increasing resistance to any lesion-forming pathogens other than Botrytis cinerea and Alternaria solani. A Written Description rejection is based on what the Applicant was in possession of at the time of filing. Applicant tested one PUB17 allele, SlPUB17 (instant sequence SEQ ID NO: 1), which when expression is reduced, increased resistance to Botrytis cinerea and Alternaria solani. Additionally, claim 4 recites “wherein the modified Pub17 allele comprises at least 70% identity with SEQ ID NO:1 (wild type Pub17 allele) or an orthologue or homologue thereof”. Applicants have identified a mutation, an A→T SNP at position 1477 of the coding region of the SlPUB17 allele (instant sequence SEQ ID NO: 2), which results in a premature stop codon R493* (Specification, page 51, lines 35-36). Instant sequence SEQ ID NO: 1 consists of 2175 nucleotides. Altering up to 30% of those nucleotides would allow for 652 substitutions, and therefore the genus of nucleotides encompassed by this is 4652 . Claim 4 encompasses an extremely large genus of molecules, and the Applicant was only in possession of one (modified PUB17 allele, instant sequence SEQ ID NO: 2) which was reduced to practice. Applicant has described one sequence, instant sequence SEQ ID NO: 2, which shares 99.9% sequence identity with instant sequence SEQ ID NO: 1, capable of increasing resistance to the lesion-forming pathogens Botrytis cinerea and Alternaria solani. Furthermore, the instant Specification does not describe any orthologue or homologue of instant sequence SEQ ID NO: 1 which, when expression is reduced, is capable of increasing resistance to any lesion-forming pathogen. Yee (Yee et al., 2009, Journal of Experimental Botany, Vol. 60(4), pp. 1109-1121) describes the Arabidopsis thaliana PUB protein with the highest sequence homology to BnARC1 is AtPUB17. However, AtPUB17 does not appear to be a functional orthologue, given that Arabidopsis thaliana is a self-compatible plant and that AtPUB17 is much more broadly expressed. Arabidopsis plants with AtPUB17 knocked out have shown phenotypes that are unrelated to plant reproduction (Yee, page 1112, left column, first full paragraph). Applicant has not reduced to practice any functional orthologue or homologue of instant sequence SEQ ID NO: 1 which, when expression is reduced, is capable of increasing resistance to a lesion-forming pathogen. Given that there have not been an adequate number of species reduced to practice to be representative of the broad genus of all PUB17 alleles and encoded PUB17 proteins, all modified Pub17 alleles comprising at least 70% identity with SEQ ID NO:1 (wild type Pub17 allele), any orthologue or homologue of SEQ ID NO:1 (wild type Pub17 allele), and all lesion-forming pathogens, there is not an adequate description to support the breadth of the claim. Claim Rejections - 35 USC § 102/103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 1, 2, 7, 8, and 15 are rejected under 35 U.S.C. 102(a)(1) as anticipated by or, in the alternative, under 35 U.S.C. 103 as obvious over YANG (Yang et al., 2006, The Plant Cell, Vol. 18(4), pp. 1084-1098; see IDS dated 10/01/2024). Claim 1 recites “[a] tomato plant or plant material having reduced level, activity, or expression of a Pub 