Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Status of Claims
Claims 1-26 are pending.
Priority
Claims 1-26 are a 371 of PCT/IB 2023/054956 filed on May 13, 2023, which has priority to PRO 63\341,798 filed on May 13, 2022.
Claim Objections
Claim 5 is objected to for the following reasons:
Claim 5 recites “wherein the vector further comprises an miR-142” should read as “wherein the vector further comprises [[an]] a miR-142”.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1, 5-12 and 13-23 are rejected under 35 U.S.C. §102(a)(1) as being anticipated by Choi [US 2020 325454 A1].
Regarding claim 1, Choi teaches a method of treating a retinal disease in a subject in need thereof [¶ 0022, 0021], comprising administering to the subject a pharmaceutically effective amount [¶ 0021, 0107] a recombinant vector comprising an exon 2-deleted AIMP2 variant (AIMP2-DX2) gene [¶ 0010].
Regarding claim 5, Choi teaches the method of claim 1, wherein the vector further comprises an miR-142 target sequence [¶ 0010].
Regarding claim 6, Choi teaches the method of claim 1, wherein the vector further comprises a promoter operably linked to the AIMP2-DX2 [¶ 0011].
Regarding claim 7, Choi teaches the method of claim 6, wherein the promoter is a retrovirus (LTR) promoter, cytomegalovirus (CMV) promoter, Rous sarcoma virus (RSV) promoter, MT promoter, EF-1 alpha promoter, UB6 promoter, chicken beta-actin promoter, CAG promoter, RPE65 promoter, Synapsin promoter, MECP2 promoter, CaMKII promoter, Hb9 promoter, or opsin promoter [¶ 0011].
Regarding claim 8, Choi teaches the method of claim 5, wherein the miR-142 target sequence is 3’ to the AIMP2-DX2 gene [Fig. 1, ¶ 0012].
Regarding claim 9, Choi teaches the method of claim 1, wherein the AIMP2-DX2 gene comprises a nucleotide sequence encoding an amino acid sequence that is at least 90% identical to SEQ ID NO: 2 [¶ 0049].
Regarding claim 10, Choi teaches the method of claim 9, wherein the AIMP-DX2 gene comprises a nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 2 [¶ 0049].
Regarding claim 11, Choi teaches the method of claim 1, wherein the AIMP2-DX2 gene does not have an exon comprising a nucleotide sequence encoding an amino acid sequence that is at least 90% identical to SEQ ID NO: 10 or 11 [¶ 0029].
Regarding claim 12, Choi teaches the method of claim 1, wherein the AIMP2-DX2 gene does not have an exon comprising a nucleotide sequence encoding an amino acid sequence of SEQ ID NO: 10 or 11 [¶ 0029].
Regarding claim 13, Choi teaches the method of claim 5, wherein the miR-142 target sequence comprises ACACTA [¶ 0015].
Regarding claim 14, Choi teaches the method of claim 5, wherein the miR-142 target sequence comprises ACACTA and 1-17 additional contiguous nucleotides of SEQ ID NO: 5 [¶ 0015].
Regarding claim 15, Choi teaches the method of claim 5, wherein the miR-142 target sequence comprises a nucleotide sequence at least 50% identical toa nucleotide sequence of SEQ ID NO: 5 (TCCATAAAGTAGGAAACACTACA) [¶ 0016].
Regarding claim 16, Choi teaches the method of claim 15, wherein the miR-142 target sequence comprises a nucleotide sequence of SEQ ID NO: 5 [¶ 0016].
Regarding claim 17, Choi teaches the method of claim 5, wherein the miR-142 target sequence comprises ACTTTA [¶ 0017].
Regarding claim 18, Choi teaches the method of claim 5, wherein the miR-142 target sequence comprises ACTTTA and 1-15 additional contiguous nucleotides of SEQ ID NO: 7 [¶ 0017].
Regarding claim 19, Choi teaches the method of claim 5, wherein the miR-142 target sequence comprises a nucleotide sequence at least 50% identical to a nucleotide sequence of SEQ ID NO: 7 (AGTAGTGCTTTCTACTTTATG) [¶ 0018].
Regarding claim 20, Choi teaches the method of claim 19, wherein the miR-142 target sequence comprises a nucleotide sequence of SEQ ID NO: 7 [¶ 0018].
Regarding claim 21, Choi teaches the method of claim 5, wherein the miR-142 target sequence is repeated 2-10 times [¶ 0020].
Regarding claim 22, Choi teaches the method of claim 1, wherein the vector is a viral vector [¶ 0020].
