DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Restriction/Election
In response to the communication received on May 4th, 2026, from Seiko Okada, the election of Group II, claims 7-8, 10-13, 16, 18-19, and 21-22, without traversal, is acknowledged. Applicants have further added a new claim, claim 32, which is directed to Group II.
Priority
Applicant’s claim for the benefit of a prior-filed application no. GB2206107.1 filed April 27th, 2022, and PCT/GB2023/051109 filed April 26th, 2023, under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged.
Thus, the earliest possible priority for the instant application is April 27th, 2022.
Information Disclosure Statement
The information disclosure statements (IDSs) submitted on October 24th, 2024 and May 5th, 2025 were considered, initialed, and attached hereto. A signed copy of the list of references cited is included with this Office Action.
Status of Claims
Claims 1, 3, 5, 7-8, 10-13, 16, 18-19, 21-23, 27-29, and 31-32 filed May 4th, 2026 are pending.
Claims 1, 3, 5, 23, 27-29, and 31 are withdrawn under the restriction requirement.
Claims 7-8, 10-13, 16, 18-19, 21-22, and 32 are examined herein.
Claim Objections
In claims 7, and 8, 10-13, 16, 18-19, 21-22, and 32 depending therefrom, “TSNA” is used as abbreviation. It is suggested to insert a definition for TSNA without bringing in new matter, immediately before the first appearance of “TSNA” in claim 7; and to enclose the appearance of “TSNA” in parentheses (in claim 7 only).
In claims 7, and 8, 10-13, 16, 18-19, 21-22, and 32 depending therefrom, “YIPF” is used as abbreviation. It is suggested to insert a definition for YIPF without bringing in new matter, immediately before the first appearance of “YIPF” in claim 7; and to enclose the appearance of “YIPF” in parentheses (in claim 7 only).
In claim 10, and claim 11 depending therefrom, “PON” is used as abbreviation. It is suggested to insert a definition for PON without bringing in new matter, immediately before the first appearance of “PON” in claim 10; and to enclose the appearance of “PON” in parentheses (in claim 10 only).
Claim 32 recites “a tobacco plant or part thereof or a tobacco cell or cell culture according to claim 7, wherein the YIPF-related protein: a) comprising an amino acid sequence as set out in SEQ ID No. 3; or a functional variant or functional fragment or orthologue of SEQ ID No. 3; or a sequence which has at least 80% identity to SEQ ID No. 3; or a homologue of SEQ ID No. 3; or b) encoded by a nucleotide sequence as set out in SEQ ID No. 1 or 2; or a functional variant or functional fragment or orthologue of SEQ ID No. 1 or 2; or a nucleic acid sequence which has at least 80% identity to SEQ ID No. 1 or 2; or a homologue of SEQ ID No. 1 or 2 has been modified.”
It is suggested to amend “comprising” to “comprises”, and “encoded” to “is encoded”.
Appropriate correction is required.
Claim Interpretation
The term “YIPF-related protein” is recited in claim 7 (and claims 8, 10-13, 16, 18-19, 21-22, and 32 depending therefrom). The instant specification states that the term “YIPF-related protein” herein refers to a protein which comprises a YPT/RAB GTPase Interacting Protein domain. Suitably, the YIPF-related protein comprises a YIP1 domain. The instant specification states that an illustrative sequence of a YIPF-related protein from tobacco is shown in SEQ ID No. 3. Amino acids 112-269 of SEQ ID No. 3 relate to a YIP1 domain [pg. 10, lns. 30-35]. Thus, “YIPF-related protein” is taken to mean any protein that comprises a YPT/RAB GTPase Interacting Protein domain and a YIP1 domain.
The term "modifying" or "modified" recited in claim 7 (and claims 8, 10-13, 16, 18-19, 21-22, and 32 depending therefrom) as used herein means a plant (e.g. a tobacco plant) or nucleic acid sequence that has been altered or changed by any means, including naturally, as defined in the instant disclosure [pg. 19, lns. 13-15].
The term “unmodified plant” as recited in claim 7 (and claims 8, 10-13, 16, 18-19, 21-22, and 32 depending therefrom) is defined as a plant which has not been modified according to the present invention in which all relevant features are the same, as defined in the instant disclosure [pg. 10, lns. 19-27].
The term “plant propagation material” as recited in claim 8 is taken to mean any plant matter taken from a plant from which further plants may be produced. This may be a seed, plant calli or plant clumps, as defined in the specification [pg. 41, lns. 30-35].
The term “processed” or “processing” as recited in claims 18-19 refers to a tobacco leaf that has undergone one or more processing steps to which tobacco is subjected to in the art, as defined in the specification [pg. 45, lns. 8-10].
Claim Rejections – 35 USC § 112(a)
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Written Description
Claims 7-8, 10-13, 16, 18-19, 21-22, and 32 are rejected under 35 USC § U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The claims are broadly drawn to a tobacco plant or any part thereof having been modified in any way to modulate or decrease the activity or expression of a YIPF-related peptide and comprising decreased alkaloid and/or TSNA precursor content as compared to an unmodified plant.
Applicant describes:
Virus-induced gene silencing (VIGS) of Nitab4.5_0005388g0090.2 (which has the genomic sequence of SEQ ID NO: 1, the coding sequence of SEQ ID NO: 2, and the amino acid sequence of SEQ ID NO: 3), using a 300-nucleotide cDNA fragment of Nitab4.5_0005388g0090.2 (SEQ ID NO: 16). The TRV VIGS vector comprised both TRV RNA1 (SEQ ID NO: 15) and TRV RNA2 propagated into A. tumefaciens [Example 1].
