Prosecution Insights
Last updated: July 17, 2026
Application No. 18/877,624

METHOD FOR EFFICIENT GENETIC TRANSFORMATION AND GENE EDITING OF BRASSICA CROP MEDIATED BY AGROBACTERIUM RHIZOGENES

Non-Final OA §103§112
Filed
Dec 20, 2024
Priority
May 08, 2024 — CN 202410562568.6 +1 more
Examiner
STOCKDALE, JESSICA NICOLE
Art Unit
1663
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Nanjing Suman Plasma Eri Co. Ltd.
OA Round
1 (Non-Final)
43%
Grant Probability
Moderate
1-2
OA Rounds
10m
Est. Remaining
87%
With Interview

Examiner Intelligence

Grants 43% of resolved cases
43%
Career Allowance Rate
13 granted / 30 resolved
-16.7% vs TC avg
Strong +44% interview lift
Without
With
+44.0%
Interview Lift
resolved cases with interview
Typical timeline
2y 5m
Avg Prosecution
27 currently pending
Career history
69
Total Applications
across all art units

Statute-Specific Performance

§101
0.6%
-39.4% vs TC avg
§103
69.8%
+29.8% vs TC avg
§102
8.9%
-31.1% vs TC avg
§112
11.7%
-28.3% vs TC avg
Black line = Tech Center average estimate • Based on career data from 30 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Status of the Claims Claim 8 is cancelled. Claims 1-7 and 9-18 are pending. Claims 1-7 and 9-18 are examined herein. Claims 1-7 and 9-18 are rejected. Priority Application No. 18/877,624 filed on 12/20/2024 is a 371 of PCT/CN2024/129620 filed on 11/04/2024 and also claims foreign priority to CN202410562568.6 filed on 05/08/2024. Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55. A certified English translation of neither PCT/CN2024/129620 nor CN202410562568.6 has been filed. Should applicant desire to obtain the benefit of foreign priority under 35 U.S.C. 119(a)-(d) prior to declaration of an interference, a certified English translation of the foreign application must be submitted in reply to this action. 37 CFR 41.154(b) and 41.202(e). Failure to provide a certified translation may result in no benefit being accorded for the non-English application. Specification The disclosure is objected to because of the following informalities: Applicant provides a brief description of the drawings in ¶0010-0012. The descriptions are of FIG. 1, 2, and 3. (see below). [0010] FIG1 shows structural schematic diagrams of the gene editing vector and the gene editing system in the present disclosure; [0011] FIG. 2 shows a process of callus and bud regeneration in Example 1; where (a) shows seed culture; (b) shows explants; (c) shows Agrobacterium rhizogenes infection; (d) shows callus induction, and red callus is positive; (e) shows that the red callus is cut and subcultured to induce adventitious buds; (f) shows that the adventitious buds develop into plants and induce rooting; (g) shows that positive plants are marked with red (left), and green plants are wild type (right); and (h) shows that transgenic plants are transplanted; and [0012] FIG. 3 show effect of PDS gene and editing site sequence alignment of the pakchoi (Brassica rapa ssp. chinensis) in Example 1; where WT-PDS1 and WT-PDS2 are two PDS homologous genes of the wild type of pakchoi; A, B, C, D, E in A-PDS1, A-PDS2, B-PDS1, B-PDS2, C-PDS1, C-PDS2, D-PDS1, D-PDS2, and E-PDS2 represent five different mutant strains, respectively, and PDS 1 and PDS2 are two PDS homologous genes of the pakchoi; bold fonts represent a target site of the PDS gene; underlines represent substitutions and insertions. However, a review of the figures shows FIG. 1A, 1B, 2, 3A, and 3B. Applicant has not provided a description for the distinct A and B portions of FIGs. 1 and 3. A typo is also present in ¶0010, where “FIG1” should read “FIG. 1”. Appropriate correction is required. The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code in ¶0031. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01. The use of the term GenScript and Addgene (¶0035), which is/are a trade name or a mark used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term. Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. Applicant should review the specification and correct other instances of the use of trade name or marks if present. Claim Objections Claim 7 is objected to because of the following informalities: Claim 7 recites “…wherein sgRNA sequences for the PDS gene comprises…”. The term “comprises” introduces a grammatical error, and should be amended to “comprise”. Appropriate correction is required. Claim 10 is objected to because of the following informalities: Claim 10 recites “…ligating an sgRNA…”. The term “an” introduces a grammatical error, and should be amended to “a”. Appropriate correction is required. Claim Rejections - 35 USC § 112 Indefiniteness The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1-7 and 9-18 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 1 recites “A gene editing vector, comprising a clustered regularly interspaced short palindromic repeats-associated protein 9 (Cas9) vector backbone…”. This recited backbone is not defined in the specification and it is unclear what is required to be present in the backbone to be considered a clustered regularly interspaced short palindromic repeats-associated protein 9 (Cas9) vector backbone. For example, it is unclear if either Cas9 or the gRNA scaffold is required to be present, thus producing a CRISPR/Cas9 vector backbone since CRISPR/Cas9 related sequences are present, or if both Cas9 and the gRNA scaffold components are required. \ Claims 2-7 and 9-18 are rejected as a function of dependency. Claim 7 recites “wherein sgRNA sequences for the PDS gene comprises…”. However, the sgRNA sequences are I reference to the recitation of “wherein a single guide RNA (sgRNA) pf a target gene…” in claim 5. Because claim 5 recites a sgRNA (singular), and claim 7 recites sgRNA sequences (plural), it is unclear if one or both sgRNA sequences in claim 7 are required to be in the gene-editing system. Claims 4 and 18 recite “…wherein the Cas9 vector backbone comprises pYLCRISPR/Cas9P35S-N…”. It is unclear what pYLCRISPR/Cas9P35S-N is based on this title/ abbreviation. The specification describes a gene editing vector pYLCRISPR/Cas9P35S-N (Addgene Plasmid #66191) from the research group of Academician Yaoguang Liu of South China Agricultural University was used as backbone (¶0031). However, the specification does not explicitly define pYLCRISPR/Cas9P35S-N and it is unclear if pYLCRISPR/Cas9P35S-N can be any CRSIPR/Cas9 backbone, if it is limited to only require the features in Addgene Plasmid #66191, if some portions of the plasmid DNA may be removed and if so what and where, or if pYLCRISPR/Cas9P35S-N requires all 16,211 basepairs from Addgene plasmid #66191. For at least these reasons, the recitation of “pYLCRISPR/Cas9P35S-N” in claims 4 and 18 are indefinite. For purposes of examination, the vector is broadly interpreted to require a 35S promoter driving Cas9 expression as seen in the Addgene plasmid #66191. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 1-2 and 4-6 are rejected under 35 U.S.C. 103 as being unpatentable over Maher (Maher, M. F., Nasti, R. A., Vollbrecht, M., Starker, C. G., Clark, M. D., & Voytas, D. F. (2020). Plant gene editing through de novo induction of meristems. Nature biotechnology, 38(1), 84-89.) and Lian (Lian, Z., Nguyen, C. D., Liu, L., Wang, G., Chen, J., Wang, S., ... & Huo, H. (2022). Application of developmental regulators to improve in planta or in vitro transformation in plants. Plant Biotechnology Journal, 20(8), 1622-1635.). Claim 1 is drawn to a gene editing vector, comprising a clustered regularly interspaced short palindromic repeats-associated protein 9 (Cas9) vector backbone and further comprising developmental regulators (DRs), the DRs being ZmWUS2, AtIPT, and AtPLT5. Claim 2 is drawn to the gene editing vector according to claim 1, further comprising a visual marker gene. Claim 4 is drawn to the gene editing vector according to claim 1, wherein the Cas9 vector backbone comprises pYLCRISPR/Cas9P35S-N. Claim 5 is drawn to a gene editing system, wherein a single guide RNA (sgRNA) of a target gene is ligated to the gene editing vector according to claim 1. Claim 9 is drawn to a method for culturing a Brassica crop tissue, comprising contacting the gene editing vector according to claim 1 to with the Brassica crop tissue. Claim 16 is drawn to the method according to claim 9, wherein the gene vector further comprises a visual marker gene. Claim 18 is drawn to the method according to claim 9, wherein the Cas9 vector backbone comprises pYLCRISPR/Cas9P35S-N. Regarding claim 1, Maher teaches growing N. benthamiana plant harboring 35S:Cas9 transgenes to maturity, and inoculating the plants with constructs including pMM114 which comprises a guide RNA targeting NbPDS and further comprises the developmental regulators ZmWUS2 and IPT (p. 90, section titled Induction of