SYSTEM FOR PLANT CO-TRANSFORMATION AND METHODS OF USE

DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Second Action Non-Final It is noted that this Office action is a Second Action Non-Final. The Office is re-opening prosecution to make a new rejection over the position that RUBY would be a design choice and finding the recombination site would be obvious. Status of the Claims The amendments received on 07/13/2026 have been entered. Claims 1-2, 7, 9, 16-22, and 44-47 are pending. Claims 3-6, 8, and 10-15 have been canceled. Claims 44-47 have been newly added. Claim 9 remains withdrawn and new claims 46-47 are withdrawn for being directed to a non-elected species. Claims 1, 7, 9, 17-18, 10, and 22 have been amended. Claims 1-2, 7, 16-22, and 44-45 are examined in this Office action. Objections/Rejections that are Withdrawn The objection to and/or rejection of claims 3-6, 8, and 10-15 has been rendered moot by Applicant’s cancelation of the claims. The Objection to the Specification has been withdrawn in light of Applicant’s amendment to the Specification. The 35 USC 112(b) Indefiniteness rejection of claims 17 and 18 has been withdrawn in light of Applicant’s amendment to the claims. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. This is a modified rejection necessitated by claim amendment. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 1-2, 7, 16, 19-22, and 44-45 are rejected under 35 U.S.C. 103 as being unpatentable over CHENG (Cheng et al, Pub. No.: US 2020/0263197 A1; Pub. Date: Aug. 20, 2020; included on IDS dated 01/14/2025) in view of YADAV (Yadav et al., Pub. No.: US 2004/0172688 A1; Pub. Date: Sep. 2, 2004) in further view of YUAN (Yuan et al., June 29, 2022, ACS Synthetic Biology, Vol. 11(7), pages 2513-2517; included on IDS dated 01/14/2025) and HE (He et al., 2020, Horticultural Research, Vol. 7(152), pages 1-6, and Supplementary information; included on IDS dated 01/14/2025). Claim 1 recites “[a] split selectable marker system for plant co-transformation, the system comprising: A) a first vector comprising: (i) from 5' to 3', and operably linked: a first promoter, a nucleotide sequence encoding an N-terminal fragment of a selectable marker protein; a nucleotide sequence encoding an N-terminal fragment of an intein; and a first terminator; wherein the nucleotide sequence encoding the N-terminal fragment of the selectable marker protein is linked, in frame, to the nucleotide sequence encoding the N- terminal fragment of the intein; and (ii) a first gene of interest, wherein the first gene of interest comprises a promoter, a coding sequence, and a terminator; and B) a second vector comprising: (i) from 5' to 3', and operably linked: a second promoter, a nucleotide sequence encoding a C-terminal fragment of the intein; a nucleotide sequence encoding a C-terminal fragment of the selectable marker protein; and a second terminator; wherein the nucleotide sequence encoding the C-terminal fragment of the intein is linked, in frame, to the nucleotide sequence encoding the C-terminal fragment of the selectable marker protein; and (ii) a second gene of interest, wherein the second gene of interest comprises a promoter, a coding sequence, and a terminator; wherein upon expression in a plant cell, the N-terminal fragment and the C-terminal fragment of the intein join the N-terminal fragment and the C-terminal fragment of the selectable marker protein to form a peptide bond; and wherein the selectable marker protein is (a) a protein component of a RUBY reporter system, wherein the protein component comprises the amino acid sequence as set forth in SEQ ID NO: 1, and wherein the split between the N-terminal fragment and the C-terminal fragment of the protein component occurs at an amino acid position within the first 240 amino of SEQ ID NO: 1; or (b) an eYGFPuv protein comprising the amino acid sequence as set forth in SEQ ID NO: 3, and the split between the N-terminal fragment and the C-terminal fragment of the eYGFPuv protein occurs at an amino acid position within the first 75 amino acids of SEQ ID NO: 3”. In regard to claims 1, 7, and 22, CHENG teaches and claims a split intein selectable marker system for the