VIGS of Nitab4.5_0005388g0090.2 causing a significant reduction in nicotine within a Nicotiana plant as compared to an unmodified control plant [Example 1; Fig. 1].
Applicant does not describe:
Decreased content of any alkaloids or TSNA precursors other than nicotine.
Modification of the activity or expression of any YIPF-related peptide with at least 80% identity to SEQ ID NO: 1-3, or a functional variants, fragments or orthologues thereof, other than SEQ ID NOs: 1-3.
Decreased activity of a YIPF-related peptide.
Modification of any kind to decrease the activity or expression of a YIPF-related peptide, other than VIGS.
Any plant propagation material obtained from the tobacco plant comprising decreased activity or expression of a YIPF-related peptide from the heritable modification.
Any plant part with decreased YIPF-related peptide activity or expression and decreased alkaloid and/or TSNA precursor content, other than tobacco leaves.
Alkaloids are a vast genus of molecules found primarily as secondary metabolites in plants. However, several other types of alkaloids are known to be produced by other organisms, such as animals, fungi and bacteria, and some alkaloids are specific to certain plants. For example, Papaver somniferum (opium poppy) is known for producing unique benzylisoquinoline alkaloids, mainly morphine, codeine, and thebaine, which are not produced by tobacco plants (Beaudoin, G. et al., 2014, “Benzylisoquinoline alkaloid biosynthesis in opium poppy”, Planta, 240(1):19-32, doi: 10.1007/s00425-014-2056-8).
The instant claims recite decreased alkaloid and/or TSNA precursor content in comparison to an unmodified plant (which is taken to mean a control tobacco plant under the same conditions as the modified plant, see claim interpretation). With the VIGS modification of Example 1, the instant disclosure describes silencing of Nitab4.5_0005388g0090.2. The results of the relative content of pyridine alkaloids were determined by LC-MS/MS, for analytes nicotine, nicotine d4, anabasine, anatabine, nornicotine, nornicotine d4, PON, and PON d4 [pg. 70]. Alkaloid content of 5-week-old tobacco leaves silenced for Nitab4.5_0005388g0090.2 is shown in Fig. 1. Although the Applicant claims that VIGS of Nitab4.5_0005388g0090.2 leads to a decrease in alkaloid content in leaves, in particular a decrease in nicotine, anabasine, and PON, Fig.1 shows that only the reduction in nicotine content was statistically significant.
Given the limited description in the instant specification of only Nicotiana plants and the alkaloids present in tobacco, a skilled artisan would not have reasonably recognized Applicant to be in possession of the full metes and bounds of the claims at the time the application was filed.
Modifications, including mutations, insertions, deletions, and/or substitutions, can have varying
effects on gene expression. Ge, F. et al. (2024, “Review of Computational Methods and Database Sources
for Predicting the Effects of Coding Frameshift Small Insertion and Deletion Variations,” ACS
Publications, 9:2032-2047) teaches, for example, silent mutations may not change the protein structure and thus do not result in increased gene expression, while others, such as frameshift mutations, can cause
a premature stop codon resulting in a truncated protein that is not functional [pg. 2032, col. 1, ¶1]. Aboud, M. et al. (Genetics, Epigenetic Mechanism. [Updated 2023 Aug 14]. In: StatPearls [Internet]. Treasure Island (FL): StatPearls Publishing; 2026 Jan-. Available from: https://www.ncbi.nlm.nih.gov/ books/NBK532999/) teaches that modifications to alter gene expression or activity includes epigenetic changes through alterations in the chromosome, rather than the DNA sequence, regulating gene expression through chemical modifications [pg. 1, ¶1-2].
Modification may refer to the alteration of the peptide or gene encoding the peptide by any means, including merely natural modifications, such as a reaction to abiotic or biotic stress. Such modifications may or may not result in a decrease in activity or expression of a YIPF-related peptide, however, there is not sufficient structure to indicate that any modification would result in the function of decreasing activity or expression of a YIPF-related peptide in a reliable and predictable manner. As the Applicant only provides the one, specific example of the VIGS technique, which is a small species in the large genus of “modification”, any methodology of modification is not reduced to practice. The instant disclosure lacks sufficient variety of species to reflect the variance within the genus of modification.
VIGS can serve as an alternative to mutant collections or stable transgenic plants to allow the characterization of gene functions in a wide range of angiosperm species, but is a transient method of genetic transformation (Lange, M, et al. 2013, “Virus-Induced Gene Silencing (VIGS) in Plants: An Overview of Target Species and the Virus-Derived Vector Systems”, In: Becker, A. (eds) Virus-Induced Gene Silencing. Methods in Molecular Biology, vol 975. Humana Press, Totowa, NJ. https://doi.org/10.1007/978-1-62703-278-0_1) [Abstract]. With only a few exceptions, the targeted gene silencing will not be transferred to subsequent generations [pg. 10, ¶4]. These limitations require experiments for each new species or specific tissue targeted, and the optimal time point and location of infection have to be determined experimentally. Gene silencing may only be successful when the consequences of the target gene VIGS (i.e., decreased activity or expression of a YIPF-related peptide comprising decreased alkaloid and/or TSNA precursor content) do not exceed the stability of the VIGS vector. The Applicant has not reduced to practice VIGS in any tissue other than leaves. The Applicant has not provided any examples of a plant, plant propagation material, or any sort of processed leaf or product produced from the tobacco leaves with the VIGS modification. As VIGS is known to be transient and no examples of a plant grown from the tobacco plant with the modification with decreased activity or expression of a YIPF-related peptide or decreased alkaloid content are reduced to practice, the Applicant has not sufficiently linked the structure to the function.