meristems on soil-grown plants; and Supplementary Table 1). Maher teaches the cytokinin biosynthesis gene isopentenyl transferase (ipt) is that in two referenced papers (p. 84, ¶1) which both teach the IPT gene is from Agrobacterium tumefaciens. Therefore, IPT as recited in Maher is reasonably interpreted to be AtIPT (i.e. IPT from Agrobacterium tumefaciens). Additionally, because the construct comprises guide RNAs used for CRISPR/Cas9 gene editing, the construct is reasonably interpreted to comprise a CRISPR/Cas9 vector backbone. Maher teaches the ZmWUS2 and AtIPT combination produced up to 5 times as many shoot-like growths and approximately four times more full plants than the other DR combinations (p. 85, ¶2, and Fig. 1f). Maher further teaches DRs can induce transgenic shoots on diverse dicot species (p. 87, ¶1). Regarding claims 2 and 16, Maher teaches the vector further comprises a CmYLCV:LUC module (i.e. luciferase reporter) (Supplementary Table 1), which is a visual marker gene. Regarding claims 4 and 18, Maher teaches the N. benthamiana plant harbor 35S:Cas9 transgenes, and the 35S:Cas9- harboring plants were transformed with a pMM114 construct which comprises a guide RNA targeting the endogenous PDS gene and further comprises the developmental regulators ZmWUS2 and IPT (p. 90, section titled Induction of meristems on soil-grown plants; and Supplementary Table 1). Regarding claims 5-6, Maher teaches the pMM114 vector comprises a sgRNA targeting NbPDS (Supplementary Table 1). However, Maher does not explicitly teach: the gene editing vector also comprises AtPLT5 (remaining limitation of claim 1) contacting the gene editing vector according to claim 1 to with the Brassica crop tissue (claim 9) Regarding the remaining limitation of claim 1, in analogous art, Lian teaches about the application of developmental regulators to improve in planta or in vitro transformation in plants (title). Specifically, Lian teaches using a PLT5 vector to transform Brassica (p. 1627), and PLT5 significantly improved the shoot regeneration and transformation in two Brassica cabbage varieties (Brassica rapa) (abstract). Regarding claim 9, Lian teaches using a PLT5 vector to transform Brassica (p. 1627) (i.e. contacting the vector with Brassica crop tissue), and PLT5 significantly improved the shoot regeneration and transformation in two recalcitrant Brassica cabbage varieties (Brassica rapa) (abstract). It would therefore be prima facie obvious to modify the pMM114 construct of Maher to include the 35S:Cas9 cassette that was already transformed into the N. benthamiana plant with a reasonable expectation of success because combining the vectors to produce a single transformation vector comprising both the Cas9 and gRNA/ DR cassettes could be achieved without encountering any special technical difficulty. One of ordinary skill in the art would have been motivated to do so because it would be prima facie obvious to combine the known vectors into a single vector for the same purpose that is gene-editing target gene(s) in plants while expressing the DRs to improve regeneration of gene-edited plants as taught by Maher. Additionally, it would be prima facie obvious to modify the teachings of Maher to include the teachings of Lian to arrive at the claimed gene-editing vector and also contact it with Brassica tissue with a reasonable expectation of success because construct/ vector cloning is routine and one of ordinary skill in the art could arrive at the instant gene-editing vector without encountering any special technical difficulties. One of ordinary skill in the art would have been motivated to combine the teachings because Maher teaches developmental regulators can induce transgenic shoots on diverse dicot species and teaches ZmWUS2+AtIPT was the best combination of those tested (p. 87, ¶1, Discussion, entire document). Additionally, Brassica is known in the art as relatively difficult to regenerate which is supported by the teachings of Lian (Table 1, see control), and Lian teaches the PLT5 developmental regulator significantly improved the shoot regeneration and transformation in two Brassica cabbage varieties (Brassica rapa) (abstract) and further suggests the co-expression of PLT5 and WUS will have a synergistic effect in promoting embryogenic calli formation and completing reconstitution of programming for de novo shoot regeneration in recalcitrant