production and selection of transgenic cells (i.e., a split selectable marker system for plant co-transformation) (Cheng, Abstract). CHENG teaches and claims a method comprising delivering to eukaryotic cells (i.e., a method of co-transforming plant cells, the method comprising delivering DNA vectors into a plant cell (instant claim 22)) (a) a first vector comprising (i) a nucleotide sequence encoding an N-terminal fragment of a selectable marker protein (i.e., a nucleotide sequence encoding an N-terminal fragment of a selectable marker protein), which is upstream from a nucleotide sequence encoding an N-terminal fragment of an intein (i.e., from 5’ to 3’; a nucleotide sequence encoding an N-terminal fragment of an intein) and (ii) a nucleotide sequence encoding a first molecule of interest (i.e., a first gene of interest); and (b) a second vector comprising (i) a nucleotide sequence encoding a C-terminal fragment of the intein (i.e., a nucleotide sequence encoding a C-terminal fragment of an intein), which is upstream from a C-terminal fragment of the selectable marker protein (i.e., from 5’ to 3’; a nucleotide sequence encoding an N-terminal fragment of a selectable marker protein) and (ii) a nucleotide sequence encoding a second molecule of interest (i.e., a second gene of interest), wherein the N-terminal fragment and the C-terminal fragment of the intein catalyze joining of the N-terminal fragment and the C-terminal fragment of the selectable marker protein to produce a full-length selectable marker protein (i.e., wherein the N-terminal fragment and the C-terminal fragment of the intein join the N-terminal fragment and the C-terminal fragment of the selectable marker protein to form a peptide bond) (Cheng, page 1, paragraph 0006; claim 1). CHENG teaches a vector includes a promoter operably linked to a nucleic acid encoding a fragment of an intein and a fragment of selectable marker protein; a vector also comprises a promoter operably linked to a nucleic acid, such as a transgene, encoding a molecule of interest (i.e., operably linked) (Cheng, page 7, paragraph 0050). CHENG teaches delivering to a composition comprising eukaryotic cells two or more vectors, wherein each vector comprises (i) a nucleotide sequence encoding a selectable marker protein fragment linked to an N-terminal intein protein fragment and/or a C-terminal intein protein fragment and (ii) a nucleotide sequence encoding a molecule of interest, wherein the intein protein fragments, when joined in frame (i.e., linked, in-frame) to form full-length function proteins, catalyze joining of the selectable marker protein fragments to produce a full-length selectable marker protein (Cheng, page 1, paragraph 0006). CHENG teaches a first promoter and a second promoter (see Fig. 1A below; Pr = promoter) (i.e., a first promoter and a second promoter) (Cheng, Fig. 1A). PNG media_image1.png 557 851 media_image1.png Greyscale CHENG does not explicitly teach a first terminator or a second terminator. CHENG does not explicitly teach a first gene of interest, wherein the first gene of interest comprises a promoter, a coding sequence, and a terminator, or a second gene of interest, wherein the second gene of interest comprises a promoter, a coding sequence, and a terminator. However, YADAV teaches constructs and methods to introduce a protein splicing mechanism into plants by employing inteins and transgenes. Inteins function effectively in plants when they contain plant optimized codons, leading to their self-excision from a protein precursor and ligation of the extein fragments to produce a mature or active protein in the plant. This mechanism can be utilized to assemble exteins into large protein polymers (including structural proteins and bioactive proteins), hybrid protein polymers, and circular protein polymers. Further, by selectively choosing promoters responsive to various inducers, plant tissues, or plant developmental states, it is possible to control the protein splicing mechanism so as to produce complex mature and active protein products under selected environmental conditions, in selected plant tissues, at selected development stages, or in selected plant