DETAILED ACTION
Notice of Pre-AIA or AIA Status
1. The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
2. The Preliminary Amendment filed on November 21, 2024, have been received and entered.
Claim Disposition
3. Claims 1-20 are pending and are under examination.
Information Disclosure Statement
4. The Information Disclosure Statements filed on June 2, 2026 and November 21, 2024, have been received and entered. The references cited on the PTO-1449 Form have been considered by the examiner and a copy is attached to the instant Office action.
Abstract
5. The abstract is objected to for the following informalities:
“The purpose of the present invention is to enhance [[ergothioneine productivity in]] ergothioneine production [[through]] by culturing [[of]] an ergothioneine-producing filamentous fungus [[. In the present invention]], where a genetic mutation that enhances ergothioneine production [[in an ergothioneine-producing filamentous fungus]] is identified. [[The present invention provides:]] Additionally, a nucleic acid [[that includes]] with a conserved region at positions 433-440 in SEQ ID [[NO. 1]] NO: 1 and that has, in a sequence corresponding to SEQ ID [[NO. 1]] NO: 1, a deletion of a region included in a functional domain corresponding to a functional domain at W404-Q515 in SEQ ID [[NO. 1]] NO: 1; and a filamentous fungus having said nucleic acid”.
Specification Objection
6. The specification is objected to for the following informalities:
The title of the invention is not descriptive. A new title is required that is clearly indicative of the invention to which the claims are directed. The following is suggested: "Nucleic acid and microorganism modified to produce enhanced ergothioneine".
The specification is objected to because the organism names are not consistently italicized throughout the specification see page 1, for example, ‘Basidiomycetes’ and FIG 2.
The specification is also objected to because it contains an embedded hyperlink and/or other form of browser-executable code. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code. See MPEP § 608.01. See page 30, for example. It is suggested that http:// is deleted.
The specification is objected to because the foreign language is found on line 25, page 31 and the application must be in English.
Appropriate correction is required.
Drawing
7. The drawings filed on November 21, 2024, are accepted by the examiner (however, see commentary above about FIG. 2).
Claim objection
8. Claims 1-20 are objected to for the following informalities:
For clarity and precision of claim language it is suggested that claim 1 is amended to recite “A nucleic acid that encodes an ergothioneine amino acid sequence set forth in SEQ ID NO:1, wherein the amino acid sequence has a mutation within a domain having residues W404 to Q515 of SEQ ID NO:1, wherein the function of the domain is modulated to enhance ergothioneine production with introduction of the nucleic acid into an ergothioneine-producing microorganism and wherein residues 433 to 440 is conserved within SEQ ID NO:1”, because the claim language lacks clarity and is redundant. The dependent claims hereto are also included.
For clarity it is suggested that claims 2-12 and 14-20 are amended to recite, “of” in lieu of “according to”.
For clarity it is suggested that claims 3-9 are amended to read, “The nucleic acid of….”.
For clarity it is suggested that claim 9 is amended to read, “…..wherein the nucleic acid is a microbial nucleic acid obtained from [[derived from]] a microorganism…. Talaromyces [[microorganisms]]”. See claim 13 with similar language.
For clarity it is suggested that claims 10-11 are amended to delete “including” and instead recite “comprising”. See also claims 4 and 16 with similar language.
For clarity and precision of claim language it is suggested that claim 12 is amended to read, “a method for producing ergothioneine [[which comprises]] comprising:
culturing [[a]] the microorganism [[according to]] of claim 11”.
For clarity it is suggested that claim 13 is amended to read, “ A method for producing a microorganism with enhanced ergothioneine production ability, [[wherein the method comprises]], comprising:
introducing……”. The dependent claims hereto are also included.
For clarity it is suggested that claims 14-20 are amended to read, “The method of claim….”.
For clarity it is suggested that claim 15 is amended to read, “…..wherein the conserved region is [[the conserved region]] from position….”.
For clarity it is suggested that claim 16 is amended to read, “….deleted region[[includes the position corresponding to]] comprises position 428…..”.
For clarity it is suggested that claim 17 is amended to read, “….wherein the deleted region comprises [[a deletion of]] 1 to 120 amino acids’’.
For clarity it is suggested that claim 18 is amended to read, “….wherein the deleted [[region is a region corresponding to one or more regions]] position is selected from…..”. See also claim 19 with similar language.
Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
9. Claims 1-20 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AlA), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or
a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The claimed invention is directed to “a nucleic acid coding for a sequence of SEQ ID NO:1 (see claim 1 in its entirety). The invention is not adequately described because there are no indicia in the claim language that the expression product is an ergothioneine amino acid. There is no defined conserved region or a clear indication that at least 90% or a possible deletion of the entire region of 404 to 515 (111 amino acids) garners a functional amino acid structure. The claimed invention encompasses a large variable genus of structures that are not adequately described, note that claim 17 recites deletion of 1 to 120 amino acids with the open language of comprising, thus not limited. The art generally recognizes for example, a single amino acid change can be detrimental to the proteins structure -function relationship. No correlation is made between structure and function, and the deleted region overlaps with the conserved region which could affect function. No specific ergothioneine producing organism is provided in claim 1, which makes the genus vast. The claimed invention provides organisms from which the nucleic acid is derived, however, does not provide the ergothioneine producing organism and there are no indicia in the claims that they are the same organism.
Thus the claimed invention is overly broad and not commensurate in scope with the disclosure in the specification, and does not demonstrate possession of the large genus. The specification fails to provide a representative number of species for the claimed genus to show that applicant was in possession of the claimed genus. A representative number of species means that the species, which are adequately described, are representative of the entire genus.
The written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, disclosure of drawings, or by disclosure of relevant identifying characteristics, for example, structure or other physical and/or chemical properties, by
functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. Vas-Cath Inc. v. Mahurkar, 935 F.2d 1555, 1563-64, 19 USPQ2d 1111, 1117 (Fed. Cir. 1991), states that "applicant must convey with reasonable clarity to those skilled in the art that, as of the filing date sought, he or she was in possession of the invention. The invention is, for purposes of the ‘written description’ inquiry, whatever is now claimed" (See page 1117). The specification does not "clearly allow persons of ordinary skill in the art to recognize that [he or she] invented what is claimed" (See Vas-Cath at page 1116). The skilled artisan cannot envision the detailed chemical structure of the encompassed genus, and therefore, conception is not achieved until reduction to practice has occurred, regardless of the complexity or simplicity of the method of isolation. Adequate written description requires more than a mere statement that it is part of the invention and reference to a potential method of isolating it. The compound itself is required. See Fiers v. Revel, 25 USPQ2d 1601 at 1606 (CAFC 1993).
Therefore, for all these reasons the specification lacks adequate written description, and one of skill in the art cannot reasonably conclude that the applicant had possession of the claimed invention at the time the instant application was filed.
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
10. Claims 1-20 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claims 1, 3, 8, 13-14 and 20 are indefinite with the recitation of, “modulated/modulates” because the term in ambiguous since it can mean an increase or decrease. The claims recite ‘modulates the function’ but it is unclear if modulate is up or down in the claimed invention.
Claim 1 is ambiguous for the recitation of, “..a sequence corresponding to the sequence of SEQ ID NO:1, comprising a conserved region within SEQ ID NO:1, wherein the sequence has a mutation in a region within a functional domain corresponding to the functional domain of W404 to Q515 of SEQ ID NO:1…”, because it is not clear what the ‘conserved region is in the sequence, is it everything other than residues 404-515 or all of the sequence and the mutation is simply an exception.
In addition, claim 1 lacks clarity with respect to the ‘functional domain’ because there is no limitation to the mutation in the functional domain and there is no defined mutation in the region provided.
Claim 1 lacks clarity with regard to the structure being the amino acid sequence of an ergothioneine because the claim language does not recite, for example, ‘a nucleic acid encoding an ergothioneine set forth in SEQ ID NO:1”, instead it recites that the nucleic acid enhances ergothioneine production in an ergothioneine-producing microorganism. The dependent claims hereto are also included.
Claim 13 is indefinite for the recitation of a mutated position in the region disclosed as a conserved region (see claim 1 for example). The language in the claims do not establish for example that the mutation can occur in residues 404-432 and 441-515 with the conserved region being 433-440 (the independent claim has a mutation in the region of 404-515 which encompasses the conserved region). See also claim 18 which recites positions 427-440, position 427-444 and position 419-444; claim 19 with 431-475, 419-475 and 404-515; and claim 20 with position 459, as deleted regions that overlap with the conserved region.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
11. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
12. Claim(s) 1 and 13 is/are rejected under 35 U.S.C. 103 as being unpatentable over WO2016/121285 (of record in the application) in view of Database Accession No. EY430249.1 (see below alignment).
