Prosecution Insights
Last updated: October 01, 2026
Application No. 18/865,711

USE OF GLYCINE MAX ASPARTATE KINASE/HOMOSERINE DEHYDROGENASE FAMILY GENE GmAK-HSDH

Final Rejection §103
Filed
Nov 14, 2024
Priority
Oct 27, 2023 — CN 202311404037.6 +1 more
Examiner
CHATTERJEE, JAYANTA
Art Unit
1662
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Nanjing Agricultural University
OA Round
2 (Final)
46%
Grant Probability
Moderate
3-4
OA Rounds
8m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 46% of resolved cases
46%
Career Allowance Rate
10 granted / 22 resolved
-14.5% vs TC avg
Strong +80% interview lift
Without
With
+80.0%
Interview Lift
resolved cases with interview
Typical timeline
2y 7m
Avg Prosecution
57 currently pending
Career history
82
Total Applications
across all art units

Statute-Specific Performance

§101
3.6%
-36.4% vs TC avg
§103
41.9%
+1.9% vs TC avg
§102
17.2%
-22.8% vs TC avg
§112
29.6%
-10.4% vs TC avg
Black line = Tech Center average estimate • Based on career data from 22 resolved cases

Office Action

§103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claim Status Claims 6, 11 and 13-15 are pending. Claims 3-5 and 7-12 are cancelled by the Applicant. Claims 13-15 are newly added by the Applicant and are entered. Claims 6, 11, 13-15 are being examined. Examiner’s Note It is noted by the Examiner that many parts of the claim are not legible. The Applicant is requested to follow the patent filing rule that states to file using "black font" and instead filing using colored fonts or a "dark grey" font in any future submission, as deemed necessary. The Applicant is requested to submit the claims using black font, as per the patent filing rule. However, as a courtesy to the Applicant and in an effort to provide better customer service, the Examiner continued examining the application. Claim Objections Claims 6 and 13 is objected to because of the following informalities: The numbering (1, 2, 3….) of various steps within claim 6 need not be the same as claim numbering. It is requested to change the numbering of different steps in claim 6 and in the dependent claim 13. It is suggested to change it to a), b), c)…. Appropriate correction is required. Claim Rejections - 35 USC § 103 Claims 6 and 11 remain and new claims 13-15 are rejected under 35 U.S.C. 103 as being unpatentable over Zhang et al.(a) (Genome-wide Scan for Seed Composition Provides Insights into Soybean Quality Improvement and the Impacts of Domestication and Breeding, 2017, Molecular Plant, 11:460-472) and Nguyen et al. (US 2011/0083234 A1) in view of Hamera et al. (Expression of Cucumber mosaic virus suppressor 2b alters FWA methylation and its siRNA accumulation in Arabidopsis thaliana, 2016, Biology Open, 5:1727-1734), Paz et al. (Improved cotyledonary node method using an alternative explant derived from mature seed for efficient Agrobacterium-mediated soybean transformation, 2006, Plant Cell Rep., 25: 206–213), Yoshinobu et al. (Studies on the conversion of [4-14C]-L-aspartic acid to L-lysine, L-threonine and L-isoleucine in hiproly barley, 1981, Tokyo Nogyo Daigaku Aisotopu Kenkyusho Kenkyu Hokoku, 1:23-32, original article is in Japanese), Zhang et al.(b) (The genetic architecture of watersoluble protein content and its genetic relationship to total protein content in soybean, 2017, Scientific Reports, 7:5053), Liu et al. (Factors influencing Agrobacterium-mediated cotyledonary-node transformation of soybean (Glycine max L.), 2007, Fen Zi Xi Bao Sheng Wu Xue Bao, 40:286-94.; In Chinese) and in evidence of Martin et al. (Ohio performance trials of public soybean varieties, January 1996, Horticulture and Crop Science Series 225). Claim 6 is drawn to a method for increasing water-soluble protein content and protein content in soybean seeds via Agrobacterium mediated transformation using cotyledonary node explant and a recombinant vector derived from pBA002 and containing the gene GmAK-HSDH comprising SEQ ID NO: 1, and a harvesting seed from regenerated plants. Zhang et al.