generations. This permits use of the intein-mediated protein splicing reaction as a means to activate regulatory protein factors and enzymes, and thus control gene expression and metabolism. The present invention and its embodiments therefore can benefit plant-based protein polymer production methods and have use in agronomic practice for various other agricultural and industrial applications (Yadav, page 5, paragraph 0073). YADAV teaches that a split intein is comprised of two distinct polypeptides or proteins, referred to as the “N-terminal” or N-intein (abbreviated as IntN, Intn or Int-n) and the “C-terminal” or C-intein (abbreviated as IntC, Intc or Int-c) because of their homology to the N-terminal and C-terminal regions of non-split inteins, respectively. Together IntN and IntC polypeptides, when operably linked to foreign polypeptides, possess all necessary functionality to complete a trans-protein splicing reaction, whereby the two foreign “extein” fragments are ligated together by formation of a peptide bond (Yadav, page 5, paragraph 0080). YADAV further teaches that an intein cassette refers to a synthetic construct that minimally includes an intein or a portion thereof, and an extein. This encompasses split intein constructs that have the structures of ExtN-IntN and IntC-ExtC. An intein cassette may possess intervening sequences between the intein sequence and extein fragment that are destined to produce a mature, active protein. These intervening sequences may include, for example, regulatory sequences (e.g., promoters and 3′ terminators) (i.e., a first terminator and a second terminator) (Yadav, page 6, paragraph 0082). Additionally, YADAV teaches an expression cassette that contains a DNA sequence for a selected gene product (i.e., a transgene) for expression in the host cell. This expression cassette typically includes a 5′ promoter region, the transgene ORF, and a 3′ terminator region, with all necessary regulatory sequences required for transcription and translation of the ORF (i.e., a first gene of interest, wherein the first gene of interest comprises a promoter, a coding sequence, and a terminator, and a second gene of interest, wherein the second gene of interest comprises a promoter, a coding sequence, and a terminator) (Yadav, page 9, paragraph 0119). YADAV teaches plasmids pGISN containing the 35S-Pro::GUSn/Intn::NOS-T chimeric gene, and pGISC containing the 35-Pro::Intc/GUSc::NOS-Ter chimeric gene (Yadav, Example 15, page 28, paragraph 0329; Figure 19 below). PNG media_image2.png 223 558 media_image2.png Greyscale Neither CHENG nor YADAV explicitly teach wherein the selectable marker protein is (a) a protein component of a RUBY reporter system, wherein the protein component comprises the amino acid sequence as set forth in SEQ ID NO: 1, and wherein the split between the N-terminal fragment and the C-terminal fragment of the protein component occurs at an amino acid position within the first 240 amino of SEQ ID NO: 1; or (b) an eYGFPuv protein comprising the amino acid sequence as set forth in SEQ ID NO: 3, and the split between the N-terminal fragment and the C-terminal fragment of the eYGFPuv protein occurs at an amino acid position within the first 75 amino acids of SEQ ID NO: 3. However, YUAN teaches that an intein-mediated split system was adapted and optimized in plant cells by a successful demonstration of split-eYGFPuv expression (Yuan, Abstract). Protein splicing elements (called “inteins”) allow the coding sequence of a target protein to be split into two inactive fragments, which can then be reconstituted post-translationally. An eYGFPuv reporter was selected to test the efficacy of the split system. Given that the obligatory cysteine residue on the C-extein junction and a residue on the N-extein junction promote substantial trans-splicing activities, one potential split site T52:C53 was identified to split the eYGFPuv into two fragments, F1 and F2 (see Figure 1c below) (i.e., an eYGFPuv protein comprising the amino acid sequence as set forth in SEQ ID NO: 3, and the split between the N-terminal fragment and the C-terminal fragment of the eYGFPuv protein occurs at an amino acid position within the