species. Therefore, one of ordinary skill in the art would have been motivated to include PLT5 as taught by Lian in the most successful vector taught by Maher that is the ZmWUS2 + AtIPT vector to further improve shoot regeneration of recalcitrant Brassica species. Claims 3 and 17 are rejected under 35 U.S.C. 103 as being unpatentable over Maher and Lian as applied to claims 1-2 above, and further in view of He (He, Y., Zhang, T., Sun, H., Zhan, H., & Zhao, Y. (2020). A reporter for noninvasively monitoring gene expression and plant transformation. Horticulture research, 7.). Claim 3 is drawn to the gene editing vector according to claim 2, wherein the visual marker gene comprises Ruby. Claim 17 is drawn to the method according to claim 16, wherein the visual marker gene comprises Ruby. Regarding claims 3 and 17, Maher and Lian teach the limitations of claim 1-2 as set forth in the previous obviousness rejection. The teachings of Maher and Lian as they are applied to claims 1-2 are set forth previously herein and are incorporated by reference. It is reiterated that Maher teaches the construct further comprises a luciferase visual reporter gene. However, Maher and Lian do not explicitly teach the limitations of claims 3 and 17 as recited above. In analogous art, He teaches an alternative, new visual reporter gene known as RUBY (abstract) that converts tyrosine to vividly red betalain, which is clearly visible to naked eyes without the need of using special equipment or chemical treatments. He teaches RUBY can be used to noninvasively monitor gene expression in plants. It would therefore have been obvious to a person of ordinary skill in the art to modify the invention of as taught by Maher and Lian to include the reporter gene taught by He to arrive at the instantly claimed method with a reasonable expectation of success because the RUBY reporter gene taught by He was a known alternative and readily obtainable. One having ordinary skill in the art would have been motivated to combine the teachings because it would have been prima facie obvious to substitute the luciferase gene taught by Maher with another reporter gene known in the art, RUBY, for the same purpose and especially because He teaches additional benefits of RUBY including that it is clearly visible to naked eyes without the need of using special equipment or chemical treatments. Claims 10-12 and 14 are rejected under 35 U.S.C. 103 as being unpatentable over Maher and Lian as applied to claims 1-2 above, and further in view of Jedličková (Jedličková, V., Mácová, K., Štefková, M., Butula, J., Staveníková, J., Sedláček, M., & Robert, H. S. (2022). Hairy root transformation system as a tool for CRISPR/Cas9-directed genome editing in oilseed rape (Brassica napus). Frontiers in plant science, 13, 919290.) and Petit (Petit, A., David, C., Dahl, G. A., Ellis, J. G., Guyon, P., Casse-Delbart, F., & Tempé, J. (1983). Further extension of the opine concept: plasmids in Agrobacterium rhizogenes cooperate for opine degradation. Molecular and General Genetics MGG, 190(2), 204-214.). Claim 10 is drawn to a method for genetic transformation and/or gene editing of a Brassica crop, comprising: ligating an sgRNA designed based on a sequence from a target gene of the Brassica crop with the gene editing vector according to claim 1, transforming a resulting ligation product into Agrobacterium rhizogenes to infect an explant of the Brassica crop, and then subjecting the explant to callus induction and adventitious bud regeneration in sequence to obtain a gene-edited plant. Claim 11 is drawn to the method according to claim 10, wherein the explant is selected from the group consisting of a petiolate cotyledon and a hypocotyl. Claim 12 is drawn to the method according to claim 10, wherein the target gene of the Brassica crop comprises a PDS gene. Claim 14 is drawn to the method according to claim 10, wherein the Brassica crop is selected from the group consisting of Brassica rapa ssp. chinensis, Brassica rapa ssp. pekinensis, Brassica oleracea var. capitata, Brassica oleracea var. italica, and Brassica napus. Regarding claims 10-12 and 14, Maher and Lian teach the limitations of claim 1 as set forth in the previous obviousness rejection. The teachings of Maher and Lian as they are applied to claim 1 are set forth previously herein and are incorporated by reference. Additionally, it is noted that the gRNAs in the