DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
This application is a DIV of U.S. Patent Application No. 18/054,778 filed 11/11/20222, now U.S. Patent No. 12,123,062 which claims benefit of U.S. Serial Application no. 63/278,566 filed 11/12/2021.
Status of the claims
Claims 2, 5, 9 and 45 are pending and currently under examination. Claims 1, 3-4, 6-8 and 10-44 are canceled.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claim 2 recites “a set of primers comprising SEQ ID NOS: 4 and 5”.
Claim 5 recites “a set of primers comprising SEQ ID NOS: 14 and 15”.
Claim 9 recites “a nucleic acid probe for amplifying an amplification product produced by the primers of claim 2 or 5, wherein said probe comprises SEQ ID NO: 6”.
Claim 45 recites “a nucleic acid probe for amplifying an amplification product produced by the primers of claim 5, wherein said probe comprises SEQ ID NO: 6”.
SEQ ID NO: 4 consists CGGTGGGTTTTGTTGTCTTC;
SEQ ID NO: 5 consists TCATCGCACCGTCAAAGGA;
SEQ ID NO: 6 consists CTCTGGATGGTATGCCCGGTAAACA;
SEQ ID NO: 14 consists CCAGTTTATCGTTATTACCAAAGG;
SEQ ID NO: 15 consists ATCGCACCGTCAAAGGANC (N is any nucleotide).
Claims 2, 5, 9 and 45 above are rejected under 35 U.S.C. 101 because these claimed inventions are directed to a judicial exception without significantly more.
Claims 2, 5, 9 and 45 are construed as being directed to nucleic acids or nucleotide sequences that appear to encompass a natural product which falls within the law of nature exception.
The unpatentability of natural products was confirmed by the U.S. Supreme Court in Association for Molecular Pathology v. Myriad Genetics, Inc., No. 12-398 (June 13, 2013) - “A naturally occurring DNA segment is a product of nature and not patent eligible merely because it has been isolated”, and “Myriad’s DNA claim falls within the law of nature exception”.
The following inquiries are used to determine whether a claim is drawn to patent-eligible subject matter:
Step 1. Is the claim directed to a process, machine, article of manufacture, or composition of matter?
Yes- the claims are clearly directed to a set of two polynucleotides or nucleic acids. The nucleic acids/ polynucleotides are a composition of matter.
Step 2A, prong one. Does the claim recite a law of nature, a natural phenomenon, or an abstract idea (recognized judicial exceptions)?
Yes- the claims are directed to primer polynucleotides and/or a probe polynucleotide, which each comprise sequences that are not markedly different naturally occurring sequence(s) of GenBank Accession No. M90846.1.
The claimed primer/probe polynucleotides have no functional differences relative to their naturally occurring counterparts since both the claimed and naturally occurring molecules hybridize to complementary nucleic acids.
The primer/probe sequence(s) of claims 2, 5, 9 and 45 with 100% identity the naturally occurring invA gene sequence having the GenBank No. M90846.1
The instant SEQ ID NO: 4 (20 nt) is 100% identical to and indistinguishable from nucleotides 419-438 of the Salmonella typhimurium InvA (invA) gene having the Genbank Accession No. M90846.1.
The instant SEQ ID NO: 5 is 100% identical to nucleotides 655-637 of the Salmonella typhimurium InvA (invA) gene having the Genbank Accession No. M90846.1.
The instant SEQ ID NO: 6 is 100% identical to and indistinguishable from nucleotides 515-539 of the Salmonella typhimurium InvA (invA) gene having the Genbank Accession No. M90846.1.
The instant SEQ ID NO: 14 is at least 89% identical to nucleotides 456-479 of Salmonella typhimurium InvA (invA) gene having the Genbank Accession No. M90846.1.
The instant SEQ ID NO: 15 is at least 89% identical to nucleotides 653-637 of the Salmonella typhimurium InvA (invA) gene having the Genbank Accession No. M90846.1.
MPEP 2106.04(b)(i) identifies nucleic acid sequence(s)or nucleotide sequence(s) having no structural or functional differences from naturally occurring nucleic acids as an example of a patent-ineligible natural product.
In addition, as discussed in MPEP 2016.04(b)(II), “[P]roduct of nature exceptions include both naturally occurring products and non-naturally occurring products that lack markedly different characteristics from any naturally occurring counterpart.” See Ambry Genetics, 774 F.3d at 760, 113 USPQ2d at 1244.