first 75 amino acids of SEQ ID NO: 3 (instant claim 1); wherein the selectable marker protein is a protein that produces a visible signal (instant claim 22)) (Yuan, Results and Discussion, page 2513 and Figure 1c). PNG media_image3.png 55 287 media_image3.png Greyscale Although YUAN does not disclose the sequence of the eYGFPuv reporter, absent evidence to the contrary, the eYGFPuv reporter as taught by YUAN is interpreted as the same eYGFPuv reporter claimed in the instant application (author Yuan is listed as an inventor of the instant invention). Furthermore, HE teaches that the bright red color seen in beets, dragon fruit, Swiss chard, and other plants is resulted from accumulation of betalains. Biosynthesis of betalains has been well studied and only needs three enzymatic reactions to convert tyrosine into betalain. Betalain has a very bright red color, which potentially can serve as a reporter to track gene expression or to visualize transgenic events. Because every cell contains the amino-acid tyrosine, exogenous application of tyrosine to tissues may not be required. We hypothesized that betalain would be a more convenient reporter than the aforementioned reporters. It is visible to naked eyes without any needs for special equipment. It does not require processing samples and it allows continuously monitoring events throughout the life cycle of an organism. Moreover, it is applicable to large plants grown under normal field conditions. Herein, we synthesize an artificial open reading frame named RUBY that when expressed can produce all of the enzymes required for betalain biosynthesis. We show that RUBY is a very effective marker for noninvasively selecting transformation events in both rice and Arabidopsis. Moreover, we show that RUBY can be used to visualize gene expression without any chemical treatments or special equipment, providing useful tools for visualizing gene expression in large plants under natural field growth conditions (He, Introduction, page 2). HE teaches the complete sequence of the RUBY reporter gene which shares 100% sequence identity with the RUBY reporter gene of instant sequence SEQ ID NO: 2, which encodes instant SEQ ID NO: 1 (see alignment below; He, Supplemental Figure 1). RUBY consists of the linked CYP76AD1, DODA, and glucosyltransferase (GT) coding regions (He, page 5, left column, last paragraph). The instant specification describes that the RUBY reporter is encoded by three genes CYP76AD1, DODA, and glucosyltransferase (GT) (Example 1, page 48, paragraph 0118). HE RUBY GENE SEQUENCE ALIGNED WITH INSTANT SEQ ID NO: 2 Qy 1 ATGACCGCCATCAAGATGAACACCAACGGCGAGGGCGAGACACAGCACATCCTCATGATC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2449 ATGACCGCCATCAAGATGAACACCAACGGCGAGGGCGAGACACAGCACATCCTCATGATC 2508 Qy 61 CCGTTCATGGCGCAGGGCCACCTCAGGCCATTTCTCGAACTCGCCATGTTCCTCTACAAG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2509 CCGTTCATGGCGCAGGGCCACCTCAGGCCATTTCTCGAACTCGCCATGTTCCTCTACAAG 2568 Qy 121 CGCTCCCACGTGATCATCACCCTGCTCACAACTCCGCTCAACGCCGGCTTCCTCAGGCAC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2569 CGCTCCCACGTGATCATCACCCTGCTCACAACTCCGCTCAACGCCGGCTTCCTCAGGCAC 2628 Qy 181 CTCCTTCACCACCATTCCTACTCCTCCAGCGGCATCAGGATCGTCGAGCTGCCATTCAAC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2629 CTCCTTCACCACCATTCCTACTCCTCCAGCGGCATCAGGATCGTCGAGCTGCCATTCAAC 2688 Qy 241 TCCACCAACCACGGACTCCCACCGGGCATCGAGAACACCGATAAGCTCACACTCCCGCTC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2689 TCCACCAACCACGGACTCCCACCGGGCATCGAGAACACCGATAAGCTCACACTCCCGCTC 2748 Qy 301 GTGGTGTCCCTCTTCCATTCCACCATCAGCCTCGATCCGCACCTCCGCGATTACATCTCC 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2749 GTGGTGTCCCTCTTCCATTCCACCATCAGCCTCGATCCGCACCTCCGCGATTACATCTCC 2808 Qy 361 AGGCATTTCAGCCCAGCCAGGCCACCACTCTGCGTGATCCATGATGTGTTCCTCGGCTGG 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2809 AGGCATTTCAGCCCAGCCAGGCCACCACTCTGCGTGATCCATGATGTGTTCCTCGGCTGG 2868 Qy 421 GTTGACCAGGTGGCCAAGGATGTGGGCTCTACAGGCGTGGTGTTCACAACAGGCGGCGCT 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2869 GTTGACCAGGTGGCCAAGGATGTGGGCTCTACAGGCGTGGTGTTCACAACAGGCGGCGCT 2928 Qy 481 TATGGCACATCCGCCTACGTGTCCATCTGGAACGATCTCCCGCACCAGAACTACTCCGAC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2929 