DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election without traverse of Group II, consisting of claims 15, 18-22, 24 & 26, in the reply filed on 15 May 26 is acknowledged.
Claim Status
Claims 15, 18-20, 22 & 28-35 are under examination on the merits.
Claims 1-14, 16-17, 21 & 23-27 are canceled.
Priority
Claims 15, 18-20, 22 & 28-35 receive the U.S. effective filing date of 16 May 2022.
Claim Objections
Claims 15 & 22 are objected to because of the following informalities:
- Claim 15; use of proper articles; the claim introduces ‘…the Cannabis plant…’ (line 3), and, ‘…the one or more markers…’ (line 5) which are referenced in subsequent dependent claims. Use of ‘the’ specifies a previously introduced object in the claim set. Because it is the first introduction of both of these objects, they require use of the articles a/an.
- Claim 22; Typographical error; the amended claim 22 references a method from canceled claim 21. This appears to be a typographical error/omission and likely the amended claim 22 is meant to depend from method of claim 15.
Appropriate correction is required.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 15, 18-20, 22 & 28-35 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a natural phenomenon without significantly more. The claims recite genetic diagnosis of a naturally occurring sequence in Cannabis associated with autoflowering. This judicial exception is not integrated into a practical application because genetic predisposition to a particular phenotypic trait, and its diagnosis via genotyping, is a description of a naturally occurring phenomenon. Additionally, cross-pollination and production of progeny is a natural phenomenon in Cannabis populations. The claims do not include additional elements that are sufficient to amount to significantly more than the judicial exception because they merely diagnose a gene or describe gene transfer via reproduction.
The claims are drawn to identifying the naturally occurring alleles of PRR37 associated with autoflowering in Cannabis plants. This is a natural phenomenon because diagnosis of the claimed genetic sequence is merely a descriptive characterization of genomic DNA from Cannabis.
Claim 15 recites the additional element that genetic or molecular markers are used to identify a truncation or deletion in the endogenous PRR37 gene and that such plants are ‘selected’. However, Applicant is diagnosing naturally occurring genetic variation (i.e. an endogenous allele or gene) in Cannabis. The autoflowering phenotype has long been recognized from various subpopulations of Cannabis [see p.115, ¶3 in Clarke, Marijuana Botany (1981) Ronin Publishing Inc., ISBN 0-914171-78-X; Published 1981] and Applicant’s disclosure indicates they are not generating the mutant allele or phenotype, but merely characterizing existing genetic variation from within the genus (i.e. endogenous PRR37 mutants).
Absent an additional active method step, ‘selecting a plant’ is simply the mental act of identifying an organism for use of some sort. Claims do not indicate Applicant is actively generating mutations impacting the gene, genetically modifying or otherwise performing any active step beyond characterizing photoperiod sensitivity using genotyping. Thus, this claim is not directed to significantly more than a natural phenomenon.
Claim 18 recites the additional element of an oligonucleotide probe designed to amplify the sequence containing the naturally occurring gene for autoflowering, comprising the marker SEQ ID NO.225. However, this is merely describing the detection tool used to diagnose the naturally occurring gene, as in claim 15. Thus, this claim is not directed to significantly more than use of routine diagnostic tools directed to a natural phenomenon.
Claims 19-20 & 22 recite the additional elements of the gene sequence and alleles of the gene (i.e. wherein one or more markers comprise polymorphism at position 26 of SEQ ID NO.225, and, variants of <100% identity to SEQ ID NO.211 & 224). However, this merely indicates the underlying sequences of a naturally occurring genetic factor to be diagnosed, as in claim 15. Thus, claims 19-20 & 22 are not directed to significantly more than a natural phenomenon.
Claims 28-35 recite the additional elements of the crossing of Cannabis plants comprising autoflowering markers (i.e. alleles or polymorphic sequences) to other plants. Cannabis is an outcrossing, dioecious species with genetically distinct male and female plants that cross-pollinate in natural populations. Autoflowering forms of Cannabis, which would comprise genetic markers for autoflowering activity, would naturally cross to other plants, and generate both seeds and progeny with the inherent genetic markers for the endogenous autoflowering phenotype.
As such, all claims are drawn to the diagnosis of a naturally occurring allele and cross-pollination to generate progeny in Cannabis plants, which naturally occurs. These are natural phenomena and absent additional inventive steps, claims 15, 18-20, 22 & 28-35 are rejected.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 15, 18-20, 22, 28-35 are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Barrera [WIPO WO2022/232811A1; filed 28 Apr 2022].
Claims are drawn to breeding autoflowering (i.e. photoperiod insensitive) Cannabis plants via use of molecular markers that detect truncation or deletion (i.e. loss-of-function mutations) in the endogenous PRR37 gene. Claims are drawn to use of oligonucleotide primers to detect sequence polymorphisms and the crossing or vegetative propagation of plants comprising markers of PRR37 alleles to generate progeny plants, including F1 hybrids, that are autoflowering.
The WIPO filing of Barrera discloses methods of using one or more molecular markers to select for autoflowering Cannabis plants via marker-assisted selection of linked markers [¶.26]. Barrera discloses alleles of the PRR37 gene that can be used for selecting autoflowering, including those of 30-100% sequence similarity to PRR37 orthologs from other species [¶96-97]. Barrera discloses markers consisting of SNPs which lead to loss-of-function of PRR37 in Cannabis, and thus generate autoflowering plants [¶100-102]. They disclose use of oligonucleotide probes and PCR procedures to identify polymorphisms in the PRR37 gene, in Cannabis [¶149].
Barrera discloses the causative SNP of the PRR37 mutation, which is a ‘G’ to ‘T’ polymorphism at position 19,988,827 represented by their SEQ ID NO.3 [¶199]. For comparison, this sequence is:
Barrera, SEQ ID NO.3 …acatgcaaggacatccctgtaatta T tgagtatatttcctttattttggat…
Applicant, SEQ ID NO.225 …acatgcaaggacatccctgtaatta G tgagtatatttcctttattttggat…
Thus, the functional mutation and marker polymorphism locus claimed by Applicant is identical to that described by Barrera (i.e. this is the same functional SNP or allele).
Regarding methods of using selected plants; Barrera discloses pollination-based methods of breeding as well as generation of doubled-haploids [¶114]. They also describe methods of vegetative propagation [¶87] and of transgenic and/or gene editing of Cannabis plants with altered PRR37 alleles [¶121-122].
Barrera clearly describes and anticipates all claim limitations as well as the specific allele and marker(s) being claimed by Applicant, prior to the effective filing date of the instant application. As such, claims 15, 18-20, 22 & 28-35 are rejected.
Conclusion
No claims are allowed.
Contact Information
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEITH R WILLIAMS whose telephone number is (571)272-3911. The examiner can normally be reached Mon - Fri, 9:30 - 5:30 EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad Abraham can be reached on (571)270-7058. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/KEITH R. WILLIAMS/Examiner, Art Unit 1663
/Amjad Abraham/SPE, Art Unit 1663