CTNF 18/895,960 CTNF 72793 DETAILED ACTION Continued Examination Under 37 CFR 1.114 07-42-04 AIA A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 5/6/26 has been entered. Claims 20, 21, 23, 24, 27, 29-34, 36 and 42 are currently under examination. Claims 37-41 remain withdrawn for being drawn to a non-elected invention. Rejections which are withdrawn : The former rejection under 35 USC 101 has been obviated by the amendment to the claims. Allowable Subject Matter 12-151-08 AIA 07-43 12-51-08 Claim 42 is objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims. Claim Rejections - 35 USC § 112-2 nd paragraph 07-30-02 AIA The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. 07-34-01 Claims 20, 21, 23, 24, 27, 29-34 and 36 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claims 20 and 21 are vague and indefinite because they recite a ‘genetic homology’ percent requirement to the LB10G strain, yet no nucleic acid sequence for the strain is recited in the claim making it impossible to determine the metes and bounds of the composition . While the specification can be used to provide definitive support, the claims are not read in a vacuum. Rather, the claim must be definite and complete in and of itself. Limitations from the specification will not be read into the claims. The claims as they stand are incomplete and fail to provide adequate structural properties to allow for one to identify what is being claimed. The amendment to include that the strain is identified “using 16S rRNA Sanger sequencing methods” does not remedy this rejection. Appropriate clarification and/or correction is required. Claim Rejections - 35 USC § 112-Written Description 07-30-01 AIA The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. 07-31-01 Claims are 20, 21, 23, 24, 27 and 29-36 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. The instantly amended claims recite, for example: A bacterial strain identified using 16S rRNA Sanger sequencing standard methods as having at least 99.5% genetic homology to Weissella viridescens LB10G, which is deposited as DSM 32906, wherein the bacterial strain is capable of treating, alleviating, suppressing, prophylaxis, and/or preventing growth of a pathogenic micro-organism, wherein the bacterial strain is provided as one or more viable strains, one or more dead or inactivated strains, one or more strain lysates, one or more strain metabolites, or a combination thereof, and wherein the viable bacterial strain is provided in an encapsulated, microencapsulated, spray-dried, and/or lyophilized form . The instant specification does not provide sufficient written description for the scope of this claim. The specification only provides for the strain deposited as DSM 32906 and not any other variants, much less variants with the functional abilities recited in the instant claims, e.g., capable of treating, alleviating, suppressing, prophylaxis, and/or preventing growth of a pathogenic micro-organism. To fulfill the written description requirements set forth under 35 USC § 112, first paragraph, the specification must describe at least a substantial number of the members of the claimed genus , or alternatively describe a representative member of the claimed genus, which shares a particularly defining feature common to at least a substantial number of the members of the claimed genus, which would enable the skilled artisan to immediately recognize and distinguish its members from others, so as to reasonably convey to the skilled artisan that Applicant has possession the claimed invention. Applicants have not described the genus such that the specification might reasonably convey to the skilled artisan that Applicants had possession of the claimed invention at the time the application was filed. With the written description of a genus, however, merely drawing a fence around a perceived genus is not a description of the genus. One needs to show that one has truly invented the genus, i.e., that one has conceived and described sufficient representative species encompassing the breadth of the genus. Otherwise, one has only a research plan, leaving it to others to explore the unknown contours of the claimed genus. See Ariad , 598 F.3d at 1353 (The written description requirement guards against claims that "merely recite a description of the problem to be solved while claiming all solutions to it and . . . cover any compound later actually invented and determined to fall within the claim's functional boundaries."). Abbvie Deutschland GmbH & Co. v. Janssen Biotech, Inc., 759 F.3d 1285, 1300, 111 U.S.P.Q.2d 1780, 1790, 2014 BL 183329, 12 (Fed. Cir. 2014). To fulfill the written description requirements set forth under 35 USC § 112, first paragraph, the specification must describe at least a substantial number of the members of the claimed genus, or alternatively describe a representative member of the claimed genus, which shares a particularly defining feature common to at least a substantial number of the members of the claimed genus, which would enable the skilled artisan to immediately recognize and distinguish its members from others, so as to reasonably convey to the skilled artisan that Applicant has possession the claimed invention. Applicants have not described the genus of claimed fructanases such that the specification