TATGGCACATCCGCCTACGTGTCCATCTGGAACGATCTCCCGCACCAGAACTACTCCGAC 2988 Qy 541 GACCAAGAGTTCCCGCTGCCAGGCTTCCCAGAGAACCATAAGTTCCGCAGGTCCCAGCTC 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2989 GACCAAGAGTTCCCGCTGCCAGGCTTCCCAGAGAACCATAAGTTCCGCAGGTCCCAGCTC 3048 Qy 601 CATCGGTTCCTCAGATATGCCGACGGCTCCGACGATTGGTCCAAGTATTTCCAGCCGCAG 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3049 CATCGGTTCCTCAGATATGCCGACGGCTCCGACGATTGGTCCAAGTATTTCCAGCCGCAG 3108 Qy 661 CTCCGCCAGTCCATGAAGTCTTTTGGCTGGCTCTGCAACTCCGTGGAAGAGATCGAGACA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3109 CTCCGCCAGTCCATGAAGTCTTTTGGCTGGCTCTGCAACTCCGTGGAAGAGATCGAGACA 3168 Qy 721 CTCGGCTTCTCCATCCTCCGCAACTACACCAAGCTGCCGATCTGGGGCATCGGCCCACTT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3169 CTCGGCTTCTCCATCCTCCGCAACTACACCAAGCTGCCGATCTGGGGCATCGGCCCACTT 3228 Qy 781 ATTGCTTCCCCAGTGCAGCACTCCTCCTCCGACAACAATTCAACAGGCGCCGAGTTCGTG 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3229 ATTGCTTCCCCAGTGCAGCACTCCTCCTCCGACAACAATTCAACAGGCGCCGAGTTCGTG 3288 Qy 841 CAGTGGCTCAGCCTCAAAGAGCCGGACTCCGTCCTCTACATCTCCTTCGGCTCCCAGAAC 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3289 CAGTGGCTCAGCCTCAAAGAGCCGGACTCCGTCCTCTACATCTCCTTCGGCTCCCAGAAC 3348 Qy 901 ACGATCAGCCCGACGCAGATGATGGAACTCGCTGCTGGCCTTGAGTCCTCCGAGAAGCCA 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3349 ACGATCAGCCCGACGCAGATGATGGAACTCGCTGCTGGCCTTGAGTCCTCCGAGAAGCCA 3408 Qy 961 TTCCTCTGGGTGATCAGAGCCCCGTTCGGCTTCGACATCAACGAAGAGATGCGCCCAGAG 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3409 TTCCTCTGGGTGATCAGAGCCCCGTTCGGCTTCGACATCAACGAAGAGATGCGCCCAGAG 3468 Qy 1021 TGGCTGCCAGAGGGCTTTGAGGAACGCATGAAGGTGAAGAAACAGGGCAAGCTCGTGTAC 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3469 TGGCTGCCAGAGGGCTTTGAGGAACGCATGAAGGTGAAGAAACAGGGCAAGCTCGTGTAC 3528 Qy 1081 AAGCTCGGCCCGCAGCTTGAGATCCTCAACCATGAATCCATCGGCGGCTTTCTCACCCAC 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3529 AAGCTCGGCCCGCAGCTTGAGATCCTCAACCATGAATCCATCGGCGGCTTTCTCACCCAC 3588 Qy 1141 TGCGGATGGAACAGCATCCTTGAGTCTCTTCGCGAGGGCGTTCCGATGCTTGGATGGCCA 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3589 TGCGGATGGAACAGCATCCTTGAGTCTCTTCGCGAGGGCGTTCCGATGCTTGGATGGCCA 3648 Qy 1201 CTTGCTGCCGAGCAGGCCTACAACCTCAAGTACCTCGAAGATGAGATGGGCGTCGCGGTT 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3649 CTTGCTGCCGAGCAGGCCTACAACCTCAAGTACCTCGAAGATGAGATGGGCGTCGCGGTT 3708 Qy 1261 GAGCTTGCTAGAGGCCTCGAAGGCGAGATCTCCAAAGAGAAGGTCAAGCGCATCGTCGAG 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3709 GAGCTTGCTAGAGGCCTCGAAGGCGAGATCTCCAAAGAGAAGGTCAAGCGCATCGTCGAG 3768 Qy 1321 ATGATCCTTGAGCGCAACGAGGGCTCCAAAGGCTGGGAGATGAAGAATCGCGCCGTGGAA 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3769 ATGATCCTTGAGCGCAACGAGGGCTCCAAAGGCTGGGAGATGAAGAATCGCGCCGTGGAA 3828 Qy 1381 ATGGGCAAAAAGCTCAAGGACGCCGTGAACGAGGAAAAAGAGCTGAAGGGCTCCTCCGTG 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3829 ATGGGCAAAAAGCTCAAGGACGCCGTGAACGAGGAAAAAGAGCTGAAGGGCTCCTCCGTG 3888 Qy 1441 AAGGCGATCGACGATTTCCTCGACGCCGTCATGCAGGCCAAACTTGAGCCAAGCCTCCAG 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3889 AAGGCGATCGACGATTTCCTCGACGCCGTCATGCAGGCCAAACTTGAGCCAAGCCTCCAG 3948 Qy 1501 TGATAGTGA 1509 ||||||||| Db 3949 TGATAGTGA 3957 Although HE does not explicitly teach wherein the split between the N-terminal fragment and the C-terminal fragment of the protein component occurs at an amino acid position within the first 240 amino acids of SEQ ID NO: 1 or at amino acid position L231:C232 of SEQ ID NO: 1, there are only a finite number of sites at which to split the RUBY reporter gene. Additionally, the instant Specification describes that the selectable marker is a protein that produces a visible signal – a red pigment or fluorescent signal. Non-limiting examples of fluorescent proteins that may be used as provided herein include TagCFP, mTagCFP2, Czurite, ECFP2, mKalama1, Sirius, Sapphire, T-Sapphire, ECFP, Cerulean, SCFP3C, mTurquoise, mTurquoise2, monomeric Midoriishi-Cyan, TagCFP, mTFP1, EGFP, Emerald, Superfolder GFP, Monomeric Czami Green, TagGFP2, mUKG, mWasabi, Clover, mNeonGreen, EYFP, Citrine, Venus, SYFP2, TagYFP, Monomeric