(a) describes identifying a total of 87 chromosomal regions in soybean genome associated with seed (protein and oil) composition (Abstract, line 4-5). The observation not only provides valuable genes and markers for soybean nutrient improvement, both quantitatively and qualitatively, but also offers insights into the alteration of soybean quality during domestication and breeding processes (Abstract, last 3 lines). One of the identified regions located in chromosome 8 at locus 8.3-9.3 Mb (page 463, right column, para 2, line 1) comprises Glycine Max Aspartokinase-homoserine dehydrogenase (Gm AK-HSDH) which is next to Rhg4, one of the major cyst nematode resistance genes in soybean (page 463, right column, para 2, line 6-9; page 466, table 1). Zhang et al.(a) also identifies a miscoding mutation at the 3rd exon or mutation(s) in the promoter region of the AK-HSDH as the causal genetic variant (page 467, right column, last para, line 21-23; Fig. 4; Supplemental Fig. 10) that results in increased concentration of specific amino acids (page 463, right column, para 2, line 14-19; page 465, Fig. 4C-H). Zhang et al.(a) also describes that AK-HSDH is a bifunctional enzyme catalyzing the key steps of Asp phosphatization and aspartate-semialdehyde to homoserine by which all the crucial aspartate family amino acids (Lys, Thr, Met, and Ile) are synthesized in plants (page 463, right column, para 2, line 10-13). The locus (ss715602750 comprising AK-HSDH) is associated with Asp, Thr, and Lys content (p.463, right column, para 2, line 14-15; Table 1). Zhang et al.(a) describes a positive phenotypic and genetic correlations between total protein and all amino acids without altering or correcting for total protein content (page 461, right column, last para, line 1-3). Zhang et al.(a) teaches that the independence of the locus from total protein (content) makes it an ideal target for the modification of the amino acid profile in soybean seed, and thus useful for soybean meal improvement as well (page 467, right column, last para, line 18-21). However, Zhang et al.(a) neither describes a recombinant expression vector nor a AK-HSDH polypeptide encoded by the polynucleotide set forth by SEQ ID NO: 1. Zhang et al.(a) also does not explicitly describe increasing water-soluble protein content and protein content in soybean seeds. Nguyen et al. describes several QTLs linked with resistance to soybean cyst nematode (abstract). One of the QTLs, QTL9, is in chromosome 8 of soybean (G. max) and linked to Rhg4 locus (page 1, Table 1), as described by Zhang et al.(a) (as discussed above). The QTL comprises many genes including SEQ ID NO: 3385 which encodes a polynucleotide comprising 100% sequence identity to instant SEQ ID NO: 1, as shown below. RESULT 1 AZG84732 ID AZG84732 standard; DNA; 2751 BP. AC AZG84732; DT 26-MAY-2011 (first entry) DE Glycine max SCN QTL9 gene fragment sequence, SEQ ID 3385. KW chromosome-8; crop improvement; ds; genetic marker; nematode resistance; KW plant; plant breeding; transgenic plant. OS Glycine max. CC PN US2011083234-A1. CC PD 07-APR-2011. CC PF 02-OCT-2010; 2010US-00896864. PR 02-OCT-2009; 2009US-0278233P. CC PA (NGUY/) NGUYEN H T. CC PA (SLEP/) SLEPER D A. CC PI Nguyen HT, Sleper DA, Shannon JG, Vuong TD, Wu X; DR WPI; 2011-D68368/27. CC PT Generating soybean cyst nematode-resistant transgenic plant comprises CC PT introducing a gene located within the chromosomal region as defined by CC PT quantitative trait loci into the host plant. CC PS Disclosure; SEQ ID NO 3385; 52pp; English. CC The present invention relates to a method for generating a novel CC transgenic plant using