Regarding claim 23, Choi teaches the method of claim 22, wherein the viral vector is an adenovirus, adeno-associated virus, lentivirus, retrovirus, human immunodeficiency virus (HIV), murine leukemia virus (MLV), avian sarcoma/leukosis (ASLV), spleen necrosis virus (SNV), Rous sarcoma virus (RSV), mouse mammary tumor virus (MMTV), vaccinia virus, or Herpes simplex virus vector [¶ 0020].
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 2-4 and 24-26 are rejected under 35 U.S.C. §103 as being unpatentable over Choi [US 2020 325454 A1], in view of Chiu et al. [An update on gene therapy for inherited retinal dystrophy: experience in Leber congenital amaurosis clinical trials, Int J Mol Sci., 2021], in view of Strong et al. [Prospective exploratory study to assess the safety and efficacy of aflibercept in cystoid macular oedema associated with retinitis pigmentosa, British Journal of Ophthalmology, 2019], in view of Mendell et al. [Five-year extension results of the phase 1 START trial of onasemnogene abeparvovec in spinal muscular atrophy, JAMA Neurology, 2021].
Choi teaches every element of claim 1. However, for claim 2, Choi does not specifically teach the retinal degenerative disease is retinitis pigmentosa, Leber’s congenital amaurosis, Cone-rod dystrophy, glaucoma, or diabetic retinopathy. Although, Choi does identify retinal degeneration in general as being capable of being treated using the claimed invention by administering a recombinant vector comprising an exon 2-deleted AIMP2 variant. For the specific Markush listing in claim 2, Chiu et al. teaches that inherited retinal dystrophies, included Leber congenital amaurosis, are retinal degenerative diseases where recombinant viral vector gene therapy is known therapeutic approach [Abstract]. This includes certain viral vector gene therapies that have been FDA approved such as voretigene neparvovec-rzyl which is an adeno-associated virus vector for use in treating biallelic RPE65 mutation-associated Leber Congenital Amaurosis [Id.]. Based on this, it would have been prima facie obvious to a person of ordinary skill in the art prior to the filing of the claimed invention to modify the systems and methods of Choi that discloses an exon 2-deleted AIMP2 recombinant vector variant used in treating retinal degeneration with the teachings of Chiu et al. that teaches that it is feasible to treat inherited retinal dystrophies, i.e. Leber Congenital Amaurosis, using such viral vector gene therapies. Here, there would have been a reasonable expectation of success to take an existing viral vector therapeutic treatment of Choi which is already capable of treating retinal degeneration in general and apply it to inherited retinal dystrophies given that Chiu et al. discloses that such inherited retinal dystrophies are capable of treating such diseases, and furthermore, both references address treatment of retinal degeneration using recombinant gene therapy and would have constituted an application of a known therapeutic agent to a known retinal degenerative disease.
With respect to claim 3 where retinal degeneration precedes or is accompanied by such diseases as Parkinson’s disease or Alzheimer’s, as well as others, Chiu et al. discloses that Leber’s Congenital Amaurosis is a rare inherited retinal degenerative disease with a prevalence of 1/30,000 to 1/81,000 newborn babies and that the disease comprises a genetically heterogenous group of mainly autosomal-recessive retinopathies beginning in infancy and childhood with at least 21 mutated genes and over 400 mutations known [3.1 Clinical characteristics and genetics]. Additionally, Choi teaches that the recombinant viral vector containing the exon 2-deleted AIMP2 can be used in the treatment of such neurodegenerative diseases, e.g. Alzheimer’s disease and Parkinson’s disease [¶ 0022], and given that Choi et al. already teaches the administration of recombinant viral vector for purposes of treating neurodegenerative diseases that include retinal degeneration with Chui et al. disclosing that Leber’s Congenital Amaurosis is an early onset disease typically diagnosed in early childhood, a person of ordinary skill would understand that certain retinal diseases necessarily manifest substantially before the typical clinical onset of Parkinson’s disease or Alzheimer’s disease.
For claim 4 where the retinal degenerative disease is not age-related macular disease, Chiu et al. establishes that recombinant gene therapy was an established therapeutic approach for inherited retinal degeneration diseases that included Leber’s Congenital Amaurosis [Abstract] and describes such diseases as early onset, a person of ordinary skill would understand that the combination of Chiu et al., along with Choi, to administer the recombinant viral vector containing the exon 2-deleted AIMP2 gene to non-age related macular degeneration diseases given the Chiu et al. teaches the use of such therapies for early-onset disease processes that are non-age related.