17 protein conferring an increased resistance to a lesion-forming pathogen relative to a reference tomato plant or plant material”. YANG teaches that Arabidopsis PUB17 is the closest functional homolog of tomato (Lycopersicon esculentum) ACRE276 (Yang, page 1085, right column, first paragraph). YANG further teaches tomato ACRE276 primers TomNtACRE2761 (5’-GAAGAAGCTGCTGGTGCATT-3’) and TomNtACRE2762 (5’-ATACTCTAGCAAGCGATGCT-3’). A GenBank BLAST® search of the primers discloses sequence XM_015211212, Solanum pennellii U-box domain containing protein 17 (tomato PUB17) which shares 100% identity with each of the recited primers (see alignments below) (Yang, page 1096, left column, second paragraph). TomNtACRE2761 ALIGNED WITH XM_015211212 Query 1 GAAGAAGCTGCTGGTGCATT 20 |||||||||||||||||||| Sbjct 2218 GAAGAAGCTGCTGGTGCATT 2237 TomNtACRE2762 ALIGNED WITH XM_015211212 Query 1 ATACTCTAGCAAGCGATGCT 20 |||||||||||||||||||| Sbjct 2503 ATACTCTAGCAAGCGATGCT 2484 YANG teaches tomato plants in which ACRE276 (tomato Pub17) was silenced (i.e., a tomato plant or plant material having reduced level, activity, or expression of a Pub 17 protein) (Yang, page 1087, right column, first full paragraph). Although YANG does not explicitly teach wherein the silenced tomato plants were resistant to lesion-forming pathogens, the instantly claimed property of an increase in resistance to lesion-forming pathogens would be inherent to the compositions taught by YANG. Since all the structural elements recited in the instant claims are taught by YANG, and function follows structure, the instantly claimed function would follow in the silenced tomato plants. Applicants are reminded that the express, implicit, and inherent disclosures of a prior art reference may be relied upon in the rejection of claims under 35 U.S.C. § 102 or § 103. “The inherent teaching of a prior art reference, a question of fact, arises both in the context of anticipation and obviousness.” In re Napier, 55 F.3d 610, 613, 34 USPQ2d 1782, 1784 (Fed. Cir. 1995) (affirmed a 35 U.S.C. § 103 rejection based in part on inherent disclosure in one of the references). See also In re Grasselli, 713 F.2d 731, 739, 218 USPQ 769, 775 (Fed. Cir. 1983). See MPEP § 2112. Applicants are also reminded that prima facie obviousness is not rebutted by merely recognizing additional advantages or latent properties present but not recognized in the prior art. See MPEP § 2145. Mere recognition of latent properties in the prior art does not render nonobvious an otherwise known invention. Id.; In re Wiseman, 596 F.2d 1019, 201 USPQ 658 (CCPA 1979). Indeed, courts have held that “[t]he fact that appellant has recognized another advantage which would flow naturally from following the suggestion of the prior art cannot be the basis for patentability when the differences would otherwise be obvious.” Ex parte Obiaya, 227 USPQ 58, 60 (Bd. Pat. App. & Inter. 