a host plant, the transgenic plant being more CC resistant to soybean cyst nematode (SCN) when compared to the host plant. CC The method involves introducing a gene into the host plant, where the CC gene being located within the chromosomal region as defined by one CC quantitative trait loci (QTL) selected from SCN QTL1-11. The invention CC further relates to: (1) a plant resistant to at least one race of CC nematode; (2) a method for generating a soybean plant by determining the CC presence or absence of a marker gene or its fragment (AZG81348-AZG81369); CC and (4) a soybean plant generated by the above method. The method of the CC invention can be used for generating a novel transgenic plant that is CC more resistant to SCN when compared to the host plant. The present CC sequence is a Glycine max SCN QTL gene fragment sequence, used in the CC invention. XX SQ Sequence 2751 BP; 776 A; 535 C; 643 G; 797 T; 0 U; 0 Other; Query Match 100.0%; Score 2751; Length 2751; Best Local Similarity 100.0%; Matches 2751; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ATGGCGTCGTTTTCCGCCGCCGTCGCTCAGTTCTCCCGCGTTTCACCTTCTCACACTTCG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 ATGGCGTCGTTTTCCGCCGCCGTCGCTCAGTTCTCCCGCGTTTCACCTTCTCACACTTCG 60 Qy 61 CTCCACTCTCACTCTCACGGCACGCTCTTCCAATCTCAATGCCGCCCTTTCTTCCTCTCG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 CTCCACTCTCACTCTCACGGCACGCTCTTCCAATCTCAATGCCGCCCTTTCTTCCTCTCG 120 Qy 121 CGCACTTCCCATTCACTCCGGAAGGGTCTTACTTTACCACGGGGAAGAGAGGCACCGAGT 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 CGCACTTCCCATTCACTCCGGAAGGGTCTTACTTTACCACGGGGAAGAGAGGCACCGAGT 180 Qy 181 ACATCTGTACGTGCTTCATTTACAGATGTTTCACCGAATGTGTCCTTGGAGGAAAAACAA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 ACATCTGTACGTGCTTCATTTACAGATGTTTCACCGAATGTGTCCTTGGAGGAAAAACAA 240 Qy 241 CTACCCAAAGGAGAAACTTGGTCTGTTCACAAATTTGGTGGAACCTGTGTGGGAACCTCT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 CTACCCAAAGGAGAAACTTGGTCTGTTCACAAATTTGGTGGAACCTGTGTGGGAACCTCT 300 Qy 301 CAGAGAATAAAAAATGTTGCGGACATAATTCTTAAGGATGATTCGGAGAGGAAATTGGTG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 CAGAGAATAAAAAATGTTGCGGACATAATTCTTAAGGATGATTCGGAGAGGAAATTGGTG 360 Qy 361 GTTGTTTCTGCAATGTCAAAGGTGACAGATATGATGTATGACCTTATCCACAAGGCTCAA 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 GTTGTTTCTGCAATGTCAAAGGTGACAGATATGATGTATGACCTTATCCACAAGGCTCAA 420 Qy 421 TCACGCGATGAGTCTTATACAGCTGCATTAAATGCTGTTTTGGAGAAGCACAGTGCAACT 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 TCACGCGATGAGTCTTATACAGCTGCATTAAATGCTGTTTTGGAGAAGCACAGTGCAACT 480 Qy 481 GCACATGACATACTTGATGGAGATAATCTTGCTACTTTCTTGTCTAAATTGCATCATGAT 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 GCACATGACATACTTGATGGAGATAATCTTGCTACTTTCTTGTCTAAATTGCATCATGAT 540 Qy 541 ATTAGTAACCTTAAGGCGATGCTTCGTGCAATATACATAGCTGGTCATGCAACAGAGTCC 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 ATTAGTAACCTTAAGGCGATGCTTCGTGCAATATACATAGCTGGTCATGCAACAGAGTCC 600 Qy 601 TTTACAGATTTTGTTGTGGGACATGGAGAATTATGGTCTGCTCAGATGTTGTCTCTAGTT 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 TTTACAGATTTTGTTGTGGGACATGGAGAATTATGGTCTGCTCAGATGTTGTCTCTAGTT 660 Qy 661 ATTAGGAAGAATGGGACTGATTGCAAATGGATGGATACAAGGGATGTCCTTATCGTAAAT 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 ATTAGGAAGAATGGGACTGATTGCAAATGGATGGATACAAGGGATGTCCTTATCGTAAAT 720 Qy 721 CCTACTGGTTCTAATCAAGTTGATCCTGACTATTTGGAATCTGAGCAAAGACTTGAAAAA 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 CCTACTGGTTCTAATCAAGTTGATCCTGACTATTTGGAATCTGAGCAAAGACTTGAAAAA 780 Qy 781 TGGTACTCTTTGAATCCATGTAAGGTAATCATTGCCACTGGATTCATTGCAAGCACACCT 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 TGGTACTCTTTGAATCCATGTAAGGTAATCATTGCCACTGGATTCATTGCAAGCACACCT 840 Qy 841 CAAAACATTCCTACCACACTGAAGAGAGATGGAAGTGACTTCTCGGCAGCAATTATGGGT 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 CAAAACATTCCTACCACACTGAAGAGAGATGGAAGTGACTTCTCGGCAGCAATTATGGGT 