For claim 24 where the recombinant vector can be administered intravitreal injection or into the subretinal space of the subject, Chiu et al. teaches that the eye is naturally small and easily approachable with intravitreal and subretinal injections [2.2 Retina, the ideal playground for gene therapy]. Here, it would have been prima facie obvious to person of ordinary skill in the art prior to the filing of the claimed invention to modify the systems and methods of Choi that discloses a recombinant viral vector gene therapy that contains an exon 2-deleted AIMP2 gene that can be used in retinal degeneration treatment with the further teachings of Chui et al. that discloses that eye is an ideal candidate for gene therapy given its accessibility with both intravitreal and subretinal injections. Based on this, there is a reasonable expectation of success that a person of ordinary skill would recognize the teachings of Chiu et al. and apply them to the teachings of Choi where the recombinant viral vector gene therapy could be directly administered into the eye via certain injection routes based on the eye being accessible.
Regarding claim 25 where an additional therapeutic agent is administered, Mendell et al. discloses that gene therapy can be sequentially administered along with another therapeutic, i.e. nusinersen [Efficacy ¶ 4].
Regarding claim 26 where the additional therapeutic agent is ranibizumab, aflibercept, or bevacizumab, Strong et al. discloses the use of aflibercept being administered in cystoid oedema associated with retinitis pigmentosa [Abstract]. Additionally, Strong et al. further teaches that several publications have observed variable effects of anti-VEGFs in retinal pigmentosa [Introduction ¶ 4], and that anti-VEGF is thought to act by reversing proliferation and cell migration stimulated by VEGF and the delocalization of tight junction proteins induced by VEGF165 [Discussion ¶ 3]. Given this, there is a reasonable expectation of success that a person of ordinary skill in the art would combine the teachings of Strong et al. where it discloses the use of anti-VEGFs, including aflibercept, as a therapeutic agent that can be used in treating retinal dystrophies given the mechanism of action where release of VEGF leads to vascular and neuronal apoptosis, as well as neovascularization and elevated vasopermeability where neural apoptosis is associated with several diseases in the Markush listing in claim 2. Therefore, it would have been prima facie obvious to a person of ordinary skill in the art prior to the filing of the claimed invention to administer an additional therapeutic, to include anti-VEGFs, given that Strong et al. discloses that anti-VEGF is thought to act by reversing proliferation and cell migration stimulated by VEGF with the further teachings of Choi that discloses a recombinant viral vector gene therapy directed to neuronal cell death where the AIMP2-DX2 directly competes with AIMP2 as a binding partner suppressing the pro-apoptotic activity associated with AIMP2.
The Supreme court has acknowledged:
When a work is available in one field of endeavor, design incentives and other market forces can prompt variations of it, either in the same field or a different one. If a person of ordinary skill can implement a predictable varition..103 likely bars its patentability…if a technique has been used to improve one device, and a person of ordinary skill in the art would recognize that it would improve similar devices in the same way, using the technique is obvious unless its actual application is beyond that person’s skill. A court must ask whether the improvement is more than the predictable use of prior-art elements according to their established functions…
…the combination of familiar elements according to known methods is likely to be obvious when it does no more than yield predictable results (see KSR International Co. v. Teleflex Inc., 82 USPQ2d 1385 U.S. 2007) emphasis added.
In KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398 (2007), the Supreme Court reaffirmed "the conclusion that when a patent 'simply arranges old elements with each performing the same function it had been known to perform' and yields no more than one would expect from such an arrangement, the combination is obvious." Id. at 417 (quoting Sakraida v. Ag Pro, Inc., 425 U.S. 273,282 (1976)). The Supreme Court also emphasized a flexible approach to the obviousness question, stating that the analysis under 35 U.S.C. § 103 "need not seek out precise teachings directed to the specific subject matter of the challenged claim, for a court can take account of the inferences and creative steps that a person of ordinary skill in the art would employ." Id. at 418; see also id. at 421 ("A person of ordinary skill is... a person of ordinary creativity, not an automaton.").
From the teachings of the references, it is apparent that one of ordinary skill in the art would have had a reasonable expectation of success in producing the claimed invention. Therefore, the invention as a whole was prima facie obvious to one of ordinary skill in the art at the time the invention was made, as evidenced by the references, especially in the absence of evidence to the contrary.
Conclusion
No claims allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JOHN DAVID MOORE whose telephone number is (703)756-1887. The examiner can normally be reached M-F 8-5.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Tracy Vivlemore can be reached on 571-272-2914. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JOHN DAVID MOORE/Examiner, Art Unit 1638
/JAMES D SCHULTZ/Supervisory Patent Examiner, Art Unit 1631