Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Detailed Action
Applicant’s election of Group I, claims 1-5 in part and as sequences, fifteen (15) sequences SEQ ID NOs: 12-26 without traverse in the reply filed on 09/15/2026 is acknowledged; in said reply applicants’ have requested Group IV-V claims 12-15 in part to be rejoined with the elected Group I, claims 1-5 in part. In reply, examiner would like to point out that the elected Group I, claims 1-5 in part are not allowable at this stage of prosecution, therefore the restriction requirement is still deemed proper and is therefore made FINAL. Claims 1-10 and 12-15 are pending in this application; Group I, claims 1-5 in part and as sequences, fifteen (15) sequences SEQ ID NOs: 12-26 reading on the elected invention is now under consideration for examination; non-elected sequences in Group I and claims 6-10 and 12-15 of non-elected Groups II-V are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected invention, there being no allowable generic or linking claim.
Priority
Acknowledgment is made of applicants’ claim for foreign priority under 35 U.S.C. 119(a)-(d). This application is a 371 of PCT/EP2023/061017 filed on 04/26/2023 and claims the priority date of EPO application 22171430.6 filed on 05/03/2022.
Information disclosure statement
The information disclosure statements (IDS) submitted on 10/28/2024 is in compliance with the provisions of 37 CFR 1.97. Accordingly, the IDS statement is considered and initialed by the examiner.
Specification-Objection/Sequence Compliance
I. Applicants’ are advised that the application is not in compliance with 37 CFR §§ 1.821-1.825. This application contains sequence disclosures that are encompassed by the definitions for nucleotide and/or amino acid sequences set forth in 37 CFR § 1.821(a)(1) and (a)(2). However, this application fails to comply with the requirements of 37 CFR §§ 1.821-1.825. Specifically, applicants’ are required to comply with the sequence rules by inserting the sequence identification numbers of all sequences within the claims and/or specification. It is particularly noted that Figure 1 of Drawings/specification recites polynucleotide sequence, but applicants’ fail to provide the SEQ ID NO: (sequence identifier) to the sequence recited in the specification; i.e., SEQ ID NO: is required for nucleotides 10 (ten) or more and amino acids 4 (four) or more. Sequences must be referred to by their sequence identifiers, see particularly 37 CFR 1.821(d). If the sequences appearing in the specification do not have SEQ ID NO: assigned to them, then an amendment to the sequence listing will be required as well. There must not be any new matter submitted, therefore it is important to be careful to include only the sequences that are already disclosed in the current specification. Failure to correct the deficiency will be held a non-responsive to this Office action. Correction and clarification required.
Sequence Rules: The nucleic acid sequences presented requires having a sequence identifier. In order to comply with the sequence rules Applicants must identify the sequence by providing SEQ ID NO:, and where required provide a new version of the sequence listing and disk. Applicant must submit a CRF copy and paper copy of the Sequence Listing, a statement that the content of the paper and computer readable copies are the same and where applicable include no new matter as required by 37 C.F.R. j 1.821(e) or 1.821(9 or 1.821(g) or 1 .825(d), as well as an amendment directing its entry into the specification. Note: If the nucleic acid sequences are already part of the sequence listing and the CRF, Applicants may amend the specification by providing the appropriate SEQ ID NO: or provide the SEQ ID NO, to the legend of the figure(s). Applicant's cooperation is requested in correcting other unidentified sequences of which applicant may become aware of in the specification.
II. The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code. The specification contains hyperlinks to various site domains, for example, line 25, page 6 of the instant application. Applicants’ are required to thoroughly scrutinize the specification and delete all embedded hyperlink and/or other form of browser-executable code. See MPEP § 608.01. Appropriate correction is required.
Claim Objections
I. Claims 1-5 are objected to, as said claims recite non-elected subject-matter/SEQ ID NOs.
II. Claims 1-5 are objected to, due to the following informality: Claims 1-5 recite abbreviation "HBD; KLF1; TFIIB; & b-DRF" in the claims. Examiner suggests expanding the abbreviations to recite the full form of what the abbreviation stands for at least in the first recitation. Appropriate correction is required. For examination purposes "HBD; KLF1; TFIIB; & b-DRF" is interpreted respectively as "gene encoding delta-globin; Kruppel-like factor I; Transcription Factor IIB & beta-globin direct repeat".
Although the claims are examined in the light of the specification, specification cannot be read into the claims, i.e., the limitations of the specification cannot be read into the claims (see MPEP 2111 R-5).
III. Claim 3 is objected to, due to the following informality: Recitation of “and/or” in claim 3 makes the claims indefinite, as it is not clear what limitations must be present. Correction and clarification is required. Examiner suggests amending the claim to recite “…or …”.