900 Qy 901 GCTCTATTTAAGGCTCGTCAGGTCACAATTTGGACAGATGTTGATGGTGTGTATAGTGCA 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 GCTCTATTTAAGGCTCGTCAGGTCACAATTTGGACAGATGTTGATGGTGTGTATAGTGCA 960 Qy 961 GATCCTAGAAAAGTTAGTGAGGCTGTGATTTTGAAGACACTGTCTTATCAAGAGGCTTGG 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 GATCCTAGAAAAGTTAGTGAGGCTGTGATTTTGAAGACACTGTCTTATCAAGAGGCTTGG 1020 Qy 1021 GAAATGTCTTATTTTGGTGCCAATGTCTTGCATCCCCGCACAATTATTCCTGTGATGCGA 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1021 GAAATGTCTTATTTTGGTGCCAATGTCTTGCATCCCCGCACAATTATTCCTGTGATGCGA 1080 Qy 1081 TATGGCATACCCATTATGATAAGGAACATTTTCAACCTTTCTGCTCCTGGAACAAAGATC 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1081 TATGGCATACCCATTATGATAAGGAACATTTTCAACCTTTCTGCTCCTGGAACAAAGATC 1140 Qy 1141 TGCCATCCTTCTGTTAATGATCATGAAGATAGCCAGAACCTGCAAAATTTTGTCAAAGGA 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1141 TGCCATCCTTCTGTTAATGATCATGAAGATAGCCAGAACCTGCAAAATTTTGTCAAAGGA 1200 Qy 1201 TTTGCAACCATAGACAACTTGGCACTTGTAAACGTCGAGGGAACTGGAATGGCTGGTGTT 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1201 TTTGCAACCATAGACAACTTGGCACTTGTAAACGTCGAGGGAACTGGAATGGCTGGTGTT 1260 Qy 1261 CCAGGTACTGCCAGTGCTATTTTTGGTGCAGTAAAAGATGTTGGAGCTAATGTTATCATG 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1261 CCAGGTACTGCCAGTGCTATTTTTGGTGCAGTAAAAGATGTTGGAGCTAATGTTATCATG 1320 Qy 1321 ATATCTCAGGCTAGTAGTGAGCATTCTGTATGCTTTGCTGTGCCCGAGAAAGAAGTAAAA 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1321 ATATCTCAGGCTAGTAGTGAGCATTCTGTATGCTTTGCTGTGCCCGAGAAAGAAGTAAAA 1380 Qy 1381 GCTGTTGCTGAGGCATTGCAATCTAGATTTCGTCAAGCTTTGGATAATGGGCGTCTTTCT 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1381 GCTGTTGCTGAGGCATTGCAATCTAGATTTCGTCAAGCTTTGGATAATGGGCGTCTTTCT 1440 Qy 1441 CAGGTTGCAGTCATTCCAAATTGTAGCATTCTGGCTGCAGTTGGCCAGAAAATGGCAAGC 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1441 CAGGTTGCAGTCATTCCAAATTGTAGCATTCTGGCTGCAGTTGGCCAGAAAATGGCAAGC 1500 Qy 1501 ACTCCTGGTGTTAGTGCCTCCCTTTTCAATGCATTGGCTAAGGCCAATATAAATGTCCGT 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1501 ACTCCTGGTGTTAGTGCCTCCCTTTTCAATGCATTGGCTAAGGCCAATATAAATGTCCGT 1560 Qy 1561 GCTATAGCCCAAGGTTGTTCTGAGTACAATATTACTGTTGTTGTTAAGCGAGAGGATTGT 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1561 GCTATAGCCCAAGGTTGTTCTGAGTACAATATTACTGTTGTTGTTAAGCGAGAGGATTGT 1620 Qy 1621 ATAAAGGCTTTACGAGCTGTCCATTCCAGATTTTATCTCTCAAGAACCACCATAGCAATG 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1621 ATAAAGGCTTTACGAGCTGTCCATTCCAGATTTTATCTCTCAAGAACCACCATAGCAATG 1680 Qy 1681 GGCATTATTGGACCTGGATTAATTGGGAGCACACTACTTGAGCAGCTAAGGGATCAGGCC 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1681 GGCATTATTGGACCTGGATTAATTGGGAGCACACTACTTGAGCAGCTAAGGGATCAGGCC 1740 Qy 1741 TCAACCCTAAAAGAAGAATTCAACATCGATTTGCGTGTAATGGGCATACTTGGTTCAAAG 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1741 TCAACCCTAAAAGAAGAATTCAACATCGATTTGCGTGTAATGGGCATACTTGGTTCAAAG 1800 Qy 1801 TCAATGCTTCTTAGTGATGTGGGCATTGACTTAGCTAGATGGAGAGAACTTCGAGAGGAA 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1801 TCAATGCTTCTTAGTGATGTGGGCATTGACTTAGCTAGATGGAGAGAACTTCGAGAGGAA 1860 Qy 1861 AGAGGAGAAGTGGCTAATATGGAAAAATTTGTTCAACATGTACATGGAAATCATTTTATA 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1861 AGAGGAGAAGTGGCTAATATGGAAAAATTTGTTCAACATGTACATGGAAATCATTTTATA 1920 Qy 1921 CCAAACACGGCATTAGTGGACTGCACAGCTGACTCTGTCATTGCTGGCTATTACTATGAT 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1921 CCAAACACGGCATTAGTGGACTGCACAGCTGACTCTGTCATTGCTGGCTATTACTATGAT 1980 Qy 1981 TGGTTGCGCAAAGGAATACATGTAGTTACTCCTAACAAGAAGGCAAATTCAGGACCACTT 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1981 TGGTTGCGCAAAGGAATACATGTAGTTACTCCTAACAAGAAGGCAAATTCAGGACCACTT 2040 Qy 2041 GATCAGTATTTGAAGTTAAGAGCTCTTCAAAGGCAATCCTATACACATTACTTCTATGAA 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2041 GATCAGTATTTGAAGTTAAGAGCTCTTCAAAGGCAATCCTATACACATTACTTCTATGAA 