CRISPR/Cas9 construct of Maher targeted the endogenous PDS gene. However, Maher and Lian do not explicitly teach the limitations of claim 10-12 and 14 as recited above. Specifically, Maher and Lian do not explicitly teach the sgRNA is designed based on a sequence from a target gene of the Brassica crop, and transforming a resulting ligation product into Agrobacterium rhizogenes to infect an explant of the Brassica crop, and then subjecting the explant to callus induction and adventitious bud regeneration in sequence to obtain a gene-edited plant. Because Maher and do not explicitly teach this method, the limitations of claims 11 and 14 are also not taught by Maher and Lian. In analogous art, Jedličková teaches using CRISPR/Cas9 vectors comprising sgRNAs targeting Brassica napus genes (p. 2), and transforming Brassica napus hypocotyl explants with Agrobacterium tumefaciens comprising a Ri plasmid and not a Ti plasmid, wherein the Ri plasmid comprises the CRISPR/Cas9 vector (p. 3, section titled Plant transformation (hairy root cultures)). Jedličková teaches hairy roots and calli formed and were detected 2 weeks after injection (p. 6, section titled An efficient protocol for hairy root induction in Brassica napus), and then teaches regenerating shoots (i.e. adventitious bud regeneration) from the hairy roots (p. 3-4, section titled Regeneration of hairy root clones) to obtain T0 regenerants with CRISPR/Cas9-induced mutations (p. 3-4, section titled Regeneration of hairy root clones , p. 9, section titled Optimization of hairy roots regeneration and regeneration of CRISPR/Cas9 BnaTAA1 mutants). In addition to the explicit teaching that callus was formed, then shoot/ bud regeneration occurred, Supplementary Figure S5 also shows the formation of callus from the hair roots and then shoots regenerating and elongating from them (See Supplementary Figure S5). In other analogous art referenced by Jedličková, Petit teaches both Agrobacterium rhizogenes strains and Agrobacterium tumefaciens strains in which the pathogenic plasmids of A. rhizogenes (Ri plasmids) have been introduced incite hairy root tissue (p. 205). It would therefore be prima facie obvious to combine the teachings of Maher and Lian with that of Jedličková and Petit to arrive at the instantly claimed method with a reasonable expectation of success because one of ordinary skill in the art would look for a known transformation method to introduce the CRISPR/Cas9 vector of Maher and Lian into a Brassica plant, and Jedličková provides a successful hairy root transformation and regeneration method to produce gene-edited plants of the species Brassica napus. One of ordinary skill in the art would have been motivated to combine the teachings because Jedličková teaches exploiting hairy root cultures avoids the lengthy explant transformation and regeneration process to study the gene-editing efficiency of various CRISPR/Cas9 vectors, and successfully teaches producing transgene-free and target gene-edited plants in the T1 generation from the method. Additionally, it would have been obvious to a person of ordinary skill in the art to modify the transformation method that utilized a Ti-less A. tumefaciens strain carrying an Ri plasmid to induce hairy roots as taught by Jedličková to include the Rhizobium rhizogenes taught by Petit to arrive at the instantly claimed method with a reasonable expectation of success because Rhizobium rhizogenes taught by Petit was a known and readily obtainable alternative bacteria capable of the same function. One having ordinary skill in the art would have been motivated to combine the teachings because it would have been prima facie obvious to substitute the hairy-root inducing A. tumefaciens bacteria comprising the Ri plasmid taught by Jedličková with another bacteria known in the art, Rhizobium rhizogenes, for the same purpose. Furthermore, it would be prima facie obvious to target the endogenous PDS gene as taught by Maher in the Brassica crop as taught by Jedličková for the same purpose, and therefore the target gene of the Brassica crop would comprise a PDS gene as required by claim 12. Claim 15 is rejected under 35 U.S.C. 103 as being unpatentable over Maher and Lian, Jedličková, and Petit as applied to claims 1 and 10 above, and further in view of Porter (Porter, J. R., & Flores, H. (1991). Host range and implications of plant infection by Agrobacterium