Claim Rejections: 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
I. Claims 1-5 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112, second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which applicant regards as the invention.
Claims 1-5 are indefinite in the recitation of “(b) a second component selected from (b-1) a DNA donor template, or (b-2) a vector, preferably an AAV vector or a lentiviral vector comprising a-the DNA donor template, wherein the DNA donor template comprises of the human HBD gene, (b-ii) a second homology arm sequence having at least 80% sequence identity to a second portion of a chromosomal DNA sequence comprised in the promoter region of the human HBD gene, (b-iii) a human KLF1 binding site, (b-iv) a human TFIIB binding site, and (b-v) a human b-DRF motif, wherein the first homology arm sequence and the second homology arm sequence independently of each other have a length of between 20 to 200 nucleotides…”, i.e., “80%… homology” for the following reasons.
Claims 1-5 are indefinite in the recitation of “… a second homology arm sequence having at least 80% sequence identity to a second portion of a chromosomal DNA sequence” for the following reasons. The reference to specific homology is unclear and confusing in the absence of the specific sequence structure. It is suggested that if the sequences of the human chromosomal DNA sequence comprised in the promoter region of the human HBD gene is disclosed in the sequence listing, the corresponding sequence identifier (i.e., SEQ ID NO: X; SEQ ID NO: Y) be used in the claims. Furthermore, as written and additionally it is not clear which specific version and the corresponding structure is being referred to in the claim, as public databases are constantly curated and revised; and (ii) The term “homology” is unclear and confusing in the absence of a definition providing the intended meaning of the term or the intended parameters required to determine the required homology value. While one could argue that the term “sequence homology” can be interpreted as “sequence identity”, as known in the art, these terms are not equivalent. The calculation of sequence homology takes into consideration the type of mismatches, i.e., even mismatches contribute to the % homology value, whereas mismatches do not have any weight in the calculation of sequence identity, i.e., only exact matches contribute to the % identity value. Thus, if there is no indication that the term “homology” is intended to mean “identity”, and the specification does not provide the specific parameters intended in the calculation of sequence homology (e.g., BLOSUM62), one of skill in the art cannot determine the scope of the term “having at least 80% homology”, because one could have an human HBD gene which has 80% sequence homology to a reference sequence based on a particular matrix, and at the same time may not have 80% sequence homology to the same reference sequence if other matrices/parameters are used. Correction and clarification is required.
II. Claim 3 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor, or for pre-AIA the applicant regards as the invention.
Claim 3 recites “and/or” and makes the claims indefinite, as it is not clear what limitations must be present. Correction and clarification is required. Examiner suggests amending the claim to recite “…or …”. See MPEP § 2173.05(d).
Claim Rejections: 35 USC § 112(a)
The following is a quotation of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Written Description
I. Claims 1-5 are rejected under 35 U.S.C. (a) or 35 U.S.C. 112, first paragraph, as containing subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claims 1-5 of the instant application as interpreted are directed to a genus of undefined and unlimited structures i.e., “(b) a second component selected from (b-1) a DNA donor template, or (b-2) a vector, preferably an AAV vector or a lentiviral vector comprising a-the DNA donor template, wherein the DNA donor template comprises of the human HBD gene, (b-ii) a second homology arm sequence having at least 80% sequence identity to a second portion of a chromosomal DNA sequence comprised in the promoter region of the human HBD gene,(b-iii) a human KLF1 binding site, (b-iv) a human TFIIB binding site, and (b-v) a human b-DRF motif, wherein the first homology arm sequence and the second homology arm sequence independently of each other have a length of between 20 to 200 nucleotides…”; and a genus of structures, any nucleic acid encoding a Cas9 polypeptide or a variant thereof of undefined unlimited structures including variants, mutants and homologs (also see claims objections; 35 U.S.C. 112(b) rejections above for claims interpretation).
In University of California v. Eli Lilly & Co., 43 USPQ2d 1938, the Court of Appeals for the Federal Circuit has held that “A written description of an invention involving a chemical genus, like a description of a chemical species, ‘requires a precise definition, such as by structure, formula, [or] chemical name,’ of the claimed subject matter sufficient to distinguish it from other materials”. As indicated in MPEP § 2163, the written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show that Applicant was in possession of the claimed genus. In addition, MPEP § 2163 states that a representative number of species means that the species which are adequately described are representative of the entire genus. Thus, when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus.