1985). In regard to claim 2, YANG teaches silencing of tomato plant cultivar Moneymaker transgenic was done; a 200-bp PCR fragment corresponding to the last three ARM repeats of the tomato ACRE276 was amplified; the PCR products were amplified from tomato cDNA and cloned into SmaI-digested pTRV-RNA2 (i.e., wherein the tomato plant or plant material has been modified to reduce the level, activity, or expression of a PUB17 protein) (Yang, page 1096, left column, second paragraph). In regard to claim 7, YANG teaches tomato silencing experiments using at least five leaves of three different plants (i.e., a plant part obtained from the tomato plant according to claim 1). In regard to claim 8, although YANG does not teach “a seed capable of producing the tomato plant of claim 1”, it would be inherent to the tomato plants taught by YANG to produce seeds capable of producing a tomato plant having a reduced level, activity, or expression of a Pub 17 protein conferring an increased resistance to a lesion-forming pathogen. In regard to claim 15, although YANG does not explicitly teach wherein the silenced tomato plants were resistant to a necrotrophic fungal pathogen, the instantly claimed property of an increase in resistance to a necrotrophic fungal pathogen would be inherent to the compositions taught by YANG. Since all the structural elements recited in the instant claims are taught by YANG, and function follows structure, the instantly claimed function would follow in the silenced tomato plants. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 3-6 are rejected under 35 U.S.C. 103 as being unpatentable over YANG (Yang et al., 2006, The Plant Cell, Vol. 18(4), pp. 1084-1098; see IDS dated 10/01/2024). Claim 3 recites “[a] tomato plant or plant material, wherein the tomato plant or plant material has been modified to reduce the level, activity, or expression of a PUB17 protein”. In regard to claim 3, , YANG teaches silencing of tomato plant cultivar Moneymaker transgenic using virus induced gene silencing (VIGS) (i.e., wherein the tomato plant or plant material comprises a modified PUB17 allele) (Yang, page 1096, left column, second paragraph). It is noted that it is the position of this Office that any gene silencing technique which reduces the level, activity, or expression of a PUB17 protein is rendered obvious by the teachings of YANG. Although YANG does not explicitly teach a modified PUB17 allele, there is no way to distinguish a silenced tomato plant comprising a modified PUB17 allele from a silenced tomato plant comprising a mutation introduced via VIGS, as taught by YANG. At the time the instant application was filed, it would have been obvious and within the scope of one of ordinary skill in the art to modify a tomato PUB17 allele as taught by YANG, by using any technique known in the art for gene silencing. One would have been motivated to follow the teachings of YANG knowing that the PUB17 gene plays an important role in plant defense against pathogens. Thus, one of ordinary skill in the art would have a high expectation of success by following the teachings of YANG. The use of introducing mutations in plant genes to reduce the level, activity, or expression is a technique that was routine in the art at the time the application was filed, as taught by the cited reference and the state of the art in general. In regard to claim 4, YANG teaches that PUB17 can functionally replace the role of ACRE276 (Yang, page 1092, left column, last paragraph). YANG further teaches the Nicotiana tabacum Avr9/Cf-9 rapidly elicited protein 276 (ACRE276), GenBank