might reasonably convey to the skilled artisan that Applicants had possession of the claimed invention at the time the application was filed. The purpose of the "written description" requirement is broader than tomerely explain how to "make and use"; the applicant must convey with reasonableclarity to those skilled in the art that, as of the filing date sought, he or she was inpossession of the invention. The invention is, for purposes of the "writtendescription" inquiry, whatever is now claimed. See Vas-Cath, Inc. v. Mahurkar,935 F.2d 1555, 1563-64, 19 USPQ2d 1111, 1117 (Federal Circuit, 1991).Furthermore, the written description provision of 35 USC § 112 is severable fromits enablement provision; and adequate written description requires more than amere statement that it is part of the invention and reference to a potential methodfor isolating it. The nucleic acid [product] itself is required. See Fiers v. Revel, 25 USPQ2d 1601, 1606 (CAFC 1993) and Amgen Inc. V. Chugai Pharmaceutical Co. Ltd., 18 USPQ2d 1016. Possession may be shown in a variety of ways including description of an actual reduction to practice, or by showing the invention was 'ready for patenting' such as by disclosure of drawings or structural chemical formulas that show that the invention was complete, or by describing distinguishing identifying characteristics sufficient to show that the applicant was in possession of the claimed invention" (Id. at 1104). Moreover, because the claims encompass a genus of variant species, an adequate written description of the claimed invention must include sufficient description of at least a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics sufficient to show that Applicant was in possession of the claimed genus. An objective standard for determining compliance with the written description requirement is, "does the description clearly allow persons of ordinary skill in the art to recognize that he or she invented what is claimed." In re Gosteli , 872 F.2d 1008, 1012, 10 USPQ2d 1614, 1618 (Fed. Cir. 1989). To satisfy the written description requirement, an applicant must convey with reasonable clarity to those skilled in the art that, as of the filing date sought, he or she was in possession of the invention, and that the invention, in that context, is whatever is now claimed. Vas-Cath, Inc. v. Mahurkar , 935 F.2d 1555, 1563-64, 19 USPQ2d 1111, 1117 (Fed. Cir. 1991) and MPEP 2163.02. However, factual evidence of an actual reduction to practice has not been disclosed by Applicant in the specification; nor has Applicant shown the invention was "ready for patenting" by disclosure of drawings or structural chemical formulas that show that the invention was complete; nor has Applicant described distinguishing identifying characteristics sufficient to show that Applicant were in possession of the claimed invention at the time the application was filed. For inventions in an unpredictable art, adequate written description of a genus which embraces widely variant species cannot be achieved by disclosing only one species within the genus'" (Id. at 1106); accordingly, it follows that an adequate written description of a genus cannot be achieved in the absence of a disclosure of at least one species within the genus. The scope of the claim includes numerous structural variants, and the genus is highly variant because a significant number of structural differences between genus members is permitted. One of skill in the art would reasonably conclude that the disclosure fails to provide a representative number of species to describe the genus, and thus, that the applicant was not in possession of the claimed genus. The claimed subject matter is not supported by an adequate written description because a representative number of species has not been described. The scope of the claim includes numerous structural variants and the genus is highly variant because a significant number of structural differences between genus members is permitted and the Genus is highly variable in that strain of the same Genus/species often have different functional capabilities, see former prior art rejections and Applicants’ response of 10/10/25. The specification does not describe any members of the claimed genus by complete structure (with the exception of deposited strain DSM 32906; LB10G). One of skill in the art would reasonably conclude that the disclosure fails to provide a representative number of species to describe the genus, and thus, that the applicant was not in possession of the claimed genus. The claimed subject matter is not supported by an adequate written description because a representative number of species has not been described. There are no drawings or structural formulas disclosed of any of thesefragments or variants of the claimed polynucleotides. There is no teaching in thespecification regarding where the structure can be vary and still provide the functional capabilities recited in the instant claims. Based on the lack of knowledge and predictability in the art, those of ordinary skill in the art would not conclude that the applicant was in possession of the claimed genus of bacterial strains. Genentech Inc. v. Novo Nordisk A/S (CAFC) 42 USPQ2d 1001 clearly states: “Patent protection is granted in return for an enabling disclosure