Step 2A, prong two. Does the claim as a whole integrate the recited judicial exception into a practical application of the exception?
No - In the instant case, none of claims 2, 5, 9 and 45 recite any additional elements beyond the sequence(s) that are found in the naturally occurring sequence(s) derived from the Salmonella typhimurium genome. Accordingly, the claims as a whole also fail to integrate the exception into a practical application since there are no additional elements/limitations that can be construed as a practical application so that the claims amount to significantly more than the judicial exception.
Step 2B. Does the claim recite additional elements that amount to significantly more than the judicial exception?
No- In the instant case, as detailed above, the claims are directed to PCR primers/probe encompassing partial or full-length sequence(s) of naturally occurring nucleic acid sequences.
This part of the eligibility analysis evaluates whether the claim as a whole amount to significantly more than the recited exception, i.e., whether any additional element, or combination of additional elements, adds an inventive concept to the claim. MPEP 2106.05.
Since there are no additional elements recited by the claims beyond naturally occurring DNA sequences, the claims do not have additional elements so that as a whole, they amount to significantly more than the judicial exception.
In view of the above, claims 2, 5, 9 and 45 are patent-ineligible.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claim 2 is rejected under 35 U.S.C. 102(a)(1) as being anticipated by Singh et al. (2019, Food Control, 96, pp.251-259).
Regarding claim 2, Singh et al. (2019) teach a primer set comprising the instant SEQ ID NO: 4 (5’-CGGTGGGTTTTGTTGTCTTC-‘3) and SEQ ID NO: 5 (5’-TCATCGCACCGTCAAAGGA -‘3) (see pg 253, Table 2b. primers are Salmonella-F and Salmonella-R, reproduced from Singh et al. (2019), pg 253, below).
B. The Illustration is reproduction of Table 2b on pg 253 of Singh et al. (2019)
PNG
media_image1.png
317
996
media_image1.png
Greyscale
Accordingly, the instant claim 2 is anticipated by Singh et al. (2019).
Claim 5 is rejected under 35 U.S.C. 102(a)(1) as being anticipated by Singh et al. (2013, International journal of food microbiology, 166(2), pp.213-218).
Regarding claim 5, Singh et al. (2013) teach a primer set comprising the instant SEQ ID NO: 14 (5’- CCAGTTTATCGTTATTACCAAAGG-‘3) and SEQ ID NO: 15 (5’- ATCGCACCGTCAAAGGANC-‘3, N is any nucleotide) (see pg 215, Table 1. primers InvF and InvR, reproduced from Singh et al., pg 215, below).
A. The Illustration below is a reproduction on pg 215 from Singh et al. (2013) of Table 1
PNG
media_image2.png
472
1266
media_image2.png
Greyscale
Accordingly, the instant claim 5 is anticipated by Singh et al. (2013).
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 9 and 45 are rejected under 35 U.S.C. 103 as being unpatentable over X et al. ()
Claims 9 and 45 are rejected under 35 U.S.C. 103 as being unpatentable over Singh et al. (2019, Food Control, 96, pp.251-259) and/or Singh et al. (2013, International journal of food microbiology, 166(2), pp.213-218) in view of GenBank Accession No. M90846.1(2006), An (US2003/0050470A1) and SantaLucia et al. (2007, Humana Press: pp 3-33).
The teachings of Singh et al. (2019) as it relates to claim 2 and Singh et al. (2013) as it relates to claim 5 are applied from above. Singh et al. (2019) generates a 237 bp amplification product using Salmonella-F and Salmonella-R primers while Singh et al. (2013) generates a 200 bp amplification product using InvF and InvR primers.
Omitted from Singh et al. (2019) and Singh et al. (2013) (claims 9 and 45)
Regarding claims 9 and 45, Singh et al. (2019) and Singh et al. (2013) do not teach a probe polynucleotide comprising SEQ ID NO: 6 (5’-CTCTGGATGGTATGCCCGGTAAACA-‘3), said probe polynucleotide useful for amplifying the respective 237 bp and 200 bp amplification product(s).
GenBank
GenBank teach a 2176 bp Salmonella typhimurium InvA (invA) gene sequence having the Accession No. M90846.1.