Kusabira-Orange, mKOK, mKO2, mOrange, mOrange2, mRaspberry, mCherry, mStrawberry, mScarlet, mTangerine, tdTomato, TagRFP, TagRFP-T, mCpple, mRuby, mRuby2, mPlum, HcRed-Tandem, mKate2, mNeptune, NirFP, TagRFP657, IFP1.4 and iRFP (page 25, paragraph 0065). The MPEP 2144.04 states "In re Japikse, 181 F.2d 1019, 86 USPQ 70 (CCPA 1950) (Claims to a hydraulic power press which read on the prior art except with regard to the position of the starting switch were held unpatentable because shifting the position of the starting switch would not have modified the operation of the device.); In re Kuhle, 526 F.2d 553, 188 USPQ 7 (CCPA 1975) (the particular placement of a contact in a conductivity measuring device was held to be an obvious matter of design choice)". Thus, the use of RUBY in the split selectable marker system of the instant invention is an obvious matter of design choice. At the time the instant application was filed, it would have been obvious and within the scope of one of ordinary skill in the art to construct a split intein selectable marker system for the production and selection of transgenic cells as taught by CHENG, additionally comprising a first terminator and a second terminator; and a first gene of interest, wherein the first gene of interest comprises a promoter, a coding sequence, and a terminator, and a second gene of interest, wherein the second gene of interest comprises a promoter, a coding sequence, and a terminator, as taught by YADAV, and using the eYGFPuv reporter as the selectable marker protein as taught by YUAN or the RUBY reporter as taught by HE. One would have been motivated to combine the teachings of CHENG, YADAV, YUAN, and HE to better regulate the transcription, RNA processing or stability, or translation of the associated coding sequence. Thus, one of ordinary skill in the art would have a high expectation of success by combining the teachings of CHENG, YADAV, YUAN, and HE. In regard to claim 2, YADAV teaches suitable regulatory sequences will include, but are not limited to: constitutive plant promoters, plant tissue-specific promoters, plant developmental stage-specific promoters, inducible plant promoters and viral promoters (i.e., wherein the first promoter and the second promoter are each an inducible or constitutive promoter) (Yadav, page 6, paragraph 0092). In regard to claim 16, CHENG teaches and claims that the first intein is a NpuDnaE intein and the second intein is a NpuDnaE intein (i.e., wherein the intein is NpuDnaE) (Cheng, page 6, paragraph 0031; claim 11). In regard to claims 19-22, YADAV teaches and claims plant hosts for transformation. Specific examples of useful host plant are: Food plants (annuals): asparagus (Asparagus), banana (Musa), barley (Hordeum), blueberry (Vaccinium), broad bean (Vicia), cacao (Theobroma), capsicum pepper (Capsicum), carrot (Daucus), cassava (Manihot), corn (Zea), cucumber (Cucumis), eggplant (Solanum), Lentil (lens), lettuce (Lactuca), mango (Mangifera), oilseed rape, canola, cabbage, broccoli, cauliflower (Brassica), oat (Avena), onions (Allium), papaya (Carica), peas (Pisum), peanut (Arachis), pineapple (Ananas), pinto bean, mung bean, lima bean (Phaseolus), potato (Solanum), pumpkin, zucchini (Cucurbita), radish (Raphanus), rice (Oryza), rye (Secale), sesame (Sesame), spinach (Spinaceae), sorphum (Sorphum), soybean (Glycine), strawberry (Fragaria), sugarcane (Saccharum), sugar beet (Beta), sunflower (Helianthus), sweet potato (Ipomoea), tomato (Lycopersicom), watermelon (Citrullus), wheat (Triticum), and yam (Dioscorea). Non-food plants (annuals): alfalfa (Medicago), amaranth (Amaranthus), angelica (Agelica), arabidopsis (Arabidopsis), castorbean (Ricinus), cotton (Gossypium), colewort (Crambe), dandelion (Taraxacum), flax (Linum), hemp (Cannabis), jojoba (Simmondsia), jute (Corchorus), kenaf (Hibiscus), lupine (Lupinus), petunia (Petunia), plantain (Plantago), sisal (Agave), snapdragon (Antirrhinum), switch grass (Panicum), and tobacco (Nicotiana). Arboreous plants: apple (Malus), acacia (Acacia), chestnut (Castanea), citrus (Citrus), coconut (Cocos), coffee (Coffea), cypress (Cupressus), eucalypti (Eucalyptus), grape (Vitis), hemlock (Tsuga), hickory (Carya), maple (Acer), oak (Quercus), pear (Pyrus), peach, plum, cherry (Prunus), pine (Pinus), poplar (Populus), rose (Rosa), spruce (Picea), and walnut (Juglans) (i.e., wherein the plant is an herbaceous or woody plant (instant claim 19); wherein the herbaceous plant is selected from the group comprising Arabidopsis thaliana, Brassica rapa, Glycine max, Nicotiana benthamiana, Oryza sativa, Solanum lycopersicum, Solanum tuberosum, Panicum virgatum, Sorghum bicolor, and Zea mays (instant claim 20); wherein the woody plant is selected from the group comprising Citrus sinensis, Eucalyptus grandis, Malus domestica, Populus tremula x P. alba INRA 717-1B4, Prunus persica, and Vitis vinifera (instant claim 21); wherein the plant is a woody plant (instant claim 22)) (Yadav, page 12, paragraphs 0148-0151; claim 30). In regard to claims 44 and 45, see claim 1 rejection. Claims 17 and 18 are rejected under 35 U.S.C. 103 as being unpatentable over CHENG (Cheng et al, Pub. No.: US 2020/0263197 A1; Pub. Date: Aug. 20, 2020), YADAV (Yadav et al., Pub. No.: US 2004/0172688 A1; Pub. Date: Sep. 2, 2004), YUAN (Yuan et al., June 29, 2022, ACS Synthetic Biology, Vol. 11(7), pages 2513-2517) and HE (He et al., 2020, Horticultural Research, Vol. 7(152), pages 1-6, and Supplementary information) as applied to claims 1-2, 7, 16, 19-22, and 44-45 above, and in further view of ZETTLER (Zettler et al., 2009, FEBS Letters, Vol. 583(5), pp. 909-914). Claim 17 recites “[t]he system of claim 16, wherein the split between the N-terminal fragment and the C-terminal fragment of NpuDnaE occurs at amino acid position within the first 110 amino acids of SEQ ID NO: 9”. CHENG, YADAV, YUAN, and HE teach the system of claim 16. Neither CHENG, YADAV, YUAN, nor HE explicitly teaches wherein the split between the N-terminal fragment and the C-terminal fragment of NpuDnaE occurs at amino acid position within the first 110 amino acids. However, ZETTLER teaches that in protein splicing, an internal protein element, the intein, excises itself out of a precursor protein with concomitant linkage of the two flanking polypeptide sequences, the exteins, by a native peptide bond. The intein domain can also be split into two pieces; in this case two separate polypeptides first associate to reconstitute the active intein followed by the ligation of the fused N- and C-extein sequences through protein trans-splicing. This reaction is highly valuable for a number of in vitro and in vivo applications in the fields of biotechnology, protein and cellular chemistry, as well as molecular and structural biology. For example, it has been used for protein semi-synthesis and selective chemical modification of proteins, generation of cyclic peptides and proteins, segmental isotopic labelling, conditional control of protein function, and construction of reporters of protein-protein interactions. In this study, we have undertaken a first in vitro characterization of the naturally split Npu DnaE intein using purified constructs (Zettler, Introduction, page ). ZETTLER teaches the protein trans-splicing reaction schemes of the Npu DnaE intein constructs used in the study. The amino acids flanking the splice junctions are indicated. The IntN part consists of 102 aa, the IntC part of 36 aa (see Figure below) (i.e., wherein the split between the N-terminal fragment and the C-terminal fragment of NpuDnaE occurs at amino acid position within the first 110 amino acids; wherein the split between the N-terminal fragment and the C-terminal fragment of NpuDnaE occurs at amino acid position N102:I103) (Zettler, Figure 1, page ). PNG media_image4.png 113 612 media_image4.png Greyscale Although ZETTLER does not disclose the sequence for the NpuDnaE intein, ZETTLER does teach that the Npu DnaE intein is a DNA polymerase III (DnaE) intein from Nostoc punctiforme PCC73102 (Npu) (Zettler, Abstract). The instant Specification describes the NpuDnaE intein is selected from DNA polymerase III (DnaE) inteins; DnaE inteins include Synechocystis sp. DnaE (SspDnaE) inteins and Nostoc punctiforme (NpuDnaE) inteins (instant Specification, page 21, paragraph 0054). Thus, absent evidence to the contrary, the NpuDnaE intein as taught by ZETTLER is interpreted as