In the instant case, there is no structure associated with function with regard to the members of genus of undefined and unlimited structures i.e., “(b) a second component selected from (b-1) a DNA donor template, or (b-2) a vector, preferably an AAV vector or a lentiviral vector comprising a-the DNA donor template, wherein the DNA donor template comprises of the human HBD gene, (b-ii) a second homology arm sequence having at least 80% sequence identity to a second portion of a chromosomal DNA sequence comprised in the promoter region of the human HBD gene,(b-iii) a human KLF1 binding site, (b-iv) a human TFIIB binding site, and (b-v) a human b-DRF motif, wherein the first homology arm sequence and the second homology arm sequence independently of each other have a length of between 20 to 200 nucleotides…”; and a genus of structures, any nucleic acid encoding a Cas9 polypeptide or a variant thereof of undefined unlimited structures including variants, mutants and homologs (also see claims objections; 35 U.S.C. 112(b) rejections above for claims interpretation).
No information, beyond the characterization of specific structures HBD: SEQ ID NO: 84: GGGCAAGTTAAGGGAATAGTGGAATGAAGG; and SEQ ID NO: 85: GTCAGAAGAAAGTGTAAGCAACAGTCGAC; Human KLF1 binding site: CCACACCC; Human TFIIB binding site: GGGCTGG; and Human b-DRF motif: GAGGGCAGG and specific cas9 polypeptides comprising the amino acid sequences of SEQ ID NOs: 56, 58, 60 and 62 has been provided by the applicants’, which would indicate that they had possession of the claimed members of the genus of undefined and unlimited structures i.e., “(b) a second component selected from (b-1) a DNA donor template, or (b-2) a vector, preferably an AAV vector or a lentiviral vector comprising a-the DNA donor template, wherein the DNA donor template comprises of the human HBD gene, (b-ii) a second homology arm sequence having at least 80% sequence identity to a second portion of a chromosomal DNA sequence comprised in the promoter region of the human HBD gene,(b-iii) a human KLF1 binding site, (b-iv) a human TFIIB binding site, and (b-v) a human b-DRF motif, wherein the first homology arm sequence and the second homology arm sequence independently of each other have a length of between 20 to 200 nucleotides…”; and a genus of structures, any nucleic acid encoding a Cas9 polypeptide or a variant thereof of undefined unlimited structures including variants, mutants and homologs (also see claims objections; 35 U.S.C. 112(b) rejections above for claims interpretation).
The prior art clearly provides evidence regarding activity of Cas polypeptides/RNA guided DNA endonucleases and recognition and requirement of specific Cas polypeptide guide RNA sequences for the activity obtained from different sources and the activities are affected by structural changes either in the Cas polypeptide or in the cognate Cas guide sequence:
Stella et al., (Cell, 2018, Vol. 175: 1856-1871) provides evidence that certain specific nucleotide residues are required for the activity of Cas12a and mutations in the guide sequence affects the activity (see Abstract; and entire document).
Swarts et al., (Mol. Cell, 2017 Vol. 66: 221-233) provides evidence any mutation in the Cas12a polypeptide affects its activity (Abstract; Fig. 5-6, pages 228-229; and entire document).
As the claimed genera of RNA guided DNA endonucleases and a genera of guide sequences i.e., homology arm sequence having at least 80% sequence identity to a second portion of a chromosomal DNA sequence comprised in the promoter region of the human HBD gene,(b-iii) a human KLF1 binding site, (b-iv) a human TFIIB binding site, and (b-v) a human b-DRF motif, wherein the first homology arm sequence and the second homology arm sequence independently of each other have a length of between 20 to 200 nucleotides…”; and a genus of structures, any nucleic acid encoding a Cas9 polypeptide or a variant thereof having widely variable structures and associated function in the claimed method, since minor changes in structure may result in changes affecting function and no additional information correlating structure with function has been provided. Furthermore, “Possession may not be shown by merely describing how to obtain possession of members of the claimed genus or how to identify their common structural features” (See University of Rochester, 358 F.3d at 927, 69 USPQ2d at 1895).
Therefore, one skilled in the art cannot reasonably conclude that applicant had possession of the claimed invention at the time the instant application was filed. Applicants are referred to the revised guidelines concerning compliance with the written description requirement of 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, published in the Official Gazette and also available at www.uspto.gov.
Enablement
II. In this regard, the application disclosure and claims are compared per the factors indicated in the decision In re Wands 858 F.2d 731, 8 USPQ2nd 1400 (Fed. Cir, 1988). These factors are considered when determining whether there is sufficient evidence to support a description that a disclosure does not satisfy the enablement requirement and whether any necessary experimentation is undue. The factors include but are not limited to: (1) the nature of the invention; (2) the breath of the claims; (3) the predictability or unpredictability of the art; (4) the amount of direction or guidance presented; (5) the presence or absence of working examples; (6) the quantity of experimentation necessary; (7) the relative skill of those skilled in the art. Each factor is here addressed on the basis of a comparison of the disclosure, the claims, and the state of the prior art in the assessment of undue experimentation.