rhizogenes. Critical Reviews in Plant Sciences, 10(4), 387-421.). Claim 15 is drawn to the method according to claim 10, wherein the Agrobacterium rhizogenes comprises Agrobacterium rhizogenes K599. Regarding claim 15, Maher, Lian, Jedličková, and Petit teach the limitations of claims 1 and 10 as set forth in the previous obviousness rejection. The teachings of Maher, Lian, Jedličková, and Petit as they are applied to claims 1 and 10 are set forth previously herein and are incorporated by reference. However, Maher, Lian, Jedličková, and Petit do not explicitly teach the limitations of claim 15 as recited above. In analogous art, Porter teaches plants of the Brassicaceae family and A. rhizogenes are susceptible to infection by A. rhizogenes, and further teaches K599 is one of the three highest successful infection strains for plant transformation (abstract). It would therefore have been obvious to a person of ordinary skill in the art to modify the invention of as taught by Maher, Lian, Jedličková, and Petit to include the Agrobacterium rhizogenes strain K599 taught by Porter to arrive at the instantly claimed method with a reasonable expectation of success because strain K599 taught by Porter was a known and readily obtainable Agrobacterium strain used for plant transformation. One having ordinary skill in the art would have been motivated to combine the teachings because it would have been prima facie obvious to substitute one Agrobacterium rhizogenes strain with another Agrobacterium rhizogenes strain known in the art, K599, for the same purpose. This is especially true given that Porter teaches K599 is one of the three highest successful infection strains for plant transformation (abstract). Claim 7 is rejected under 35 U.S.C. 103 as being unpatentable over Maher and Lian as applied to claim 1 above, and further in view of NCBI GenBank Accession No. XM_009141294 (NCBI GenBank Accession No. XM009141294, version XM009141294.3, PREDICTED: Brassica rapa 15-cis-phytoene desaturase, chloroplastic/ chromoplastic (PDS), transcript variant X1, mRNA, published online 12/07/2020). Claim 7 is drawn to the gene editing system according to claim 6, wherein sgRNA sequences for the PDS gene comprises: PDSsgRNA1: GGAACAACGAGATGCTGACA (SEQ ID NO: 1); and PDSsgRNA2: GCTGCATGGAAGGATGAAGA (SEQ ID NO: 2). Regarding claim 7, Maher and Lian teach the limitations of claim 1 as set forth in the previous obviousness rejection. The teachings of Maher and Lian as they are applied to claim 1 are set forth previously herein and are incorporated by reference. However, Maher and Lian do not explicitly teach the limitations of claim 7 as recited above. That is because Maher teaches targeted the endogenous PDS gene in Nicotiana benthamiana (i.e. NbPDS), and because sgRNAs can be targeted to various known sequences in the PDS gene to knockout the gene. In analogous art, NCBI GenBank Accession No. XM009141294 teaches the coding sequence of the Brassica rapa PDS gene. Both SEQ ID NOs: 1 and 2 in the instant claims align at 100% sequence identity within the Brassica rapa PDS coding sequence (See Figure below). PNG media_image1.png 621 514 media_image1.png Greyscale Figure 1. Coding sequence of NCBI Accession No. JQ846499. The yellow highlighted sequence (positions 636-655) is identical to instant PDSscRNA2 (SEQ ID NO: 2). The orange highlighted sequence (positions 865-884) is identical to instant PDSsgRNA1 (SEQ ID NO: 1). It would therefore have been obvious to a person of ordinary skill in the art to modify the invention of as taught by Maher and Lian to design the gRNAs so that they comprise the sequences of instant SEQ ID NOs 1 and/ or 2 to arrive at the instantly claimed method with a reasonable expectation of success because the Brassica rapa PDS gene was known and readily available, and methods of designing sgRNAs and using CRISPR/Cas9 to knockout PDS in plants in routine in the art. One having ordinary skill in the art would have been motivated to combine the teachings because it would have been prima facie obvious to perform the combined method of Maher and Lian in the Brassica rapa plant of Lian rather than the Nicotiana benthamiana plant of Maher for the same purpose that is targeting and knockout out PDS and regenerating the gene-edited plants. Because the plant to be transformed, edited, and regenerated is Brassica rapa, one of ordinary skill in the art would have been