As in the claim interpretation, “YIPF-related peptide” covers a large range of evolutionarily related short sequences of amino acids exhibiting similarity in sequence, structure, or function. The instant disclosure provides a singular example of VIGS of Nitab4.5_0005388g0090.2 purportedly reducing alkaloid content in leaves [Example 1]. The VIGS construct uses a 300-nucleotide cDNA fragment of Nitab4.5_0005388g0090.2 [pg. 66, lns. 5-11]. The results show a significant decrease in nicotine only [Fig. 1]. Homologue testing in Example 2 simply states that the effects of the homologues of SEQ ID NO: 3, namely those listed in Table 1, are tested in assays as described in the above example. Table 1 provides only three homologues and does not display any data describing the influence of VIGS on the genes or further on alkaloid and/or TSNA precursor content.
The recitation of YIPF-related peptide is defined in the specification as comprising a YPT/RAB GTPase Interacting Protein domain and a YIP1 domain. YPT/RAB GTPases are key regulators of all membrane trafficking events in eukaryotic cells, acting as molecular switches to indirectly mediate vesicular transport (Lipatova, Z. et al. 2015. “Ypt/Rab GTPases: principles learned from yeast.” Crit Rev Biochem Mol Biol. 50(3):203-11. doi: 10.3109/10409238.2015.1014023) [Abstract]. YPT/RAB GTPases are found in all eukaryotes ranging from yeast to humans. Human cells alone have more than 60 Rab GTPases that are localized to distinct membrane compartments (Pfeffer, S. et al. 2004. “Targeting RAB GTPases to distinct membrane compartments.” Nature Publishing Group. 5: 886-896) [pg. 1, col. 1, ¶1].
It appears that the VIGS construct used a tobacco reference genome, Nitab-v4.5 genome, for targeting of the YIPF-related peptide in the instant application, suggesting that modification to decrease any YIPF-related protein would not be applicable in the provided example [Example 1]. A representative number of species was not described to represent the entire genus of decreasing the activity or expression of a YIPF-related peptide given the vastness of the genus. Sufficient structure was not provided of the YIPF-related peptides that may still maintain the same function in the claims.
As is known in the art, fragments of biological sequences can sometimes retain functional properties, but they do not always perform the exact same role as the whole sequence. Dib, L. et al. (2012, “Protein Fragments: Functional and Structural Roles of Their Coevolution Networks,” PloS ONE 7(11): e48124) teaches that fragments along a protein sequence may form functional motifs necessary to the function claimed, without which, the truncated portion may not function [Abstract; pg. 2, col. 1, ¶2]. The Applicant does not provide working examples of a fragment of a sequence or a variant functioning in the method as claimed in claim 32. Due to the functional unpredictability of paralogs, and fragments and variants thereof, and breadth of the potential fragments and variants, undue experimentation would be required to ensure that all variants and fragments of the claimed sequences still maintained the functionality of the sequences.
Therefore, given the lack of written description in the instant disclosure with regard to the structural and functional characteristics of the claimed compositions, Applicant does not appear to have been in possession of the claimed genus at the time this application was filed.
Scope of Enablement
Claims 7-8, 10-13, 16, 18-19, 21-22, and 32 rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for a Nicotiana plant, or leaf, which has been modified to achieve a reduction in nicotine in comparison to an unmodified Nicotiana plant, wherein the modification is VIGS of Nitab4.5_0005388g0090.2, does not reasonably provide enablement for any modification to modulate or decrease activity or expression of a YIPF-related peptide, wherein the plant has decreased content of any alkaloid and/or TSNA precursor in comparison to an unmodified plant, or plant products or propagation material thereof. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make or use the invention commensurate in scope with these claims.
In re Wands lists a number of factors for determining whether or not undue experimentation would be required by one skilled in the art to make and/or use the invention. These factors are: (1) the quantity of experimentation necessary; (2) the amount of direction or guidance presented; (3) the presence or absence of working examples of the invention; (4) the nature of the invention; (5) the state of the prior art; (6) the relative skill of those in the art; (7) the predictability or unpredictability of the art; (8) the breadth of the claim. In re Wands, 858 F.2d 731, 8 USPQ2d 1400 (Fed. Cir. 1988).
Claims 7-8, 10-13, 16, 18-19, 21-22, and 32 are broadly directed to a tobacco plant or part thereof which has been modified by any means to achieve any modulation of a YIPF-related peptide and comprises decreased content of any alkaloid and/or TSNA precursor in comparison to a modified plant, as well as any propagate with decreased YIPF-related peptide activity or expression or decreased alkaloid and/or TSNA precursor content.
Applicant teaches:
Virus-induced gene silencing (VIGS) of Nitab4.5_005388g0090.2 (which has the genomic sequence of SEQ ID NO: 1, the coding sequence of SEQ ID NO: 2, and the amino acid sequence of SEQ ID NO: 3), using a 300-nucleotide cDNA fragment of Nitab4.5_005388g0090.2 (SEQ ID NO: 21). The TRV VIGS vector comprised both TRV RNA1 and TRV RNA2 propagated into A. tumefaciens [Example 1].