the same NpuDnaE intein claimed in the instant application. At the time the instant application was filed, it would have been obvious and within the scope of one of ordinary skill in the art to split the NpuDnaE intein at position 102/103 as taught by ZETTLER, in the split intein selectable marker system for the production and selection of transgenic cells as taught by CHENG, additionally comprising a first terminator and a second terminator; and a first gene of interest, wherein the first gene of interest comprises a promoter, a coding sequence, and a terminator, and a second gene of interest, wherein the second gene of interest comprises a promoter, a coding sequence, and a terminator, as taught by YADAV, and an eYGFPuv as taught by YUAN or a RUBY reporter as taught by HE. One would have been motivated to combine the teachings of CHENG, YADAV, YUAN, HE, and ZETTLER knowing that the NpuDnaE fusion constructs taught by ZETTLER were converted to the splice products in excellent yields from about 55% to 90%. Thus, one of ordinary skill in the art would have a high expectation of success by combining the teachings of CHENG, YADAV, YUAN, HE, and ZETTLER. Response to Applicant’s Arguments Applicant's arguments filed 07/13/2026 have been fully considered but they are not persuasive. Applicant asserts that amended claim 1 insofar as the claim reads on SEQ ID NO: 1 is free of the prior art. Further, it is submitted that the additional species of a selectable marker protein (i.e., an eYGFPuv protein comprising SEQ ID NO: 3), recited in claim 1 as amended, is also free of the prior art. Therefore, amended claim 1 cannot be obvious over Cheng and Yadav. The Examiner respectfully disagrees. As outlined in the new USC 103 Rejection above, the RUBY reporter of instant SEQ ID NO: 2 (which encodes SEQ ID NO: 1) is taught by HE. Also, although YUAN (2022) does not explicitly teach the eYGFPuv protein as instant SEQ ID NO: 3, the required split of the eYGFPuv protein is in the exact same place (T52:C53), and YUAN is listed as an inventor of the instant invention as well. So, absent evidence to the contrary, instant SEQ ID NO: 3 is interpreted as the eYGFPuv protein as taught by YUAN (2022). Applicant argues that Cheng and Yadav, either alone or in combination, do not teach or suggest each and every limitation of instant claims 1 or 22. The Examiner respectfully disagrees. In response to applicant's arguments against the references individually, one cannot show non-obviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986). CHENG teaches and claims a split intein selectable marker system for the production and selection of transgenic cells and a method comprising delivering to eukaryotic cells, including plants. YADAV teaches methods for intein-mediated protein splicing, particularly in plants. Obviousness may be established by combining or modifying the teachings of the prior art to produce the claimed invention where there is some teaching, suggestion, or motivation to do so found either in the references themselves or in the knowledge generally available to one of ordinary skill in the art. See In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988), In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992), and KSR International Co. v. Teleflex, Inc., 550 U.S. 398, 82 USPQ2d 1385 (2007). In this case, the combination of the teachings of CHENG and YADAV disclose all of the limitations required by instant claims 1 and 22; thus, one of ordinary skill in the art would have a high expectation of success by combining the teachings of CHENG and YADAV. Summary No claim is allowed. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Correspondence Any inquiry concerning this communication or earlier communications from the examiner should be directed to CHRISTINA MEADOWS whose telephone number is (703)756-1430. The examiner can normally be reached Monday - Friday 9:00 am - 5:00 pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad Abraham can be reached at 571-270-7058. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. CHRISTINA MEADOWS Examiner Art Unit 1663 /CHRISTINA L MEADOWS/Examiner, Art Unit 1663 /Amjad Abraham/SPE, Art Unit 1663