2100 Qy 2101 GCAACTGTCGGAGCTGGTCTTCCAATTGTTAGCACTTTACGTGGCCTCCTTGAAACTGGA 2160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2101 GCAACTGTCGGAGCTGGTCTTCCAATTGTTAGCACTTTACGTGGCCTCCTTGAAACTGGA 2160 Qy 2161 GACAAAATATTACAAATCGAAGGCATCTTTAGTGGGACTTTGAGTTACATATTTAATAAC 2220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2161 GACAAAATATTACAAATCGAAGGCATCTTTAGTGGGACTTTGAGTTACATATTTAATAAC 2220 Qy 2221 TTTAAAGATGGCCGGGCTTTTAGTGAGGTAGTTTCTGAAGCAAAGGAAGCAGGTTATACT 2280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2221 TTTAAAGATGGCCGGGCTTTTAGTGAGGTAGTTTCTGAAGCAAAGGAAGCAGGTTATACT 2280 Qy 2281 GAGCCAGATCCAAGAGATGATCTGTCTGGAACAGATGTTGCCAGAAAGGTTATAATTCTT 2340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2281 GAGCCAGATCCAAGAGATGATCTGTCTGGAACAGATGTTGCCAGAAAGGTTATAATTCTT 2340 Qy 2341 GCTAGGGAGTCGGGTTTAAAGCTAGAACTGTCTAATATTCCAGTTGAAAGCCTTGTGCCA 2400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2341 GCTAGGGAGTCGGGTTTAAAGCTAGAACTGTCTAATATTCCAGTTGAAAGCCTTGTGCCA 2400 Qy 2401 GAACCACTACGAGCTTGTGCATCAGCTCAGGAGTTTATGCAAGAGCTACCAAAATTTGAT 2460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2401 GAACCACTACGAGCTTGTGCATCAGCTCAGGAGTTTATGCAAGAGCTACCAAAATTTGAT 2460 Qy 2461 CAGGAGTTCACAAAGAAACAAGAAGATGCTGAGAATGCTGGGGAAGTCTTGAGATACGTT 2520 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2461 CAGGAGTTCACAAAGAAACAAGAAGATGCTGAGAATGCTGGGGAAGTCTTGAGATACGTT 2520 Qy 2521 GGAGTGGTGGACGTGACTAATAAAAAAGGAGTGGTAGAGCTGCGAAGATACAAGAAGGAT 2580 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2521 GGAGTGGTGGACGTGACTAATAAAAAAGGAGTGGTAGAGCTGCGAAGATACAAGAAGGAT 2580 Qy 2581 CATCCCTTTGCGCAATTGTCTGGGTCAGATAACATTATTGCATTTACAACACGAAGGTAT 2640 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2581 CATCCCTTTGCGCAATTGTCTGGGTCAGATAACATTATTGCATTTACAACACGAAGGTAT 2640 Qy 2641 AAGGATCAGCCTCTGATAGTTCGTGGGCCAGGAGCTGGTGCTCAAGTCACCGCTGGTGGA 2700 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2641 AAGGATCAGCCTCTGATAGTTCGTGGGCCAGGAGCTGGTGCTCAAGTCACCGCTGGTGGA 2700 Qy 2701 ATATTTAGTGATATTTTACGACTTGCCTCATATCTTGGTGCTCCATCGTAA 2751 ||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2701 ATATTTAGTGATATTTTACGACTTGCCTCATATCTTGGTGCTCCATCGTAA 2751 Nguyen et al. teaches that the genes underlying the QTL regions discovered in the soybean plants can be introduced into other soybean varieties or germplasm using various methods including transgenic approaches (page 3, para 0030, line 8-11) using expression vectors that are well known and readily available to those with skill in the art (page 5, para 0044, line 9-10). Yoshinobu et al. describes increase in water-soluble protein content and lysine content in barley when lysine biosynthetic system is activated by enzymes including homoserine dehydrogenase (HSDH) (Abstract). Zhang et al.(b) describes that soybean proteins usually are fairly soluble in water, and only water-soluble protein can be processed and utilized in traditional soyfoods (abstract). Therefore, water-soluble protein content (WSPC) is a critical factor in both food quality and the production of isolated soybean proteins (abstract). Before the effective filing date of the invention, it would have been obvious to an ordinarily skilled artisan to clone the specific allele of Glycine Max Aspartokinase-homoserine dehydrogenase (GmAK-HSDH) gene, which is closely linked to a major cyst nematode resistance gene (Rhg4) in soybean, as described by Zhang et al.(a), in a known plant expression vector. Use of a plant expression vectors including plasmid pBA002 (Hamera et al., page 1732, right column, para 2, line 4) (as recited by claims 1 and 14) and using homologous recombination in conjunction with restriction enzymes (restriction endonuclease) (as recited in claim 14) to clone polynucleotide sequence(s) (Rozwadowski et al., Homologous recombination-mediated cloning and manipulation of genomic DNA regions using Gateway and recombineering systems, 2008, BMC Biotechnol. 