ACCESSION NO: AY220483, which shares 83.8% sequence identity with instant sequence SEQ ID NO: 1 (see alignment below) (i.e., a modified PUB17 allele comprising at least 70% identity with SEQ ID NO: 1, or an orthologue or homologue thereof). YANG SEQUENCE AY220483 ALIGNED WITH INSTANT SEQUENCE SEQ ID NO: 1 Qy 1 ATGGCATCTGCTGCAATTTTCTCATCGTTGAGAAGACAAAGGTCGCCGACACTGGAAGCG 60 |||||||| ||||||||||||||||||||||| ||||||||||||||| ||||||||||| Db 159 ATGGCATCAGCTGCAATTTTCTCATCGTTGAGGAGACAAAGGTCGCCGTCACTGGAAGCG 218 Qy 61 TTCTTGGCGCCGGTGGATCTGACAGATGTTGGGTTGTTGCAAACTTTAACGGCGTTATCT 120 |||||||||||||||||||| ||||| || ||||||||||||||| |||||||||||||| Db 219 TTCTTGGCGCCGGTGGATCTAACAGAAGTGGGGTTGTTGCAAACTCTAACGGCGTTATCT 278 Qy 121 TCTGAGCTGATTTCTGCATATTCAGGTAAAAGGCTGCCGTTTTATCAGCGGAAGAATTGT 180 ||||||||||||||| ||| ||||||||||||| |||| |||||||||| ||||||||| Db 279 TCTGAGCTGATTTCTTCATTTTCAGGTAAAAGGGTGCCCTTTTATCAGCAAAAGAATTGT 338 Qy 181 AAGTCTTTGTTAAGGAAAATTCAAGTATTTTCTGTTCTCTTGGAGTGTCTTCTTGAGAAT 240 || || ||| | ||||||||||||| |||||||| || || || |||||| ||||||| Db 339 AAATCCTTGCTTAGGAAAATTCAAGCCTTTTCTGTACTTTTAGATTGTCTTGTTGAGAAC 398 Qy 241 AAAAAGAACAGAAGTAGT---------GGTTCTTCAGATTTGCCGTTTACAGCTTTTTTG 291 | | || | || ||| |||||||||||||||||||||||||||||||| Db 399 AGTGACAATAACAGAAGTGGTAGGGGGGGTTCTTCAGATTTGCCGTTTACAGCTTTTTTA 458 Qy 292 TGCTTCAAGGAGTTGTATTTATTGCTTTACCGGTCGAAAATCTTGCTTGATTATTGCTCT 351 |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| Db 459 TGCTTCAAGGAGTTGTATTTATTGCTTTACCGCTCGAAAATCTTGCTTGATTATTGCTCC 518 Qy 352 TATTCAAGTAAGTTGTGGCTGTTGCTACAAAACCATTCGATTTCAGGTCATTTCCATGAT 411 | || |||||||| ||||||||||| ||||||||||||||||| ||||||||||||||| Db 519 CAATCCAGTAAGTTATGGCTGTTGCTTCAAAACCATTCGATTTCGGGTCATTTCCATGAT 578 Qy 412 TTGAACCAAGAAATCTCGACCCTTTTGGATGTTTTCCCCTTAAAGGATTTAAAAAATTTA 471 ||||||||||||||||||||||||||||||||||||||||||||||| || | |||| Db 579 TTGAACCAAGAAATCTCGACCCTTTTGGATGTTTTCCCCTTAAAGGAATT---GACTTTA 635 Qy 472 TCTGAAGATGTTAGGGAACAGGTTGAGTTGTTGAAGAAACAAGCAAGAAAATCTCAGTTG 531 |||||||||||| ||||||||||||||||||| |||||||||||||||||||| |||| Db 636 CCTGAAGATGTTATGGAACAGGTTGAGTTGTTGCAGAAACAAGCAAGAAAATCTATGTTG 695 Qy 532 TTTGTTGATAAATATGATGAGATGCTAAGGTTGAAATTGTTTTCTTTCTTGAATGAGTTT 591 |||||||||||| ||||||||||| | |||||||| |||| |||||||||||||||||| Db 696 TTTGTTGATAAACATGATGAGATGTTGAGGTTGAAGCTGTTCTCTTTCTTGAATGAGTTT 755 Qy 592 GAGAATGGTGGTGTTCCTGACTATGCTCAGTTGTACTCTTTTTTTGTGGAAAAATTGGGG 651 |||||||| ||| |||||| || ||||||||||||||||||||||||||| ||||||| | Db 756 GAGAATGGAGGTATTCCTGGCTCTGCTCAGTTGTACTCTTTTTTTGTGGACAAATTGGTG 815 Qy 652 ATTTGTAATCCTAGGAGTTGCAGAGTTGAGATTGAGTTTTTGGAGGAGCAGATTGTGAAC 711 ||||||||||| |||||||| || ||||||||||| |||||||||||||||||||||||| Db 816 ATTTGTAATCCCAGGAGTTGTAGGGTTGAGATTGAATTTTTGGAGGAGCAGATTGTGAAC 875 Qy 712 CATGAAGGAGATATTGAGCCCACATCCTCAGTTCTCAACGGGTTTGTGGCGTTGATGCGA 771 |||||||||||||||||||||||| ||||||| ||||| ||||||||||||||||| ||| Db 876 CATGAAGGAGATATTGAGCCCACAGCCTCAGTGCTCAATGGGTTTGTGGCGTTGATACGA 935 Qy 772 TACTGCAGGTTTTTGCTATTTGGCTTTGAAGAGGATGATATGGGGTTGAGATTGGGTAAG 831 |||||||||||||||||||||||||| |||||||||||| |||| ||| || | |||||| Db 936 TACTGCAGGTTTTTGCTATTTGGCTTCGAAGAGGATGATGTGGGATTGGGAGTTGGTAAG 995 Qy 832 CATAAGAAGCCGAAGAGAGGGCTGATTAGTCAAGAGATTGCAGAGACATTCATTTCTGTA 891 |||||||||| ||||| |||||||||||||||||||||||| || |||| |||||||||| Db 