motivated to modify the vector so the gRNAs are designed to target the sequence known and readily available endogenous Brassica rapa PDS gene, thus arriving at the instantly claimed gRNAs that have 100% identity to sequences within BrPDS. Claim 13 is rejected under 35 U.S.C. 103 as being unpatentable over Maher, Lian, Jedličková, and Petit as applied to claims 1 and 10 above, and further in view of NCBI GenBank Accession No. XM_009141294 (NCBI GenBank Accession No. XM009141294, version XM009141294.3, PREDICTED: Brassica rapa 15-cis-phytoene desaturase, chloroplastic/ chromoplastic (PDS), transcript variant X1, mRNA, published online 12/07/2020). Claim 13 is drawn to the gene editing system according to claim 12, wherein sgRNA sequences for the PDS gene comprises: PDSsgRNA1: GGAACAACGAGATGCTGACA (SEQ ID NO: 1); and PDSsgRNA2: GCTGCATGGAAGGATGAAGA (SEQ ID NO: 2). Regarding claim 13, Maher, Lian, Jedličková, and Petit teach the limitations of claims 1 and 10 as set forth in the previous obviousness rejection. The teachings of Maher, Lian, Jedličková, and Petit as they are applied to claims 1 and 10 are set forth previously herein and are incorporated by reference. However, Maher, Lian, Jedličková, and Petit do not explicitly teach the limitations of claim 13 as recited above. That is because Maher teaches targeted the endogenous PDS gene in Nicotiana benthamiana (i.e. NbPDS), and because sgRNAs can be targeted to various known sequence in the PDS gene to knockout the gene. In analogous art, NCBI GenBank Accession No. XM009141294 teaches the coding sequence of the Brassica rapa PDS gene. Both SEQ ID NOs: 1 and 2 in the instant claims align at 100% sequence identity within the Brassica rapa PDS coding sequence (See Figure in 103 rejection to claim 7 above). It would therefore have been obvious to a person of ordinary skill in the art to modify the invention of as taught by Maher, Lian, Jedličková, and Petit to design the gRNAs so that they comprise the sequences of instant SEQ ID NOs 1 and/ or 2 to arrive at the instantly claimed method with a reasonable expectation of success because the Brassica rapa PDS gene was known and readily available, and methods of designing sgRNAs and using CRISPR/Cas9 to knockout PDS in plants in routine in the art. One having ordinary skill in the art would have been motivated to combine the teachings because it would have been prima facie obvious to perform the combined method of Maher and Lian in the Brassica rapa plant of Lian rather than the Nicotiana benthamiana plant of Maher for the same purpose that is targeting and knockout out PDS and regenerating the gene-edited plants. Because the plant to be transformed, edited, and regenerated is Brassica rapa, one of ordinary skill in the art would have been motivated to modify the vector so the gRNAs are designed to target the sequence known and readily available endogenous Brassica rapa PDS gene, thus arriving at the instantly claimed gRNAs that have 100% identity to sequences within BrPDS. Conclusion and Inquiries No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to JESSICA N STOCKDALE whose telephone number is (703)756-5395. The examiner can normally be reached M-F 8:30-5:00 CT. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad Abraham can be reached at (571) 270-7058. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. JESSICA N. STOCKDALE Examiner Art Unit 1663 /JESSICA NICOLE STOCKDALE/Examiner, Art Unit 1663 /CHARLES LOGSDON/Primary Examiner, Art Unit 1662
Read full office action

Prosecution Timeline

Dec 20, 2024
Application Filed
Jun 17, 2026
Non-Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12624364
PLANT REGULATORY ELEMENTS AND USES THEREOF FOR AUTOEXCISION
3y 0m to grant Granted May 12, 2026
Patent 12612640
GENE RELATED TO BIOSYNTHESIS OF ERGOTHIONEINE, AND USE THEREOF
1y 9m to grant Granted Apr 28, 2026
Patent 12590314
Expressing Multiple Genes from a Single Transcript in Algae and Plants
3y 3m to grant Granted Mar 31, 2026
Patent 12590318
NOVEL INSECT INHIBITORY PROTEINS
2y 3m to grant Granted Mar 31, 2026
Patent 12545923
MUTANT GENE CONFERRING A COMPACT GROWTH PHENOTYPE IN WATERMELON
3y 0m to grant Granted Feb 10, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
43%
Grant Probability
87%
With Interview (+44.0%)
2y 5m (~10m remaining)
Median Time to Grant
Low
PTA Risk
Based on 30 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month