of an invention, not for vague intimations of general ideas that may or may not be workable. See Brenner v. Manson, 383 U.S. 519, 536, 148 USPQ 689, 696 (1966) (stating, in context of the utility requirement, that "a patent is not a hunting license. It is not a reward for the search, but compensation for its successful conclusion.") While every aspect of a generic claim certainly need not have been carried out by an inventor, or exemplified in the specification, reasonable detail must be provided in order to enable members of the public to understand and carry out the invention.” Across the genus Weissella, several distinct species share 16S identities of 99% or greater, illustrating that 16S often lacks the resolution needed to distinguish closely related Weissella strains or even some Weissella species. See Fanelli et al (Front Microbiol. 2022 Jun 22, 2022, 13: 1-16) and Kwak et al (International J. Systematic & Evolutionary Microbio. 69(12): 3672-3675). Additionally, Applicants page 9 of the response to Office Action filed on 10/10/25 recite : Even very small differences in genome sequence (e.g., 0.3-0.5%) can result in meaningful phenotypic distinctions, including metabolic activity, bacteriocin production, or resistance to stress conditions . The claims include strains with a “0.5%” difference . The standard under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA), first paragraph 112, written description, is that adequate written description requires more than a mere statement that it is part of the invention and reference to a potential method for isolating it. The nucleic acid [product] itself is required. See Fiers v. Revel, 25 USPQ2d 1601, 1606 (CAFC 1993) and Amgen Inc. V. Chugai Pharmaceutical Co. Ltd., 18 USPQ2d 1016. Applicant is referred to the revised guidelines concerning compliance with the written description requirement of U.S.C. 112, first paragraph, published in the Official Gazette and also available at www.uspto.gov. Claim Rejections - 35 USC § 103 07-20-aia AIA The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. 07-21-aia AIA Claim (s) 20, 21, 23, 24, 27, 29-32, 34 and 36 is/are rejected under 35 U.S.C. 103 as being unpatentable over Sica et al. (Revista De Biologia Marina Y Oceanografia. 2010. 45(3): 389-397; provided by Applicants) and Ham et al (KR20120038698; April 24, 2012; provided by Applicants) in light of Fanelli et al (Front Microbiol. 2022 Jun 22, 2022, 13: 1-16) and Kwak et al (International J. Systematic & Evolutionary Microbio. 69(12): 3672-3675) . The claims are drawn to, for example: a bacterial strain identified using 16SrRNA Sanger sequence standard methods as having at least 99.5% genetic homology to Weissella viridescens LBG10, deposited as DSM 32906, wherein the bacterial strain is capable of treating, alleviating, suppressing, prophylaxis, and/or preventing growth of a pathogenic micro-organism, wherein the bacterial strain is provided as one or more viable strains, one or more dead or inactivated strains, one or more strain lysates, one or more strain metabolites, or a combination thereof, and wherein the viable bacterial strain is provided in an encapsulated, microencapsulated, spray- dried, and/or lyophilized form. Sica et al. discloses bacteria belonging to the genera Lactobacillus, Enterococcus and Weissella among others capable of inhibiting pathogenic Listeria monocytogenes. Sica discloses bacteria belonging to the genera Lactobacillus, Enterococcus and Weissella among others capable of inhibiting pathogenic Listeria monocytogenes. Some isolates have 99 or 100% genome similarity with strains of Weissella viridescens (see table 2, p.393). Ham et al discloses Weissella viridescens strains that also inhibit S. aureus (see abstract). Sang discloses Weissella viridescens strain 2-T-2-20 that inhibits the growth of methicillin-resistant Staphylococcus aureus . The abstract recites: A Weissella viridescens with MRSA (methicillin-resistant Staphylococcus aureus) suppression ability is provided to enhance health of human body and livestock. CONSTITUTION: A Weissella viridescens 2-T-2-20(deposit number KACC91550) has an ability of suppressing MRSA. A probiotic composition contains the bacteria or culture liquid thereof as an active ingredient. The probiotic composition is used as an additive for feed or food. The probiotic composition is a pharmaceutical composition containing a pharmaceutical carrier and excipient. The morphological characteristics of lactic acid bacteria with a clear MRSA inhibitory effect were as shown in Figure 4 of Ham, and as described in sequence listing 1, 16S rRNA sequence analysis identified as Weissella viridescens. The morphological characteristics of lactic acid bacteria with a clear MRSA inhibitory effect were as shown in Figure 4, and as described in sequence listing 1, 16S rRNA sequence analysis identified as Weissella viridescens. The W.viridescens 2-T-2-20 strain was cultured in MRS broth and fed to 3 pigs (145~170kg) mixed with feed at 100mL per head every day for a week. Figure 6 shows a photograph of livestock (pig) used in the feeding test of Bicella viridescence 2-T-2-20 culture medium. Figure 7 shows the graph of the change in the number of lactobacilli in pig feces before and after feeding Weissella viridescence 2-T-2-20. Figure 8 likewise shows