8:88) in a vector are routine and standard practices in the art and are among the experimental design choices of an ordinarily skilled artisan without affecting the outcome. It would also have been obvious to an ordinarily skilled artisan to activate the lysine biosynthetic system by overexpressing the crucial enzyme AK-HSDG, which is shown to be affecting biosynthesis of all the crucial aspartate family amino acids (Lys, Thr, Met, and Ile) as describes by Zhang et al.(a), in a soybean plant. Given that soybean genome is published before the effective date of the invention, an ordinarily skilled artisan would have identified the (GmAK-HSDH) gene which is closely linked to the cyst nematode resistance gene (Rhg4) in soybean plants, as described by Nguyen et al. A standard search for the soybean AK-HSDH gene (and/or the AK-HSDH protein) in the soybean genome database identifies several GmAK-HSDH genes. One such gene is described by Nguyen et al. The specific QTL (QTL9) comprising the GmAK-HSDH allele in chromosome 8 (linked to Rgh4 locus) comprising 100% sequence identity to instant SEQ ID NO: 1, is described by Nguyen et al. An ordinarily skilled artisan would have also identified the polynucleotide or polypeptide sequence of AK-HSDH sequences from the 302 soybean lines described by Zhang et al.(a) (Supplemental Fig. 10) in a soybean plant or in the QTL (as described by Nguyen et al.) given that the soybean genomic sequences are published. Regenerating transgenic soybean plants after positive screening and harvesting transgenic seeds to raise subsequence generations and for breeding purpose are well known, routine and standard practices in the art. Before the effective filing date, one with ordinary skill in the art would have been motivated to develop a method using Agrobacterium mediated transformation using a recombinant vector containing the gene GmAK-HSDH comprising SEQ ID NO: 1 cloned in a plant expression vector backbone (including pBA002) and harvesting seeds from selected regenerated plants with a realistic objective to modify amino acid profile in the transgenic soybean seeds, and, thus improve the quality of soybean meal, as described by Zhang et al.(a). Using cotyledonary node explant to efficiently transform soybean via Agrobacterium-mediated process is well known in the art and can be used by the ordinarily skilled artisan to improve transformation efficiency in the soybean explants, as described by Paz et al. (title and abstract). Moreover, the ordinary skilled artisan also would have been motivated to improve commercially important trait of water-soluble protein content in soybean, as described by Zhang et al.(b), by activating the lysine biosynthetic pathway by overexpressing the crucial GmAK-HSDG enzyme, as described by Yoshinobu et al. Regarding claim 11; claim 11 is drawn to the soybean variety JACK. Soybean variety JACK is a well-known soybean variety comprising the economically valuable trait of cyst nematode resistance (Martin et al., page 7, para 2, line 3). It would have been obvious to an ordinarily skilled artisan to undertake any well-known and standard breeding method (e.g. introgression) to combine the cyst nematode resistance, as present in JACK, with improved quality of soybean meal associated with introducing and expressing the aspartate kinase/homoserine dehydrogenase encoded by instant SEQ ID NO: 1, as discussed above, in any elite soybean variety including JACK. Regarding claim 13; Use of Agrobacterium tumefaciens strain EHA105 is well known to transform plants. It has also been successfully used for transforming soybean cotyledonary node explants (Liu et al., Factors influencing Agrobacterium-mediated cotyledonary-node transformation of soybean (Glycine max L.), 2007, Fen Zi Xi Bao Sheng Wu Xue Bao, 40:286-94.; In Chinese) and can be used by an ordinarily skilled artisan. Regarding claim 15; Using specific set of primers to clone a specific polynucleotide sequence including GmAK-HSDH comprising SEQ ID NO: 1 is well known and standard process in the art. Using any suitable primer pair including SEQ ID NO: 5 and SEQ ID NO: 6 would have been an experimental design choice of an ordinarily skilled artisan without affecting the outcome of the invention. Moreover, SEQ ID NO: 5 comprises a 100% sequence identity with the GmAK-HSDH comprising SEQ ID NO: 1 starting at nucleotide position 1 of 2751 nucleotide long SEQ ID NO: 1 while SEQ ID NO: 6 comprises a 100% sequence identity with the GmAK-HSDH comprising SEQ ID NO: 1 ending at nucleotide position 2751 in instant SEQ ID NO: 1, which is also described by SEQ ID NO: 3385 of Nguyen et al. Response to Applicant’s Arguments Applicant’s Arguments dated 6/11/2026 regarding claim Rejections under 35 USC 103 are fully considered but not found persuasive. The Applicant argues “… the prior art would not have motivated those skilled in the art to mediate the soybean plant using Agrobacterium tumefaciens carrying the specific recombinant expression vector to generate the transgenic soybean plant, thereby harvesting transgenic soybean seeds, for the purpose of increasing the water-soluble protein content and protein content in soybean seeds” (response, bridging paragraph between P.3-4). The Applicant alleges, “… increasing the content of specific amino acids through biological regulation does not necessitate or equate to an increase in total protein content, as their genetic controls are independent. Therefore, the applicant contends that it would be not obvious to a person skilled in the art to "increase the commercially important traits of total protein and water-soluble protein in soybean by activating the lysine biosynthetic pathway by overexpressing the crucial GmAK-HSDH enzyme", (response, p.7, last para, line 5-10). The Applicant argues, “barley (Poaceae) and soybean (Fabaceae) are distantly related crops belonging to different families, and there are fundamental differences in their nitrogen metabolism and amino acid biosynthesis regulatory systems… Based on the core metabolic differences between species, a person skilled in the art would not make a direct analogy of metabolic mechanisms across different families (Fabaceae VS. Poaceae), and thus would not extrapolate from the findings in barley to presume that soybean is subject to the same mechanistic limitations” (response, bridging paragraph between p.8-9). The Applicant continues to argue, “the applicant contends that the prior art merely provides a macroscopic concept of "enzyme activation" that provides no teaching or suggestion whatsoever for the technical solution of the present application, and completely fails to disclose the specific genetic engineering means required to actualize this objective in soybeans. It is well-known in the art that soybean is a notoriously recalcitrant species for genetic transformation, characterized by low transformation efficiency and high genotype dependency. Therefore, merely presenting a theoretical biological concept of uncertain applicability is entirely insufficient for a person skilled in the art to arrive at a workable solution; translating such a macroscopic concept into a specific, functional genetic construct presents a substantial technical hurdle” (response, p.10, last para, line 1-10). The Examiner disagrees. Successful genetic transformation of soybean explants including cotyledonary node via Agrobacterium mediated transformation and regenerating transgenic plants producing seeds is a well-known and routine method in the art (Paz et al.; Title and abstract). Using any specific