Claims 1-5 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112, first paragraph, because the specification, while being enabling for the characterization of specific structures HBD: SEQ ID NO: 84: GGGCAAGTTAAGGGAATAGTGGAATGAAGG; and SEQ ID NO: 85: GTCAGAAGAAAGTGTAAGCAACAGTCGAC; Human KLF1 binding site: CCACACCC; Human TFIIB binding site: GGGCTGG; and Human b-DRF motif: GAGGGCAGG and specific cas9 polypeptides comprising the amino acid sequences of SEQ ID NOs: 56, 58, 60 and 62, does not reasonably provide enablement for members of genus of undefined and unlimited structures i.e., “(b) a second component selected from (b-1) a DNA donor template, or (b-2) a vector, preferably an AAV vector or a lentiviral vector comprising a-the DNA donor template, wherein the DNA donor template comprises of the human HBD gene, (b-ii) a second homology arm sequence having at least 80% sequence identity to a second portion of a chromosomal DNA sequence comprised in the promoter region of the human HBD gene,(b-iii) a human KLF1 binding site, (b-iv) a human TFIIB binding site, and (b-v) a human b-DRF motif, wherein the first homology arm sequence and the second homology arm sequence independently of each other have a length of between 20 to 200 nucleotides…”; and a genus of structures, any nucleic acid encoding a Cas9 polypeptide or a variant thereof of undefined unlimited structures including variants, mutants and homologs (also see claims objections; 35 U.S.C. 112(b) rejections above for claims interpretation). The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the invention commensurate in scope with these claims.
Claims 1-5 are so broad as to encompass: genus of undefined and unlimited structures i.e., “(b) a second component selected from (b-1) a DNA donor template, or (b-2) a vector, preferably an AAV vector or a lentiviral vector comprising a-the DNA donor template, wherein the DNA donor template comprises of the human HBD gene, (b-ii) a second homology arm sequence having at least 80% sequence identity to a second portion of a chromosomal DNA sequence comprised in the promoter region of the human HBD gene,(b-iii) a human KLF1 binding site, (b-iv) a human TFIIB binding site, and (b-v) a human b-DRF motif, wherein the first homology arm sequence and the second homology arm sequence independently of each other have a length of between 20 to 200 nucleotides…”; and a genus of structures, any nucleic acid encoding a Cas9 polypeptide or a variant thereof of undefined unlimited structures including variants, mutants and homologs (also see claims objections; 35 U.S.C. 112(b) rejections above for claims interpretation). The scope of each of these claims is not commensurate with the enablement provided by the disclosure with regard to the extremely large number/a genera of active molecules i.e., “guide sequences” and the cognate “RNA guided DNA endonuclease” polypeptides, as broadly encompassed by the claims. Since the structure of a “guide sequence” and the cognate “RNA guided DNA endonuclease polypeptide” will remain active in the claimed method requires a knowledge of how each component of the composition in the claimed method affects the activity. In addition, since the structure of a “guide sequence” and the cognate “RNA guided DNA endonuclease polypeptide” determines its functional properties, predictability of which molecule “guide sequence” and the cognate “RNA guided DNA endonuclease polypeptide” can remain active in a composition of the claimed method requires a knowledge of and guidance with regard to the relationship of the structure to its function. However, in this case the disclosure is limited to the characterization of specific structures HBD: SEQ ID NO: 84: GGGCAAGTTAAGGGAATAGTGGAATGAAGG; and SEQ ID NO: 85: GTCAGAAGAAAGTGTAAGCAACAGTCGAC; Human KLF1 binding site: CCACACCC; Human TFIIB binding site: GGGCTGG; and Human b-DRF motif: GAGGGCAGG and specific cas9 polypeptides comprising the amino acid sequences of SEQ ID NOs: 56, 58, 60 and 62.
While methods for testing the activity of a molecule/“guide sequence” and the cognate “RNA guided DNA endonuclease polypeptide” in specific composition with desired biological/biochemical properties are known, it is not routine in the art to screen the activity of multiple molecules/“guide sequences” and the cognate “RNA guided DNA endonuclease polypeptides” or multiple modifications in multiple compositions comprising an essentially unlimited number of possible components, as encompassed by the instant claims in the claimed method.