996 CATAAGAAGCAGAAGAAAGGGCTGATTAGTCAAGAGATTGCGGACACATCCATTTCTGTA 1055 Qy 892 CCAAAGGACTTCTGTTGTCCGATATCGTTGGATTTGATGAGGGATCCAGTTATTGTGGCA 951 ||||||||||| ||||||||||||||||||||||||||||||||||| || |||||| || Db 1056 CCAAAGGACTTTTGTTGTCCGATATCGTTGGATTTGATGAGGGATCCGGTAATTGTGTCA 1115 Qy 952 ACAGGGCAGACATATGATCGAGCTTCTATATCGAGGTGGATGGAGGAGGGTCACTGTACT 1011 |||||||||||||||||| ||||||| |||||||||||||||||||||||||| |||||| Db 1116 ACAGGGCAGACATATGATAGAGCTTCCATATCGAGGTGGATGGAGGAGGGTCATTGTACT 1175 Qy 1012 TGCCCAAAGACAGGGCAGTTGCTTGATCATACCCGGCTTGTGCCAAACAGGGCTCTTAGG 1071 |||||||||||||||||||||||||||||||| |||||||| ||||| ||||| |||||| Db 1176 TGCCCAAAGACAGGGCAGTTGCTTGATCATACTCGGCTTGTCCCAAATAGGGCACTTAGG 1235 Qy 1072 AATTTGATTATGCATTGGTGTGCTGCTCGCAAAATTCCCTATGACCCTCTGGAGAGTGGG 1131 |||||||||||||| ||||||||||||| |||||||| ||||| | ||||| ||||| Db 1236 AATTTGATTATGCAGTGGTGTGCTGCTCATAAAATTCCTTATGATAATATGGAGGGTGGG 1295 Qy 1132 GATCCATGTGTTGAATGTTTTCCATCAGCTTCACCTAGCAGGGCTGCACTAGAAGCTAAT 1191 ||||||||||||||| ||||| | | ||||||||||||| ||| ||| ||||||||||| Db 1296 GATCCATGTGTTGAAAGTTTTGGAGCTGCTTCACCTAGCAAGGCCGCAGTAGAAGCTAAT 1355 Qy 1192 AAAGCCACAGCAGCTCTTCTGATTAAGCAGCTAGAGAGTGGGACGCAGATTGCAAAAACT 1251 | |||||| |||||||||| ||||||||||||| || |||||| ||||||||||||||| Db 1356 AGAGCCACGACAGCTCTTCTCATTAAGCAGCTAGCGAATGGGACACAGATTGCAAAAACT 1415 Qy 1252 ATTGCTGCTCAGGAGATAAGACTTTTAGCTAAAACTGGTAAGGAGAATCGTGCATACATA 1311 |||||||||| ||||||||| || |||||||||||||||||||| || ||||| |||||| Db 1416 ATTGCTGCTCGGGAGATAAGGCTCTTAGCTAAAACTGGTAAGGAAAACCGTGCTTACATA 1475 Qy 1312 GCTGAGGCTGGTGCAATCCCACATTTGAAGAATTTGCTTTCATCTCCAGATGCTGTGGCA 1371 ||||||||||| || ||||| ||||| ||||||||||||||||||||||||||||||||| Db 1476 GCTGAGGCTGGGGCGATCCCGCATTTAAAGAATTTGCTTTCATCTCCAGATGCTGTGGCA 1535 Qy 1372 CAAGAAAATTCCGTCACTGCAATGCTTAACTTATCGATTTTTGATAAGAATAAAGGCCGA 1431 ||||||||||| |||||||||||||| |||||||||||||||||||| |||||||||||| Db 1536 CAAGAAAATTCTGTCACTGCAATGCTGAACTTATCGATTTTTGATAAAAATAAAGGCCGA 1595 Qy 1432 ATTATTGATGAAGTAGGGTGTCTGGCTTTGATAGTTGGAGTTTTGAGATTTGGGCACACC 1491 ||||| || |||||||||||||| | ||| |||| |||||||||| ||||||||||||| Db 1596 ATTATGGACGAAGTAGGGTGTCTAACGTTGGTAGTAGGAGTTTTGATATTTGGGCACACC 1655 Qy 1492 ACAGAGGCACGGGAAAATGCTGCAGCAACATTATTCAGTCTGTCAGCTGTTCATGACTAT 1551 || ||||| ||||||||||||||||||||||| ||||||||||| |||||||||||||| Db 1656 ACGGAGGCGCGGGAAAATGCTGCAGCAACATTGTTCAGTCTGTCTGCTGTTCATGACTAC 1715 Qy 1552 AAGAGGCAAATAGCAAAAGAAGATGGGGCAGTCGAGGCCTTAGCGGGTCTGTTGCGAGAA 1611 |||| ||||||||||||||||||||||||||||||||||||||| |||||| |||||||| Db 1716 AAGAAGCAAATAGCAAAAGAAGATGGGGCAGTCGAGGCCTTAGCAGGTCTGCTGCGAGAA 1775 Qy 1612 GGTTCTCCCAGAGGGAAGAAAGATGCAGTAACTGCTCTATTTAATTTATCCACCCACACA 1671 |||||||| ||||||||||| ||||||||||||||||| ||||||||||| |||||||| Db 1776 GGTTCTCCGAGAGGGAAGAAGGATGCAGTAACTGCTCTCTTTAATTTATCTACCCACACT 1835 Qy 1672 GATAATTGTGCGAGGATGATAGAGTCTGGAGCTGTTACTGCTCTAGTTGGAGCTTTGGGA 1731 || |||||||| ||||||||||||| |||||| ||||||||||||||||||| |||||| Db 1836 GAAAATTGTGCAAGGATGATAGAGTTGGGAGCTATTACTGCTCTAGTTGGAGCATTGGGA 1895 Qy 1732 AGTGAAGGTGTTGCTGAAGAAGCTGCTGGTGCATTGGCGCTGATTGTTAGGCAGCAAGTT 1791 |||||||||||||| |||||||||||||||||||| ||||||||||||||||||| || Db 1896 AGTGAAGGTGTTGCCGAAGAAGCTGCTGGTGCATTAGCGCTGATTGTTAGGCAGCCGATT 1955 Qy 1792 GGTGCTACAGCTGTTGGCAATGAGGAAATGGCAGTAGCAGGGCTCATTGCAATGATGCGA 