The primary reference discloses: (1) an enzyme that catalyzes a reaction wherein hercynylcysteine sulfoxide is synthesized from histidine and cysteine in the presence of S-adenosyl methionine, iron (II) and oxygen; and (2) a nucleic acid encoding an enzyme that catalyzes a reaction wherein ergothioneine is synthesized from hereynyleysteine sulfoxide using pyridoxal 5'-phosphate as a coenzyme. Moreover, the primary reference discloses that said nucleic acid was used to transform a filamentous fungus belonging to the genus Aspergillus such as Aspergillus oryzae; and that said transformed filamentous fungus exhibited a greater yield of ergothioneine than the host filamentous fungus. Specifically, the primary reference discloses that genes designated "AsEgtA," "AsEgtB," and "AsEgtC" were isolated from Aspergillus oryzae, and when these genes in Aspergillus oryzae were genetically engineered, the ergothioneine production was greater than in Aspergillus oryzae that had not been transformed thereby. (In particular, see claims, and examples)
The primary reference does not expressly teach a mutation in the region of amino acids 404-515, however, such a structure is known in the art since the database (Accession No. EY430249.1) has a structure with a mutation in SEQ ID NO:1 in the 515 position (see the below alignment), in an Aspergillus oryzae.
Therefore, it would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to arrive at the claimed invention as a whole because the combined teaching of the references render the claimed invention as obvious. One of ordinary skill in the art would be motivated to combine the references because they are analogous art. Moreover, the Supreme Court pointed out in KSR, “a patent composed of several elements is not proved obvious merely by demonstrating that each of its elements was, independently, known in the prior art.” KSR, 127 S. Ct. at 1741. The Court thus reasoned that the analysis under 35 U.S.C. 103 "need not seek out precise teachings directed to the specific subject matter of the challenged claim, for a court can take account of the “inferences and creative steps that a person of ordinary skill in the art would employ.” Id. at 1741. The Court further advised that “[a] person of ordinary skill is…a person of ordinary creativity, not an automation.” Id. at 1742. Therefore, the claimed invention was obvious to make and use at the time the invention was made and was prima facie obvious.
RESULT 1
EY430249
LOCUS EY430249 1226 bp mRNA linear EST 27-MAY-2008
DEFINITION ZY093730 Aspergillus oryzae EST Library Aspergillus oryzae cDNA 5',
mRNA sequence.
ACCESSION EY430249
VERSION EY430249.1
DBLINK BioSample: SAMN00164679
KEYWORDS EST.
SOURCE Aspergillus oryzae
ORGANISM Aspergillus oryzae
Eukaryota; Fungi; Dikarya; Ascomycota; Pezizomycotina;
Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspergillaceae;
Aspergillus; Aspergillus subgen. Circumdati.
REFERENCE 1 (bases 1 to 1226)
AUTHORS Vongsangnak,W., Olsen,P., Krogsgaard,S., Nielsen,J. and Hansen,K.
TITLE Improved annotation through genome-scale metabolic modeling of
Aspergillus oryzae
JOURNAL BMC Genomics 9 (1), 245 (2008)
PUBMED 18500999
COMMENT Contact: Peter Bjarke Olsen
Bioinformatics
Novozymes
Krogshojvej 36 DK-2880 Bagsvard Denmark
Tel: +45 44463893
Email: pbo\@novozymes.com.