The specification does not support the broad scope of claims 1-5, which encompass: genus of undefined and unlimited structures i.e., “(b) a second component selected from (b-1) a DNA donor template, or (b-2) a vector, preferably an AAV vector or a lentiviral vector comprising a-the DNA donor template, wherein the DNA donor template comprises of the human HBD gene, (b-ii) a second homology arm sequence having at least 80% sequence identity to a second portion of a chromosomal DNA sequence comprised in the promoter region of the human HBD gene,(b-iii) a human KLF1 binding site, (b-iv) a human TFIIB binding site, and (b-v) a human b-DRF motif, wherein the first homology arm sequence and the second homology arm sequence independently of each other have a length of between 20 to 200 nucleotides…”; and a genus of structures, any nucleic acid encoding a Cas9 polypeptide or a variant thereof of undefined unlimited structures including variants, mutants and homologs (also see claims objections; 35 U.S.C. 112(b) rejections above for claims interpretation). The specification does not support the broad scope of claims, because the specification does not establish: (A) any or all molecule(s)/“guide sequences” and the cognate “RNA guided DNA endonuclease” polypeptides having no specific structural elements in the composition of the claimed method; (B) the general tolerance of the activity of any molecule/“guide sequences” and the cognate “RNA guided DNA endonuclease” polypeptides having no specific structural elements in the composition of the claimed method; (C) a rational and predictable scheme for choosing any molecule “guide sequences” and the cognate “RNA guided DNA endonuclease” to be active in the composition of the claimed method; (D) a rational and predictable scheme for modifying any molecule “guide sequence” and the cognate RNA guided DNA endonuclease” with an expectation of obtaining the desired biological function; and (E) the specification provides insufficient guidance as to which of the essentially infinite possible choices is likely to be successful.
Thus, applicants’ have not provided sufficient guidance to enable one of ordinary skill in the art to make and use the claimed invention in a manner reasonably correlated with the scope of the claims encompassing genus of undefined and unlimited structures i.e., “(b) a second component selected from (b-1) a DNA donor template, or (b-2) a vector, preferably an AAV vector or a lentiviral vector comprising a-the DNA donor template, wherein the DNA donor template comprises of the human HBD gene, (b-ii) a second homology arm sequence having at least 80% sequence identity to a second portion of a chromosomal DNA sequence comprised in the promoter region of the human HBD gene,(b-iii) a human KLF1 binding site, (b-iv) a human TFIIB binding site, and (b-v) a human b-DRF motif, wherein the first homology arm sequence and the second homology arm sequence independently of each other have a length of between 20 to 200 nucleotides…”; and a genus of structures, any nucleic acid encoding a Cas9 polypeptide or a variant thereof of undefined unlimited structures including variants, mutants and homologs (also see claims objections; 35 U.S.C. 112(b) rejections above for claims interpretation). The scope of the claims must bear a reasonable correlation with the scope of enablement (In re Fisher, 166 USPQ 19 24 (CCPA 1970)). Without sufficient guidance, determination of a genera of “guide sequences” and the cognate “RNA guided DNA endonuclease polypeptides” having no specific structural elements in the composition of the claimed method is unpredictable and the experimentation left to those skilled in the art is unnecessarily, and improperly, extensive and undue. See In re Wands 858 F.2d 731, 8 USPQ2nd 1400 (Fed. Cir, 1988).
Claim Rejections: 35 USC § 103
The following is a quotation of 35 U.S.C. 103(a) which forms the basis for all obviousness rejections set forth in this Office action:
(a) A patent may not be obtained though the invention is not identically disclosed or described as set forth in section 102 of this title, if the differences between the subject matter sought to be patented and the prior art are such that the subject matter as a whole would have been obvious at the time the invention was made to a person having ordinary skill in the art to which said subject matter pertains. Patentability shall not be negatived by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims under 35 U.S.C. 103(a), the examiner presumes that the subject matter of the various claims was commonly owned at the time any inventions covered therein were made absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and invention dates of each claim that was not commonly owned at the time a later invention was made in order for the examiner to consider the applicability of 35 U.S.C. 103(c) and potential 35 U.S.C. 102(e), (f) or (g) prior art under 35 U.S.C. 103(a).
The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103(a) are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 1-5 are rejected under 35 U.S.C. 103(a) as being unpatentable over Porteus et al., (US 12,043,843 B2) and further in view of Corn et al., (US 11,427,837 B2), Antoniani et al., (Blood., 2014, Vol. 131(17): 1960-1973, in IDS) and Vinjamur et al., (Brit. J. Haematol., 2018, Vol. 180: 630-643).