the number of staph bacteria in pig feces before and after treatment of the strain, and Figure 9 shows the change in the number of antibiotic-resistant staph bacteria before and after treatment of the same strain. Analysis of microorganisms in pig feces before and after feeding of Weisella viridescence 2-T-2-20 showed that the number of lactic acid bacteria (yellow colony in BCP agar) was 1.5×10 8 1.8×10 in CFU/g 9 CFU/g, while the staph count (Baird Parker agar colony) was 1.4×10 8 2.1×10 at CFU/g 6 CFU/g is approximately 1/100, and the number of antibiotic-resistant staph bacteria (CHROMagar MRSA) is 8.6×10 4 3.7×10 in CFU/g 3 CFU/g, which was reduced by about 1/20. It is noted that claim 30 uses the term ‘preferably a topical composition’ which does not limit the claim to ‘topical’ and may read on the part of the claim that recites ‘oral composition. Further, ‘topical composition’ is an intended use. A recitation of the intended use of the claimed invention must result in a structural difference between the claimed invention and the prior art in order to patentably distinguish the claimed invention from the prior art. If the prior art structure is capable of performing the intended use, then it meets the claim. The structure is the same as that taught in the prior art. Although Sica et al and Ham et al do not recite that the strain is LBG10, deposited as DSM 32906 , the instant claims allow for a bacterial strain having ‘genetic homology of at least 99.5-99.8% to LB10G. Given the strains are of the same Genus and species and have the same functional ability to prevent and suppress the growth of pathogenic microorganisms, particularly S. aureus, the genome similarity would be expected to be close to 99% identical. Multiple 16S rRNA gene sequence identity is greater than 99% identity among W. viridescens strains. The claimed bacterial strain and the strains of the prior art appear to be obvious or analogous variants since they possess similar functional characteristics (i.e., inhibit and reduce pathogenic bacteria, particularly S. aureus) and they are the same Genus and species. Since the Patent Office does not have the facilities for examining and comparing applicants' product with the product of the prior art reference, the burden is on applicants to show an unobvious distinction between the material structural and functional characteristics of the claimed product and the product of the prior art. See In re Best , 562 F.2d 1252, 195 USP PQ 430 (CCPA 1977. With respect to the concentrations recited in instant claims 31 and 32, they are within the ranges taught by Ham. Additionally, these concentrations are result effective variables. It has long been settled to be no more than routine experimentation for one of ordinary skill in the art to discover an optimum value of a result effective variable. "[W]here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum of workable ranges by routine experimentation." Application of Aller, 220 F.2d 454, 456, 105 USPQ 233, 235-236 (C.C.P.A. 1955). "No invention is involved in discovering optimum ranges of a process by routine experimentation." Id. at 458, 105 USPQ at 236-237. The "discovery of an optimum value of a result effective variable in a known process is ordinarily within the skill of the art." Application of Boesch, 617 F.2d 272, 276, 205 USPQ 215, 218-219 (C.C.P.A. 1980). Since Applicant has not disclosed that the specific limitations recited in the claims are for any particular purpose or solve any stated problem and the prior art teaches these concentrations often vary according to the subject be treated, etc., and different solutions and parameters appear to work equally as well, absent unexpected results, it would have been obvious for one of ordinary skill to discover the optimum workable ranges of the bacterial concentrations of the prior art by normal optimization procedures known in the probiotic/bacterial vaccine art. Further, given the identity of the strains of Sica and Ham , i.e., being the same Genus and species, and possessing the same functional ability, coupled with the breadth of the instant claims (minus the actual deposited strains: claim 42), the Weissella viridescens in the prior art references would reasonably be expected to be within a 98-100% 16S rDNA identity range. A recitation of the intended use of the claimed invention must result in a structural difference between the claimed invention and the prior art in order to patentably distinguish the claimed invention from the prior art. If the prior art structure is capable of performing the intended use, then it meets the claim. The 16S rDNA is an inherent property of the W. viridescens taught by the primary references. It is also not very distinguishing for different strains in the same species, 16S alone isn't enough to distinguish among the strains . Applicants should consider limiting the claims to the deposited strain. Additionally, the typical percent identity of 16S rDNA gene sequences among different strains of Weissella viridescens is very high, usually around: ≥99.5% to 100% The 16S rDNA gene is highly conserved, especially within the same species. The name/deposit alone is not enough to distinguish the claimed bacteria from the bacteria of the prior art, as identical bacteria could be coined with different names. Across the genus Weissella, several distinct species share 16S identities of 99% or greater, illustrating that 16S often lacks the resolution needed to distinguish closely related Weissella strains or even some Weissella species. So if you’re comparing two W. viridescens strains, a 16S identity of: ≥99.5% would be very typical . 