Agrobacterium strain including EHA105 and a specific vector backbone including pBA002 are experimental design choices of any ordinarily skilled artisan without affecting the outcome. The claimed invention boils down to overexpressing the soybean homoserine dehydrogenase (GmAK-HSDH) protein encoded by the polynucleotide sequence set forth by instant SEQ ID NO: 1 in a soybean plant. There is no other active step involved “for increasing water-soluble protein content and protein content” in the transgenic soybean plants and seeds thereof. It is the inherent property and an inherent function of the GmAK-HSDG protein to increase water soluble protein and protein content when overexpressed in a soybean plant, considering the teaching of Yoshinobu et al. that describes increase in water-soluble protein content and lysine content in barley when lysine biosynthetic system is activated by enzymes including homoserine dehydrogenase (HSDH) (Abstract). Moreover, the obviousness and the motivation for overexpressing the GmAK-HSDH protein encoded by the polynucleotide sequence set forth by instant SEQ ID NO: 1 by an ordinarily skilled artisan does not need to be the same as in the instant invention (See MPEP ¶2143). As discussed above, there are credible motivations to overexpress the GmAK-HSDH protein encoded by the polynucleotide sequence set forth by instant SEQ ID NO: 1 with a reasonable expectation of success to modify the amino acid profile and, thus, improve soybean meal quality ((as described by Zhang et al. (a)) as well as to improve commercially important trait of water-soluble protein content in soybean, as described by Zhang et al.(b), by activating the lysine biosynthetic pathway by overexpressing the GmAK-HSDG enzyme, as described by Yoshinobu et al, as discussed above. The Applicant did not provide any evidence to support their opinion based on “the core metabolic differences between species” (barley and soybean) to conclude that the traits associate with overexpression of AK-HSDH in barley would not be valid for soybean. Applicant’s opinion cannot take the place of evidence. See MPEP 716.01(c)(II), 2145(I). Conclusion No claim is allowed. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Contact Information Any inquiry concerning this communication or earlier communications from the examiner should be directed to JAY CHATTERJEE whose telephone number is (703)756-1329. The examiner can normally be reached (Mon - Fri) 8.30 am to 5.30 pm.. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at (571) 270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. Jay Chatterjee Patent Examiner Art Unit 1662 /Jay Chatterjee/ Examiner, Art Unit 1662 /BRATISLAV STANKOVIC/ Supervisory Patent Examiner, Art Units 1661 & 1662
Read full office action

Prosecution Timeline

Nov 14, 2024
Application Filed
Apr 03, 2026
Non-Final Rejection mailed — §103
Jun 11, 2026
Response Filed
Aug 17, 2026
Final Rejection mailed — §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12703870
REGULATION OF ROOT DEVELOPMENT
2y 2m to grant Granted Aug 11, 2026
Patent 12662514
METHODS TO BLOCK APHID TRANSMISSION OF POLEROVIRUSES AND TO DEVELOP VIRUS MANAGEMENT TOOLS
3y 6m to grant Granted Jun 23, 2026
Patent 12649926
USE OF MfERF026 GENE REGULATION IN GROWTH, DEVELOPMENT, AND STRESS TOLERANCE OF MEDICAGO SATIVA
2y 1m to grant Granted Jun 09, 2026
Patent 12642203
TOMATO PLANTS RESISTANT TO TOBRFV, TMV, TOMV AND TOMMV AND CORRESPONDING RESISTANCE GENES
2y 12m to grant Granted Jun 02, 2026
Patent 12635627
PLANTS RESISTANT TO INFECTION BY PEPINO MOSAIC VIRUS
2y 5m to grant Granted May 26, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
46%
Grant Probability
99%
With Interview (+80.0%)
2y 7m (~8m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 22 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month