Regarding claims 1-5, the disclosure of Porteus et al., (US 12,043,843 B2) teach materials and methods for treating hemoglobinopathies; more specifically, the reference provides methods for producing progenitor cells that are genetically modified via genome editing to increase the production of fetal hemoglobin (HbF), as well as modified progenitor cells (including, for example, CD34+ human hematopoietic stem cells) producing increased levels of HbF, and methods of using such cells for treating hemoglobinopathies such as sickle cell anemia and β-thalassemia (Abstract; and entire document); said reference discloses guide RNA (gRNA) sequences directed to promoter region of HBD gene and the reference gRNAs having 100% sequence identity to SEQ ID NOs: 12-26 of the instant invention (see provided sequence alignments); Porteus et al., provide teaching, suggestion and motivation for deletions in delta-globin gene (HBD gene) regulatory region/promoter (col. 15, lines 30-67; & col. 16, lines 26-54), and also suggest disrupting transcription factor KLF1, as said KLF1 is involved in switch from fetal to adult hemoglobin (col. 10, lines 49-59; & col. 11, lines 4-15).Certain relevant sections from Porteus et al., (US 12,043,843 B2) is reproduced below:
US 12,043,843
Col. 10, lines 49-59
PNG
media_image1.png
132
280
media_image1.png
Greyscale
Col. 11, lines 4-15
PNG
media_image2.png
146
280
media_image2.png
Greyscale
Col. 15, lines 36-67
PNG
media_image3.png
370
280
media_image3.png
Greyscale
Col. 16, lines 26-54
PNG
media_image4.png
334
284
media_image4.png
Greyscale
However, Porteus et al., (US 12,043,843 B2) do not explicitly teach “(b) a second component selected from (b-1) a DNA donor template, or (b-2) a vector, preferably an AAV vector or a lentiviral vector comprising a-the DNA donor template, wherein the DNA donor template comprises of the human HBD gene, (b-ii) a second homology arm sequence having at least 80% sequence identity to a second portion of a chromosomal DNA sequence comprised in the promoter region of the human HBD gene,(b-iii) a human KLF1 binding site, (b-iv) a human TFIIB binding site, and (b-v) a human b-DRF motif, wherein the first homology arm sequence and the second homology arm sequence independently of each other have a length of between 20 to 200 nucleotides…” (as in claim 1 and 4); and wherein the gRNA is chemically modified, preferably modified at the 2' position of the a sugar, particularly modified with said modifications being selected from the group consisting of 2'-OMe, 2'-MOE and 2'-F modifications, and/or modified at the phosphate group, particularly modified with phosphorothioate and/or phosphorodithioate modifications (as in claim 3).
Regarding claims 1 and 3-4 the disclosure of Corn et al., (US 11,427,837 B2) teach Genome Editing of the Sickle Mutation in Human Adult Hematopoietic Stem/Progenitor Cells utilizing CRISPR/cas9 editing system (Abstract; Claims; and entire document; Example 2; cols. 71-84) and provide teaching, suggestion and motivation for targeting HBD gene comprising homology arms/structures for said HBD gene (cols. 73-75; & Fig. 13); said homology arm sequences of HBD gene includes the following; “region of microhomology” is meant a stretch of nucleotides of a linear DNA molecule (double or single stranded) of a non-homologous DNA composition that has homology to a stretch of nucleotides at or near the target site in the genome. Such a stretch of nucleotides (within the linear DNA molecule of a non-homologous DNA composition) can have a length in a range of from 2 to 40 nucleotides (nt) (2 to 40 base pairs (bp) if double stranded) (e.g., 2 to 35 nt, 2 to 25 nt, 2 to 20 nt, 2 to 15 nt, 2 to 10 nt, 3 to 40 nt, 3 to 35 nt, 3 to 25 nt, 3 to 20 nt, 3 to 15 nt, 3 to 10 nt, 5 to 40 nt, 5 to 35 nt, 5 to 25 nt, 5 to 20 nt, 5 to 15 nt, 5 to 10 nt, 10 to 40 nt, 10 to 35 nt, 10 to 30 nt, 10 to 25 nt, 10 to 20 nt, 10 to 15 nt, 15 to 40 nt, 15 to 35 nt, 15 to 30 nt, 15 to 25 nt, 15 to 20 nt, 20 to 40 nt, 20 to 35 nt, 20 to 30 nt, 20 to 25 nt, 25 to 40 nt, 25 to 35 nt, 25 to 30 nt, 30 to 40 nt, or 30 to 35 nt) (e.g., 2 to 35 bp, 2 to 25 bp, 2 to 20 bp, 2 to 15 bp, 2 to 10 bp, 3 to 40 bp, 3 to 35 bp, 3 to 25 bp, 3 to 20 bp, 3 to 15 bp, 3 to 10 bp, 5 to 40 bp, 5 to 35 bp, 5 to 25 bp, 5 to 20 bp, 5 to 15 bp, 5 to 10 bp, 10 to 40 bp, 10 to 35 bp, 10 to 30 bp, 10 to 25 bp, 10 to 20 bp, 10 to 15 bp, 15 to 40 bp, 15 to 35 bp, 15 to 30 bp, 15 to 25 bp, 15 to 20 bp, 20 to 40 bp, 20 to 35 bp, 20 to 30 bp, 20 to 25 bp, 25 to 40 bp, 25 to 35 bp, 25 to 30 bp, 30 to 40 bp, or 30 to 35 bp) and the complementarity (sequence identity) can be 90% or more over that stretch (e.g., 95% or more, 97% or more, 98% or more, 99% or more, or 100% sequence identity over that stretch) (see col. 26,lines 5-31); said gRNAs include phosphorothioate oligonucleotides (see TABLE 2; and entire document) .