FEATURES Location/Qualifiers
source 1..1226
/organism="Aspergillus oryzae"
/mol_type="mRNA"
/strain="A1560"
/db_xref="taxon:5062"
/clone_lib="SAMN00164679 Aspergillus oryzae EST Library"
ORIGIN
Alignment Scores:
Length: 1226
Score: 1390.00 Matches: 255
Percent Similarity: 100.0% Conservative: 2
Best Local Similarity: 99.2% Mismatches: 0
Query Match: 39.6% Indels: 0
Gaps: 0
US-18-867-974-1subW404XQ515X (1-657) x EY430249 (1-1226)
Qy 401 ProAlaAspXaaAsnAlaIleSerLysThrTyrGluAlaTyrAsnGlnAsnTyrGluLeu 420
|||||||||:::||||||||||||||||||||||||||||||||||||||||||||||||
Db 3 CCAGCTGACTGGAATGCTATCTCTAAAACATACGAAGCCTACAATCAAAACTACGAGCTC 62
Qy 421 AspAsnLeuTrpTyrLeuSerGlyLeuGlnGlnProAspTrpArgGlyLeuValAlaAla 440
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 63 GATAACCTGTGGTATCTCTCGGGCCTACAACAGCCGGATTGGCGTGGGTTAGTAGCTGCT 122
Qy 441 ValAspSerHisTyrGlnValPheHisAsnGlySerPheAspCysProAlaProCysGlu 460
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 123 GTTGACAGCCATTACCAGGTCTTTCACAACGGTAGTTTTGACTGCCCAGCACCATGTGAG 182
Qy 461 AspGluAsnIleAsnHisIleLeuHisAlaAsnSerValSerGlyLeuArgTrpArgVal 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 183 GATGAGAATATCAACCATATCTTACACGCAAACTCTGTGTCGGGTTTACGGTGGAGAGTT 242
Qy 481 GlyGlyAspArgHisGlnValAlaArgAsnGluPheAlaSerSerIleThrArgAspVal 500
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 243 GGTGGGGATCGCCATCAAGTTGCCAGGAATGAGTTTGCAAGCAGCATCACCCGCGACGTT 302
Qy 501 SerArgIleIleArgAspAsnIleAlaThrLysHisGlyValXaaThrSerThrAspAsp 520
||||||||||||||||||||||||||||||||||||||||||:::|||||||||||||||
Db 303 TCTCGCATTATCCGTGATAATATCGCCACGAAGCATGGCGTTCAAACGTCAACCGACGAC 362
Qy 521 HisAlaProIleHisProSerAsnPheProProLeuProThrGlyLeuThrMetProAsn 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 363 CACGCTCCCATCCATCCATCAAATTTCCCGCCCCTCCCAACGGGTCTAACTATGCCAAAC 422
Qy 541 ProProThrThrSerGlnAlaProIleSerLeuArgIleAsnIleMetGlnAsnGlyLys 560
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 423 CCGCCCACAACCTCTCAAGCGCCAATATCTTTGCGAATTAATATCATGCAGAACGGGAAA 482
Qy 561 ArgValLeuProArgValAspLeuProAlaGlyHisCysProAspLeuGluThrLeuLys 580
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 483 CGTGTCCTTCCGCGAGTAGATCTTCCTGCAGGACACTGTCCCGATCTTGAGACTCTGAAA 542
Qy 581 GlnLeuLeuCysArgArgPheAlaGlyGlnLeuProGlyLeuProSerAspProSerLeu 600
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 543 CAGCTACTCTGCCGTCGATTCGCGGGCCAGTTGCCAGGTCTGCCCTCTGACCCTTCGCTG 602
Qy 601 AspProAlaAlaTrpMetSerSerValGlyTrpArgPheArgValTrpLeuProGluGly 620
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 603 GACCCTGCAGCCTGGATGTCTTCGGTTGGCTGGAGGTTTAGAGTCTGGTTGCCCGAGGGC 662
Qy 621 LeuThrProValGlnAsnAspGlyGluTrpThrIleAlaLeuLeuSerAlaGlyAsnVal 640
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 663 CTGACTCCTGTCCAGAATGACGGCGAGTGGACGATCGCACTGCTTTCTGCCGGGAACGTA 722
Qy 641 AspTrpMetAspGlyAspLeuArgValLeuValGluLeuGluAsnThrSer 657
|||||||||||||||||||||||||||||||||||||||||||||||||||
Db 723 GACTGGATGGACGGTGATCTACGAGTTCTTGTAGAGCTGGAGAACACCTCT 773
Conclusion
13. No claims are presently allowable.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to HOPE A ROBINSON whose telephone number is (571) 272-0957. The examiner can normally be reached 9-5pm on Monday to Friday.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Robert Mondesi can be reached on (408) 918-7584. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/HOPE A ROBINSON/Primary Examiner, Art Unit 1652
Prosecution Insights