VIGS of Nitab4.5_005388g0090.2 causing a significant reduction in nicotine within a Nicotiana plant as compared to an unmodified control plant [Example 1; Fig. 1].
Applicant does not teach:
Decreased content of any alkaloids or TSNA precursors other than nicotine.
Modification of the activity or expression of a YIPF-related peptide with at least 80% identity to SEQ ID NO: 1-3, or a functional variants, fragments or orthologues thereof, other than SEQ ID NOs: 1-3.
Decrease of activity of a YIPF-related peptide.
Modification of any kind to decrease the activity or expression of a YIPF-related peptide, other than VIGS.
Any plant propagation material obtained from the tobacco plant comprising decreased activity or expression of a YIPF-related peptide from the heritable modification.
Any plant part with decreased YIPF-related peptide activity or expression and decreased alkaloid and/or TSNA precursor content, other than tobacco leaves.
While alkaloids are a vast genus of molecules found primarily as secondary metabolites in plants, several other types of alkaloids are known to be produced by other organisms, such as animals, fungi and bacteria, and some alkaloids are specific to certain plants. For example, Papaver somniferum (opium poppy) is known for producing unique benzylisoquinoline alkaloids, mainly morphine, codeine, and thebaine, which are not produced by tobacco plants (Beaudoin, G. et al., 2014, Benzylisoquinoline alkaloid biosynthesis in opium poppy”, Planta, 240(1):19-32, doi: 10.1007/s00425-014-2056-8). The instant disclosure and the instant claims do not set forth structural characteristics essential to the YIPF-related peptide such that one would envision which YIPF-related peptides would or would not decrease the content of any alkaloid or any TSNA precursor. It is additionally unclear if having sequence identity of at least 80% to SEQ ID NOs: 1-3 would provide sufficient structure to result in the same effect of decreasing alkaloid content in a tobacco plant, as posited by the Applicant.
The instant claims are directed to a decrease in activity or expression of a YIPF-related peptide, meaning that any methodology may be used for any decreased in protein activity or gene expression. This may include anything from a natural modification (i.e., herbivory) to a single point mutation in any part of the gene encoding the peptide. The instant specification is only adequately enabled for the use of one technique, VIGS, for decreasing nicotine content. The instant disclosure only teaches VIGS of Nitab4.5_0005388g0090.2, but does not indicate any other variants or fragments of SEQ ID NOs: 1-3 with a similar functionality of decreased alkaloid content. The instant specification merely states that homologues were tested but does not provide any data to support the conclusion that the fragments, variants, orthologues, or sequences with at least 80% identity to SEQ ID NOs: 1-3 would be able to be used in the invention as claimed. One of ordinary skill in the art would not reasonable be able to make or use the invention to the broad scope it is currently claimed.
For example, SEQ ID NO: 3, the amino acid sequence of the YIPF-related peptide is 280 amino acids long. Peptides with at least 80% identity to SEQ ID NO: 3 encompass peptides with up to 56 amino acid substitutions relative to SEQ ID NO: 3. There are a large number of possible substitutions with anywhere from 1 to 56 possible amino acids substituted in any position of the 280-length sequence and any other the other 19 possible amino acids substituted. For the potential amino acid substitutions alone at each of the 56 positions, there would be 1956 possibilities, of which, the Applicant has not provided sufficient working examples or direction. The instant disclosure fails to provide guidance for how to make polypeptides with 80% identity to the listed sequences of claim 3 which have the claimed function.
Additionally, the exemplified species of the genus claim of 80% identity to SEQ ID NOs: 103, are unpredictable. One would not be able to substitute, add or delete portions of the sequence while asserting with certainty that the sequence maintains the function. For example, sites or regions with binding and/or folding activity are critical to the protein’s structure/function relationship and necessitate correct three-dimensional spatial orientation of binding and active sites. Keskin, O. et al. (2005, “Favorable scaffolds: proteins with different sequence, structure and function may associate in similar ways”, Protein Engin. Des. & Selec., 18(1):11-24) further teaches that even proteins with similar structure may have different functions [Abstract]. The instant specification does not teach any variants, fragments or orthologs to the YIPF-related peptide as it only provides a single example of Nitab4.5_0005388g0090.2 VIGS. Nitab4.5_0005388g0090.2 has the amino acid sequence of SEQ ID NO: 3, coding sequence of SEQ ID NO: 2, and genomic sequence of SEQ ID NO: 1. The specification fails to provide guidance for how to make or use nucleotides with 80% identity to the SEQ ID NOs: 1-3 with the same function. The Applicants have not provided working examples or prophetic examples of a representative number of plants carrying the modification with such great variety while maintaining the function.
Lastly, VIGS can serve as an alternative to mutant collections or stable transgenic plants to allow the characterization of gene functions in a wide range of angiosperm species, but is a transient method of genetic transformation (Lange, M, et al. 2013, “Virus-Induced Gene Silencing (VIGS) in Plants: An Overview of Target Species and the Virus-Derived Vector Systems”, In: Becker, A. (eds) Virus-Induced Gene Silencing. Methods in Molecular Biology, vol 975. Humana Press, Totowa, NJ. https://doi.org/10.1007/978-1-62703-278-0_1) [Abstract]. With only a few exceptions, the targeted gene silencing will not be transferred to subsequent generations [pg. 10, ¶4]. These limitations require experiments for each new species or specific tissue targeted, and the optimal time point and location of infection have to be determined experimentally. Gene silencing may only be successful when the consequences of the target gene VIGS (i.e., decreased activity or expression of a YIPF-related peptide comprising decreased alkaloid and/or TSNA precursor content) do not exceed the stability of the VIGS vector.