Regarding claims 1 and 4, Antoniani et al., (Blood., 2014, Vol. 131(17): 1960-1973, in IDS) provide teaching, suggestion and motivation for “a clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated protein 9 (Cas9) (CRISPR/Cas9) strategy to disrupt a 13.6-kb genomic region encompassing the d- and b-globin genes and a putative g-d intergenic fetal hemoglobin (HbF) silencer. Disruption of just the putative HbF silencer results in a mild increase in g-globin expression, whereas deletion or inversion of a 13.6-kb region causes a robust reactivation of HbF synthesis in adult erythroblasts that is associated with epigenetic modifications and changes in chromatin contacts within the b-globin locus. In primary SCD patient-derived hematopoietic stem/progenitor cells, targeting the 13.6-kb region results in a high proportion of g-globin expression in erythroblasts, increased HbF synthesis, and amelioration of the sickling cell phenotype. Overall, this study provides clues for a potential CRISPR/Cas9 genome editing approach to the therapy of b-hemoglobinopathies“ (see Abstract; Fig. 1, page1961; Fig. 2, page 1962; Fig. 3, page 1964; Fig. 4, page 1967; and entire document).
Regarding claims 1 and 4-5, wherein the DNA donor template further comprises (b-vi) a human LDB 1 complex binding site, Vinjamur et al., (Brit. J. Haematol., 2018, Vol. 180: 630-643) teach in rational approaches to fetal hemoglobin/HBF-inducing therapies to comprise and target LDB 1 complex and said LDB 1 complex is known to control fetal globin expression (see Abstract; Fig. 1-3; cols. 1-2, page 635; and entire document).
As such, disclosure of strategy and methods including structural and functional elements for rational approaches to HBF-inducing therapies in the claimed CRISPR/Cas composition for editing a human HBD gene, such as that of references of Corn et al., Antoniani et al., and Vinjamur et al., teaching the advantages of said modifications, clearly suggests to a skilled artisan to modify the teachings of Porteus et al., and incorporate the structural and functional elements of Corn et al., Antoniani et al., and Vinjamur et al., and adopt the rational approaches to HBF-inducing therapies in the claimed CRISPR/Cas composition for editing a human HBD gene as provided in the teachings of Corn et al., Antoniani et al., and Vinjamur et al., and the combined references Porteus et al., Corn et al., Antoniani et al., and Vinjamur et al., also provide teaching, suggestion and motivation including the structural and functional elements of the instant invention and are well known in the art (for details see the rejection above).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the claimed CRISPR/Cas composition for editing a human HBD gene, as suggested by the teachings of Corn et al., Antoniani et al., and Vinjamur et al., and to modify the teachings of Porteus et al. A person of ordinary skill in the art is motivated to make such change depending on the experimental need i.e., “(b) a second component selected from (b-1) a DNA donor template, or (b-2) a vector, preferably an AAV vector or a lentiviral vector comprising a-the DNA donor template, wherein the DNA donor template comprises of the human HBD gene, (b-ii) a second homology arm sequence having at least 80% sequence identity to a second portion of a chromosomal DNA sequence comprised in the promoter region of the human HBD gene,(b-iii) a human KLF1 binding site, (b-iv) a human TFIIB binding site, and (b-v) a human b-DRF motif, wherein the first homology arm sequence and the second homology arm sequence independently of each other have a length of between 20 to 200 nucleotides…” (as in claim 1 and 4); and wherein the gRNA is chemically modified, preferably modified at the 2' position of the a sugar, particularly modified with said modifications being selected from the group consisting of 2'-OMe, 2'-MOE and 2'-F modifications, and/or modified at the phosphate group, particularly modified with phosphorothioate and/or phosphorodithioate modifications (as in claim 3). One of ordinary skill in the art has a reasonable expectation of success at adding the steps, as suggested in the teachings of Porteus et al., Corn et al., Antoniani et al., and Vinjamur et al., and are well known in the art. Therefore, the invention as a whole lack an inventive step over the prior art. The expectation of success is high, because the combined teachings of Porteus et al., Corn et al., Antoniani et al., and Vinjamur et al., also provide the structural and functional elements of the instant invention (Teaching, Suggestion and Motivation). Furthermore, "it is prima facie obvious to combine two compositions or two methods each of which is taught by the prior art to be useful for the same purpose, in order to form a third composition or third method to be used for the very same purpose.... [T]he idea of combining them flows logically from their having been individually taught in the prior art." In re Kerkhoven, 626 F.2d 846, 850, 205 USPQ 1069, 1072 (CCPA 1980)”. Therefore, the above invention would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention.