1851 || ||| |||||||||||||||||||||||||||||||||| || |||| ||||||||| Db 1956 GGCGCTGCAGCTGTTGGCAATGAGGAAATGGCAGTAGCAGGACTTATTGGGATGATGCGA 2015 Qy 1852 TGTGGGACACCAAGAGGGAAGGAGAATGCTGTTGCTGCATTACTTGAATTATGCCGCGGT 1911 || || ||||| |||||||| |||||||| |||||||| || |||||||||||||| ||| Db 2016 TGCGGCACACCTAGAGGGAAAGAGAATGCAGTTGCTGCGTTGCTTGAATTATGCCGTGGT 2075 Qy 1912 GGTGGAGCAGCTGCTACTGAGAGGGTCTTGAAGGCGCCGTCATTAGCAAGTTTACTTCAG 1971 |||||||| |||||||| ||||||||||||||||| || |||||||||||||||||||| Db 2076 GGTGGAGCTGCTGCTACAGAGAGGGTCTTGAAGGCTCCAGCATTAGCAAGTTTACTTCAG 2135 Qy 1972 ACGTTGCTCTTTACAGGAACAAAGCGCGCAAGGAGGAAAGCAGCATCGCTTGCTAGAGTA 2031 || ||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| Db 2136 ACATTGCTCTTTACAGGAACGAAGCGCGCAAGGAGAAAAGCAGCATCGCTTGCTAGAGTA 2195 Qy 2032 TTCCAACGGTGTGAGCATGCAGCAGTTCATTATAGTGGGTTTGGTGTAGGATATGCATTT 2091 || |||||||||||||||||| || | |||||| | ||||| |||||||||||||| ||| Db 2196 TTTCAACGGTGTGAGCATGCATCAATGCATTATGGCGGGTTAGGTGTAGGATATGCTTTT 2255 Qy 2092 GCTGGAAACTCAGCTGCTGCTAGGGATTCAACTTTTCCTGGTGATGTCTCAGTGTCCATG 2151 ||||||||||||||| | | |||||||||||||||| |||||||||||||||| |||||| Db 2256 GCTGGAAACTCAGCTACAGTTAGGGATTCAACTTTTGCTGGTGATGTCTCAGTTTCCATG 2315 Qy 2152 TCCATTTCAGTTCCAGTATTATAG 2175 ||||||||||| ||||| |||||| Db 2316 TCCATTTCAGTACCAGTGTTATAG 2339 In regard to claims 5 and 6, it is noted that it is the position of this Office that any mutation introduced which reduces the level, activity, or expression of a PUB17 protein is rendered obvious by the teachings of YANG. Although YANG does not explicitly teach wherein the mutation is a SNP or wherein the mutation is located in the 3’ region, there is no way to distinguish a tomato plant comprising a SNP mutation or a mutation is located in the 3’ region from a silenced tomato plant comprising a mutation introduced via VIGS, as taught by YANG. Summary No claim is allowed. Correspondence Any inquiry concerning this communication or earlier communications from the examiner should be directed to CHRISTINA MEADOWS whose telephone number is (703)756-1430. The examiner can normally be reached Monday - Friday 9:00 am - 5:00 pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad Abraham can be reached at 571-270-7058. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. CHRISTINA MEADOWS Examiner Art Unit 1663 /CHRISTINA L MEADOWS/Examiner, Art Unit 1663 /Amjad Abraham/SPE, Art Unit 1663
Read full office action

Prosecution Timeline

Oct 01, 2024
Application Filed
Mar 24, 2026
Non-Final Rejection — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12599093
SOYBEAN CULTIVAR 20372402
2y 5m to grant Granted Apr 14, 2026
Patent 12588612
PARTHENOCARPIC WATERMELON PLANTS
2y 5m to grant Granted Mar 31, 2026
Patent 12590317
POLYNUCLEOTIDES AND METHODS FOR TRANSFERRING RESISTANCE TO ASIAN SOYBEAN RUST
2y 5m to grant Granted Mar 31, 2026
Patent 12588613
Wheat Variety G18C2097
2y 5m to grant Granted Mar 31, 2026
Patent 12577579
Cytoplasmic Male-Sterile Rudbeckia Plants and a Method of Production
2y 5m to grant Granted Mar 17, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
73%
Grant Probability
99%
With Interview (+26.2%)
2y 10m
Median Time to Grant
Low
PTA Risk
Based on 59 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month