GenBank Accession No. M90846.1 teach sequences that are 100% identical to SEQ ID NO: 4, SEQ ID NO: 5, and SEQ ID NO: 14 and SEQ ID NO: 15 () and that is 100% identical to SEQ ID NO: 6 at nucleotides .
An et al. (2003) (claims 9 and 45)
Regarding primer and probe design, An et al. teach at paragraphs [0065]-[0067]:
"Various probes and primers can be designed around the disclosed nucleotide sequences. Primers may be of any length but, typically, are 10-20 bases in length. By assigning numeric values to a sequence, for example, the first residue is 1, the second residue is 2, etc., an algorithm defining all primers can be proposed:
n to n+y
where n is an integer from 1 to the last number of the sequence and y is the length of the primer minus one (9 to 19), where n+y does not exceed the last number of the sequence. Thus, for a 10-mer, the probes correspond to bases 1 to 10, 2 to 11, 3 to 12 . . . and so on. For a 15-mer, the probes correspond to bases 1 to 15, 2 to 16, 3 to 17 . . . and so on. For a 20-mer, the probes correspond to bases 1 to 20, 2 to 21, 3 to 22 . . . and so on."
Therefore, An et al. not only taught designing primers of any length based on a known sequence, but also taught an algorithm for defining all possible primers of a given length based on a known sequence. In this respect, An et al. taught that all possible subsequences of a known sequence could be considered as a primer for that sequence. While An et al. was discussing in particular sequences having to do with prostate, bladder and breast cancer (see Abstract), one of ordinary skill in the art would have recognized that the principles of designing primers and probes based on a disclosed nucleotide sequence would have applied to any nucleotide sequence under study.
SantaLucia et al. (2007)(claims 9 and 45)
SantaLucia et al. teach on page 14, “over the last 10 years (1996–2006), I have informally polled scientists who are experts in PCR and asked: “What percentage of the time does a casually designed PCR reaction ‘work’ without any experimental optimization?” In this context, “work” means that the desired amplification product is made in good yield with a minimum of artifact products such as primer dimers, wrong amplicons, or inefficient amplification. By “casually designed,” I mean that typical software tools are used by an experienced molecular biologist. The consensus answer is 70–75%.
If one allows for optimization of the annealing temperature in the thermocycling protocol (e.g., by using temperature gradient optimization), magnesium concentration optimization, and primer concentration optimization, then the consensus percentage increases to 90–95%."
Thus, SantaLucia et al. teach primers casually designed to a target sequence have a reasonable expectation of success at hybridizing, amplifying and detecting a target sequence.
It would have been obvious to a person of ordinary skill in the art before the effective filing date of the invention to providing one or more functionally equivalent but alternative probe polynucleotide(s) to the amplification assay sof Singh et al. (2019) and/or Singh et a. (2013) since probe polynucleotide(s) are suitable to bind to and detect the amplification products generated by the InvF and InvR primers and/or by Salmonella F and Salmonella R primers at alternative nucleotide sequence(s) of the invA gene, thereby aid in the detection of Salmonella spp. detection.
The ordinary skilled artisan would have been readily privy to use the prior art guidance on primer/probe design provided by An et al., and SantaLucia Jr et al. and would have been motivated to derive probe(s) comprising the instant SEQ ID NO: 6 from GenBank Accession No. M90846.1 and further optimize these probes according to teachings and/or suggestions from An et al. and SantaLucia Jr et al. with a reasonable expectation of success. SantaLucia et al. elaborates that sequences casually designed for use as primers and probe are generally successfully at hybridizing, amplifying and/or detecting, particularly when further optimized as taught by SantaLucia et al.
In view of the combined teachings and suggestions of all of the cited prior art references, the instant claims 9 and 45 are prima facie obvious.
Conclusion
No claims are currently allowed.
Correspondence
Any inquiry concerning this communication or earlier communications from the examiner should be directed to OLAYINKA A OYEYEMI whose telephone number is (571)270-5956. The examiner can normally be reached Monday -Thursday: 9:00 am - 5:00 pm, EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, GARY Benzion can be reached at 571-272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
OLAYINKA A. OYEYEMI
Examiner
Art Unit 1681
/OLAYINKA A OYEYEMI/Examiner, Art Unit 1681 /GARY BENZION/Supervisory Patent Examiner, Art Unit 1681
Prosecution Insights