The Applicant has provided only the working example for VIGS in tobacco leaves, not in any other tissue. The Applicant has not provided any working examples of a plant, plant propagation material, or any sort of processed leaf or product produced from the tobacco leaves with the VIGS modification. As VIGS is known to be transient and no guidance is provided for a plant grown from the tobacco plant with the modification with decreased activity or expression of a YIPF-related peptide or decreased alkaloid content, one would not be reasonably enabled to make or use the invention. It would not be predictable to achieve a plant grown from the tobacco plant, or plant propagation material obtained from the tobacco plant that would maintain the same function as the original tobacco plant because the VIGS modification was likely transient. Although there appear to be a few exceptions to this, significant experimentation would be required to ensure the modification could be passed down or would be effective with any YIPF-related peptide.
Thus, the examples provided by the Applicant do not provide adequate working examples to enable the scope of the invention without undue experimentation. Given the breadth of the claims, the lack of guidance and working examples, the unpredictability in the art, and the state of the art, undue experimentation would be required to make and use the claimed invention, and therefore, the invention is not enabled throughout the broad scope of the claims.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 12-13, 16, 18-19, and 21-22, are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Pramod, S. et al. International Publication No. WO 2021247740 A1, “Compositions and Methods for Producing Tobacco Plants and Products Having Altered Alkaloid Levels,” published 12/09/2021. This rejection is made to the extent that the claims are interpreted to require merely decreased alkaloid and/or TSNA precursor content in comparison to a product or a leaf produced from an unmodified tobacco plant. Thus, the claimed material would be indistinguishable from other tobacco material having been modified to have lower alkaloid and/or TSNA precursor content as it does not require modulated activity or expression of a YIPF-related peptide.
Claim 12 recites a plant or a crop bred or grown from the tobacco plant or part thereof or tobacco cell or cell culture according to claim 7, the plant or the crop comprising decreased alkaloid and/or TSNA precursor content in comparison to a plant or a crop bred or grown from an unmodified tobacco plant or part thereof or an unmodified tobacco cell or cell culture.
Claim 13 recites a product or a leaf produced from the tobacco plant or part thereof or a tobacco cell or cell culture according to claim 7, the product or the leaf comprising decreased alkaloid and/or TSNA precursor content in comparison to a product or a leaf produced from an unmodified tobacco plant or part thereof or an unmodified tobacco cell or cell culture.
Claim 16 recites a harvested leaf or a cut harvested leaf of the tobacco plant according to claim 7, or obtained from a plant propagated from a propagation material obtained from the tobacco plant according to claim 7, the harvested leaf or the cut harvested leaf decreased alkaloid and/or TSNA precursor content in comparison to a harvested leaf or a cut harvested leaf obtained from an unmodified tobacco plant.
Claim 18 recites a processed leaf: obtained by processing the tobacco plant according to claim 7; obtained from a plant or a harvested leaf thereof, wherein the plant was propagated from the plant propagation material obtained from the tobacco plant according to claim 7; or obtained by processing a harvested leaf or a cut harvested leaf of the tobacco plant according to claim 7, the processed leaf comprising decreased alkaloid and/or TSNA precursor content in comparison to a processed leaf obtained by processing an unmodified tobacco plant or a harvested leaf or a cut harvested leaf thereof.
Claim 19 recites the processed leaf according to claim 18, wherein the leaf is processed by curing, fermenting, pasteurizing or a combination thereof, or wherein the leaf is a cut processed leaf
Claim 21 recites cured tobacco material made from the tobacco plant or a part thereof according to claim 7, or a harvested leaf of the tobacco plant according to claim 7, or a processed leaf obtained by processing the tobacco plant or part thereof according to claim 7, the cured tobacco material comprising decreased alkaloid and/or TSNA precursor content in comparison to a cut tobacco material made from an unmodified tobacco plant, a part thereof, a harvested leaf thereof, or a processed leaf thereof.
Claim 22 recites a tobacco blend comprising said cured tobacco material of claim 21.
Pramod teaches compositions and methods for producing tobacco plants and products having altered alkaloid levels [Abstract]. Pramod teaches that a variety of factors affect tobacco alkaloid levels including genotype, environment, fertilization, and agronomic practices [¶5]. Genetic studies using the low alkaloid Burley 21 (LA BU21) lines indicated that two unlinked loci contribute to nicotine levels in the tobacco leaf. Pramod teaches a modified tobacco plant, or part thereof, comprising a genetic modification in a gene and downregulating the expression or activity of the gene [¶9]. Pramod additionally teaches harvesting from low nicotine varieties [¶260], cured tobacco material from the tobacco [claim 12], leaf processing by processes such as fermenting [¶222], and a tobacco blend made from the cured tobacco [¶17] (i.e., a product produced, a harvested leaf, a processed leaf, wherein the leaf is processed by fermenting, cured tobacco material, a tobacco blend).