Given this extensive teaching in prior art (Porteus et al., Corn et al., Antoniani et al., and Vinjamur et al.,) the claimed genus of undefined and unlimited structures i.e., “(b) a second component selected from (b-1) a DNA donor template, or (b-2) a vector, preferably an AAV vector or a lentiviral vector comprising a-the DNA donor template, wherein the DNA donor template comprises of the human HBD gene, (b-ii) a second homology arm sequence having at least 80% sequence identity to a second portion of a chromosomal DNA sequence comprised in the promoter region of the human HBD gene,(b-iii) a human KLF1 binding site, (b-iv) a human TFIIB binding site, and (b-v) a human b-DRF motif, wherein the first homology arm sequence and the second homology arm sequence independently of each other have a length of between 20 to 200 nucleotides…”; and a genus of structures, any nucleic acid encoding a Cas9 polypeptide or a variant thereof of undefined unlimited structures including variants, mutants and homologs (also see claims objections; 35 U.S.C. 112(b) rejections above for claims interpretation), as taught by the instant invention and as claimed in claims 1-5 is not of innovation but of ordinary skill in the art and the expectation of success is extremely high i.e., “a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipated success, it is likely that product [was] not of innovation but of ordinary skill and common sense. In that instance the fact that a combination was obvious to try might show that it was obvious under § 103.”KSR, 550 U.S. at, 82 USPQ2d at 1397”.
Thus, given that the cited the prior art provides scientific basis and reduction to practice as claimed herein in claims 1-5, is a simple combination of known elements from the prior art.
THE EXPECTATION OF SOME ADVANTAGE IS THE STRONGEST RATIONALE FOR COMBINING REFERENCES
The strongest rationale for combining references is a recognition, expressly or impliedly in the prior art or drawn from a convincing line of reasoning based on established have been produced by their combination. In re Sernaker, 702 F.2d 989, 994-95, scientific principles or legal precedent, that some advantage or expected beneficial result would 217USPQ 1, 5-6 (Fed. Cir. 1983). >See also Dystar Textilfarben GmbH & Co. Deutschland KG v. C.H. Patrick, 464 F.3d 1356, 1368, 80 USPQ2d 1641, 1651(Fed. Cir. 2006) (“Indeed, we have repeatedly held that an implicit motivation to combine exists not only when a suggestion may be gleaned from the prior art as a whole, but when the improvement’ is technology-independent and the combination of references results in a product or process that is more desirable, for example because it is stronger, cheaper, cleaner, faster, lighter, smaller, more durable, or more efficient. Because the desire to enhance commercial opportunities by improving a product or process is universal-and even common-sensical-we have held that there exists in these situations a motivation to combine prior art references even absent any hint of suggestion in the references themselves.”).
The cited references render claims 1-5 prima facie obvious to one of ordinary skill in the art when one applies the Teaching, Suggestion and Motivation (TSM) test under the rationale for arriving at a conclusion of obviousness as suggested by the KSR ruling. The rationale applied for this rejection is as follows:
(1) Combining prior art elements according to known method to yield predictable results.
(2) Simple substitution of one known element for another to obtain predictable results.
(3) "Obvious to try"- choosing from a finite number of identified, predictable solution, with a reasonable expectation of success.
Hence, claims 1-5 are rejected under 35 U.S.C. 103(a) as being unpatentable over Porteus et al., (US 12,043,843 B2) and further in view of Corn et al., (US 11,427,837 B2), Antoniani et al., (Blood., 2014, Vol. 131(17): 1960-1973, in IDS) and Vinjamur et al., (Brit. J. Haematol., 2018, Vol. 180: 630-643).
Allowable Subject Matter/Conclusion
None of the claims are allowable.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to GANAPATHIRAMA RAGHU whose telephone number is (571)272-4533. The examiner can normally be reached on M-F 8:30am-5pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Robert Mondesi can be reached on 408-918-7584. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/GANAPATHIRAMA RAGHU/ Primary Examiner, Art Unit 1652