The products of the instant claims simply require that the plant or the crop comprises modulated or decreased activity or expression of a YIPF-related peptide or decreased alkaloid and/or TSNA precursor content in comparison to a plant or a crop bred or grown from an unmodified tobacco plant or part thereof. Therefore, a plant or crop bred or grown from the plant of claim 7, or products thereof, need not have modulated or decreased activity or expression of a YIPF-related peptide. Thus, there is nothing of record to distinguish the plants and products of claims 12-13, 16, 18-19, 21-22 from those of the prior art, as Pramod teaches decreased alkaloid content in comparison to an unmodified plant.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 7-8, 10-13, 16, 18-19 and 21-22 are rejected under 35 U.S.C. 103 as being unpatentable over Burner, N. et al. 2022. “Editing of A622 genes results in ultra‑low nicotine whole tobacco plants at the expense of dramatically reduced growth and development.” Mol. Breeding. 42(20): 19-29, in view of Gendre, D. et al. 2013. “Trans-Golgi Network Localized ECHIDNA/Ypt Interacting Protein Complex Is Required for the Secretion of Cell Wall Polysaccharides in Arabidopsis.” The Plant Cell. 25:2633-2646 (as cited in IDS filed 10/24/2024).
Claim 7 recites a tobacco plant or part thereof or a tobacco cell or cell culture, having been modified to decrease the activity or expression of a YIPF-related protein, and comprising decreased alkaloid and/or TSNA precursor content in comparison to an unmodified plant or unmodified cell or cell culture.
Claim 8 recites a tobacco plant or part thereof or a tobacco cell or cell culture, having been modified to decrease the activity or expression of a YIPF-related protein, and comprising decreased alkaloid and/or TSNA precursor content in comparison to an unmodified plant or cell or cell culture.
Claim 10 recites the tobacco plant or part thereof or tobacco cell or cell culture according to claim 7, wherein the content of one or more alkaloids selected from nicotine, nornicotine, PON, anabasine, myosmine, and anatabine is decreased.
Claim 11 recites the tobacco plant or part thereof or tobacco cell or tobacco cell culture according to claim 10, wherein the nicotine content is decreased.
Claim 12 recites a plant or a crop bred or grown from the tobacco plant or part thereof or tobacco cell or cell culture according to claim 7, the plant or the crop comprising decreased activity or expression of a YIPF-related protein, or decreased alkaloid and/or TSNA precursor content in comparison to a plant or a crop bred or grown from an unmodified tobacco plant or part thereof or an unmodified tobacco cell or cell culture.
Claim 13 recites a product or a leaf produced from the tobacco plant or part thereof or a tobacco cell or cell culture according to claim 7, the product or the leaf comprising decreased activity or expression of a YIPF-related protein, or decreased alkaloid and/or TSNA precursor content in comparison to a product or a leaf produced from an unmodified tobacco plant or part thereof or an unmodified tobacco cell or cell culture.
Claim 16 recites a harvested leaf or a cut harvested leaf of the tobacco plant according to claim 7, or obtained from a plant propagated from a propagation material obtained from the tobacco plant according to claim 7, the harvested leaf or the cut harvested leaf comprising decreased activity or expression of a YIPF-related protein, or decreased alkaloid and/or TSNA precursor content in comparison to a harvested leaf or a cut harvested leaf obtained from an unmodified tobacco plant.
Claim 18 recites a processed leaf: obtained by processing a harvested leaf or a cut harvested leaf of the tobacco plant according to claim 7, the processed leaf comprising decreased activity or expression of a YIPF- related protein, or decreased alkaloid and/or TSNA precursor content in comparison to a processed leaf obtained by processing an unmodified tobacco plant or a harvested leaf or a cut harvested leaf thereof.
Claim 19 recites the processed leaf according to claim 18, wherein the leaf is processed by curing, fermenting, pasteurising or a combination thereof, or wherein the leaf is a cut processed leaf.
Claim 21 recites cured tobacco material made from the tobacco plant or a part thereof according to claim 7, or a harvested leaf of the tobacco plant according to claim 7, or a processed leaf obtained by processing the tobacco plant or part thereof according to claim 7, the cured tobacco material comprising decreased activity or expression of a YIPF-related protein, or decreased alkaloid and/or TSNA precursor content in comparison to a cured tobacco material made from an unmodified tobacco plant, a part thereof, a harvested leaf thereof, or a processed leaf thereof.
Claim 22 recites a tobacco blend comprising said cured tobacco material of claim 21.
Regarding claims 7 and 10-11, Burner teaches editing of A622 genes present in the Nicotiana tabacum genome that resulted in ultra-low nicotine tobacco plants [Abstract]. Burner teaches that using genetic modifications to reduce nicotine levels in tobacco leaves can aid in abiding by regulation of tobacco products to prevent addiction [Abstract; pg. 19, col. 2, ¶2]. Knowledge of alkaloid synthesis has continued to increased, with reduced expression of genes related to alkaloid biosynthesis achieved by RNAi, conventional mutation or gene editing [pg. 20, col. 1, ¶1]. Burner teaches that, similar to other structural genes involved in nicotine biosynthesis, the expression of A622 genes is largely root-specific [pg. 20, col. 1, ¶2]. Burner teaches that the present study was an effort to determine that combined mutations in gene families further reduces nicotine accumulation over silencing individual genes and that the results provided insight on the roles of various enzymes on tobacco alkaloid synthesis (i.e., a tobacco plant or part thereof or a tobacco cell or cell culture having been modified and comprising decreased alkaloid and/or TSNA precursor content; wherein the content of one or more alkaloids is selected from nicotine is decreased; wherein the nicotine content is decreased) [pg. 20, col. 2, ¶2].
Burner does not teach that the tobacco plant has been modified to decrease the activity or expression of a YIPF-related protein. However, Gendre teaches YPT/RAB GTPase Interacting Protein 4a (YIP4a) and YIP4b in Arabidopsis thaliana localized at the trans-Golgi network (TGN) [Abstract]. Gendre teaches that a TGN subdomain defined by YIP4 in combination with ECHIDNA (ECH) is required for the secretion of pectin and hemicellulose. Gendre teaches double mutant of yip4a yip4b, which displays an elongation deficit (i.e., a plant having been modified to decreased the activity or expression of a YIPF-related protein) [Fig. 2]. The root length reduction and impairment to the hyocotyledon growth was less impaired than the triple mutant, ech yip4a yip4b, suggesting some functionality with the double mutant while having reduced root length [pg. 2635, col. 1, ¶2-3].
Given that Burner teaches that nicotine synthesis-related genes are mainly localized to roots and teaches that attempting the silencing of multiple genes or gene families can help in reducing nicotine content to improve tobacco products; and given that Gendre teaches elongation deficits in root growth, it would have been prima facie obvious to one of ordinary skill in the art at the time of filing to try the mutation of Burner in a tobacco plant, or part thereof, to reduce nicotine content.
One would have reasonable expectation of success in a modification to decreased the expression of YIP4a and YIP4b mutation resulting in a plant with decreased nicotine content because yip4a yip4b as taught by Gendre would inherently reduce root mass and functionality of genes related to nicotine biosynthesis due to the impairment to the root elongation, and thus decreased nicotine content. One would be motivated to try the modification of such genes because it would provide insight into the mechanisms of alkaloid synthesis in tobacco roots, as suggested by Burner.
Regarding claims 8, 12-13, and 16, Burner teaches the generation of genetic materials, including seeds from the double homozygous mutant (i.e., a plant propagation material) [pg. 4, col. 1, ¶3], seedlings grown out from the seeds (i.e., a plant or crop bred or grown from the tobacco plant or part thereof) [pg. 3, col. 1, ¶3], and harvesting of the top leaf from each plant (i.e., a leaf produced from the tobacco plant; a harvested leaf of the tobacco plant) [pg. 4, col. 1, ¶1].
Regarding claims 18, 19 and 21-22, Burner teaches that the top two leaves from each plant were harvested 14 days after topping, treated with ethephon, according to manufacturer’s recommendations, air-cured, and ground to pass through a 1-mm sieve to determine alkaloid profiles (i.e., a processed leaf obtained by processing a harvested leaf or a cut harvested leaf; wherein the leaf is processed by curing; cured tobacco material made from the tobacco plant or part thereof; a tobacco blend comprising said cured tobacco material) [pg. 2, col. 2, ¶2].This is taken to read on claim 22, a tobacco blend comprising said cured tobacco material, as the leaves would be mixed together, inherently creating a tobacco blend comprising said cured tobacco material.
Claim 32 is rejected under 35 U.S.C. 103 as being unpatentable over Burner in view of Gendre, as applied to claims 7-8, 10-13, 16, 18-19, and 21-22 above, and further in view of NCBI Reference Sequence: XM_019389906.1, PREDICTED: Nicotiana attenuata protein YIPF1 homolog (LOC109225290), mRNA, published 12/05/2016.
Claim 32 recites a tobacco plant or part thereof or a tobacco cell or cell culture according to claim 7, wherein the YIPF-related protein is encoded by a nucleic acid sequence which has at least 80% identity to SEQ ID No. 2; or a homologue of SEQ ID No. 2.
Burner in view of Gendre renders obvious a tobacco plant or part thereof or a tobacco cell or cell culture having been modified to decrease the activity or expression of a YIPF-related protein and comprising decreased alkaloid and/or TSNA precursor content in comparison to an unmodified plant or unmodified cell or cell culture. Burner teaches CRISPR/Cas9-based editing to introduce deleterious mutations into two A622 genes in tobacco to observe the impact on nicotine and other related alkaloid contents. Burner teaches that many nicotine synthesis-related genes are in tobacco roots and that observed results provide insights on the roles of various enzymes in tobacco alkaloid biosynthesis, a process that is not completely understood. Although Burner teaches modified tobacco plants with decreased nicotine content, Burner does not teach that the plants have been modified to decrease the activity or expression of a YIPF-related protein.
However, Gendre teaches a yip4a yip4b double mutant that resulted in decreased cell elongation and decreased root length. Given that the synthesis of nicotine and synthesis related genes are within the roots of tobacco, it would be prima facie obvious to one of ordinary skill to modify a tobacco plant with the yip4a yip4b mutant to inherently decrease nicotine synthesis in the roots and to observe the impacts on tobacco alkaloid biosynthesis, as suggested by Burner.
Burner and Gendre do not explicitly teach that the YIPF-related protein is encoded by a nucleotide sequence as set out in SEQ ID NO: 2, a nucleotide sequence that has at least 80% identity to SEQ ID NO: 2 or a homologue of SEQ ID NO: 2. However, a finite number of YIPF-related proteins and homologs thereof were known in the art at the time of filing. For example, PREDICTED: Nicotiana attenuata protein YIPF1 homolog NCBI Reference Sequence: XM_019389906.1 was known and annotated as a YIPF-homolog at the time of filing and has 98% identity to SEQ ID NO: 2 of the instant application (see alignment below). It would have been prima facie obvious to one of ordinary skill in the art at the time of filing to try this sequence in the combined methodologies of Burner and Gendre as it is one of a finite number of annotated YIPF-homologs. A person of skill in the art would have known to use this sequence without surprising results as Burner and as Gendre teaches that the YIPF proteins were effective at reducing cell elongation and root length in Arabidopsis.
Alignment statistics for match #1
Score
Expect
Identities
Gaps
Strand
1452 bits(786)
0.0
824/843(98%)
0/843(0%)
Plus/Plus
Query 1 ATGATGTCCAGCAATTACACCGCAATTGATAATCAGAATGTTTCCGGATCTGTTCCTGCA 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 173 ATGATGTCCAGCAATTACACCGCAATTGATAATCAGAATGTTTCCGGATCTGTTCCTGCA 232
Query 61 GTCGCAGATCCACCTGGCCAAGTTGCCGTCAAATTCACTGATTCGAATTTGCAGACATTT 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 233 GTCGCAGATCCACCTGGCCAAGTTGCCGTCAAATTCACTGATTCGAATTTGCAGACATTT 292
Query 121 CCACCTTCCAGTTCCCAGGGGAAAATCTCTGGTGCTTCTGGACCTCCACGTGACGCCGAC 180
||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||
Sbjct 293 CCACCTTCCAGTTCCCAGGGGAAAATCTCTGGTGCTTCTGGACCTCCACGTGATGCTGAC 352
Query 181 GATACATTCTCTAAACCAGTATCTGGTTCTGATGAGCCCCAGCAGAGCGGTTGGTTTCGC 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 353 GATACATTCTCTAAACCAGTATCTGGTTCTGATGAGCCCCAGCAGAGCGGTTGGTTTCGC 412
Query 241 GCTTTCACTATTGCTGCGTACAAGCCCTATTTTGATGTTGATACATCAGATGTTCTGGAG 300
|||||||||||||||||||||||||||||||||||||||||||| || |||||||| |||
Sbjct 413 GCTTTCACTATTGCTGCGTACAAGCCCTATTTTGATGTTGATACCTCTGATGTTCTAGAG 472
Query 301 AGAATAAAAGATTCACTCTTTCCTTTCACGGGATCCTTTTCGGAGAAGACCGCCAATAAC 360
|||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||
Sbjct 473 AGAATAAAAGATTCACTCTTTCCTTTCACGGGATCCTTTTCGGAGAAGACTGCCGATAAA 532
Query 361 CCAGATTTGTATGGCCCGTTCTGGATATGCAGTACCTTGGTATTTGTTGCAGCTTCCATT 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 533 CCAGATTTGTATGGCCCGTTCTGGATATGCAGTACCTTGGTATTTGTTGCAGCTTCCATT 592
Query 421 GGCACGTTTGTTACCTATATAGCACACAAGCTACAGAAAAAGGAGTGGAACTATGACATC 480
||||| ||||||||||||||||||||||| |||||||| |||||||||||||||||||||
Sbjct 593 GGCACATTTGTTACCTATATAGCACACAAACTACAGAACAAGGAGTGGAACTATGACATC 652
Query 481 AACCTTGTCACTTGGTCTGCGGGTTTATTCTATGGTTATTCCACTGTAGTTCCTCTTTGC 540
||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||
Sbjct 653 AACCTTGTCACTTGGTCTGCGGGTTTATTCTATGGTTATTCCACTATTGTTCCTCTTTGC 712
Query 541 TTGTTTCTAGTCCTCAAGTACTTCTCTGCCCCATCTGGCCTCGTTCAGCTGCTGTGCCTT 600
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 713 TTGTTTCTAGTCCTCAAGTACTTCTCTGCCCCATCTGGCCTCGTTCAGCTGCTGTGCCTT 772
Query 601 TACGGCTATTCCCTTTTTGTCTTCATTCCGGCATTGTGTCTGTCTCTTGTTCCCTGGGAG 660
|||||||||||||| |||||||||||||||||||||||||| |||||| |||||||||||
Sbjct 773 TACGGCTATTCCCTCTTTGTCTTCATTCCGGCATTGTGTCTCTCTCTTCTTCCCTGGGAG 832
Query 661 ATAGTGAGATGGGTGGTTGCTGGTGTAGCTGGCTTAATGTCTGCCACATTTGTCGCTCTT 720
||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||
Sbjct 833 ATAGTGAGATGGGTGGTTGCTGGTGTAGCTGGCTTCATGTCTGCCACATTTGTGGCTCTT 892
Query 721 AATCTGAAACACCACATAGTATCGGCTGGTGAAAGGTGGTTCTTCATTGTGGCTGCTATC 780
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct 893 AATCTGAAACACCACATAGCATCGGCTGGTGAAAGGTGGTTCTTCATTGTGGCTGCTATC 952
Query 781 TTCCTGTTGCAACTTGCACTTGCTTTGGTACTGAGGGTTTACTTGTTCAACGTCACAGTA 840
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 953 TTCCTGTTGCAACTTGCACTTGCTTTGGTACTGAGGGTTTACTTGTTCAACGTCACAGTA 1012
Query 841 TAA 843
|||
Sbjct 1013 TAA 1015
Conclusion
No claims allowed.
Contact Information
Any inquiry concerning this communication or earlier communications from the examiner should be directed to EMILY K. JOHNSON whose telephone number is (571)272-5761. The examiner can normally be reached Monday - Friday 7:30 am - 5:00 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at 571-270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/EMILY K JOHNSON/Examiner, Art Unit 1662
/BRATISLAV STANKOVIC/Supervisory Patent Examiner, Art Units 1661 & 1662
Prosecution Insights