99–100% is what would be generally expected to those of ordinary skill in the art. Even ~98.8–99.0% can still occur within the species, though that suggests a relatively divergent strain. ** Fanelli et al (Front Microbiol. 2022 Jun 22, 2022, 13: 1-16) and Kwak et al (International J. Systematic & Evolutionary Microbio. 69(12): 3672-3675) . 07-21-aia AIA Claim (s) 33 is/are rejected under 35 U.S.C. 103 as being unpatentable over Sica et al. (Revista De Biologia Marina Y Oceanografia. 2010. 45(3): 389-397; provided by Applicants) and Ham et al (KR20120038698; April 24, 2012; provided by Applicants), in light of Fanelli et al (Front Microbiol. 2022 Jun 22, 2022, 13: 1-16) and Kwak et al (International J. Systematic & Evolutionary Microbio. 69(12): 3672-3675) and in further view of Desroche et al (US 20180036356) . The teachings of Sica and Ham are set forth above. However, they don’t particularly recite the use of a prebiotic in the compositions. Desroche teaches bacteria having antagonist activities to pathogenic bacteria or yeasts belonging to the genera and species Staphylococcus aureus, Pseudomonas aeruginosa, Streptococcus pyogenes, Enterococcus faecium, Enterobacter cloacae, Proteus mirabilis, Bacteroides fragilis, Staphylococcus epidermidis, Propionibacterium acnes, Candida albicans and/or Malassezia furfur and to the use thereof as an active ingredient or in a medical device, in particular in the treatment and/or prevention of colonization and/or infections related to these pathogenic bacteria or yeasts. The invention relates to care products containing one or more non-pathogenic antagonistic strains intended for the prevention or treatment of infections or colonizations on the skin, wounds, mucosae and superficial body growths. At paragraph [0014] and [0045] Desroche teaches that Lactobacillus plantarum may be one of the active bacteria used in the compositions. Paragraph [0103] teaches that the composition may comprise one or more antagonistic strains, optionally combined with at least one compound chosen from probiotics, prebiotics and yeasts. Among the prebiotics, mention may be made, by way of example, of fructans such as inulin, fructooligosaccharides or trans-galactooligosaccharides, or else long-chain or branched-chain sugars. It would have been prima facie obvious to one of ordinary skill in the art at the time the invention was made to add a prebiotic to the compositions taught by Sica or Ham as is done in Desroche because the references teach similar compositions for similar purposes and prebiotic were long known in the art as a type of specialized plant fiber that feed the microbes and stimulate the growth of healthy bacteria. Status of claims : No claims are presently allowed. Limiting the claims to the bacterial strain which is Weissella viridescens LB10G which is deposited as DSM 32906 would be allowable. Prior art not relied upon : US 2012/0094327, US 8,846,334, US 2015/0010941 [0118] Two of the cultures were identified as Leuconostoc mesenteroides and Weisella viridescens , Lactococcus lactis subspecies lactis and Streptococcus oxalis. [0124] An overnight culture of Weisella viridescens was prepared and diluted into individual MRS broths containing bromcresol purple or chlorophenol red, as described in Example 2. The diluted suspensions were used to inoculate 3M PETRIFILM Aerobic Count plates. After inoculation, the plates were incubated at 30 C for 48 hours. US 2015/0272144 BLE-US-00003 QSF01-BTH-F: (SEQ ID NO: 47) ACGAACGGATAAAGAGCTTGCTCTTTTG QSF01-BTH-R: (SEQ ID NO: 48) CGAAACCGTCTTTCACTTGAACATCTTAT QSF03-BTH-F: (SEQ ID NO: 49) GGACCAGAGGTTATCGAAACATTAACTG QSF03-BTH-R: (SEQ ID NO: 50) TAATACCAGCAGCAGGAATTGCTT [0227] for Weisella viridescens 0209] FIG. 2 shows the result of quantifications of different species (genera/groups). Each circle shows the growth in Δ Log.sub.10 (Log.sub.10 at T.sub.14 days after storage under vacuum and at 8° C., including a shock at 22° C. for 24 hours on day 7-Log.sub.10 at T.sub.0) of different species/groups/genera. Each circle corresponds to an experience (that is a batch of carpaccio from the market). (SER: Serratia group, HAL: Hafnia alvei species, BTH: Brochothrix thermosphacta species, WVI: Weisella viridescens species, LME: Leuconostoc genus (4 species), PSD: Pseudomonas genus (3 species), LSA: Lactobacillus sakei species). A great variability is observed from one batch to the other: the Serratia group for example can develop, during 14 days, from about 1.5 to about 4 Log.sub.10 for example with a median value of 2.69 Log.sub.10. Correspondence regarding this application should be directed to Group Art Unit 1645. Papers related to this application may be submitted to Group 1600 by facsimile transmission. Papers should be faxed to Group 1600 via the PTO Fax Center located in Remsen. The faxing of such papers must conform with the notice published in the Official Gazette, 1096 OG 30 (November 15,1989). The Group 1645 Fax number is 571-273-8300 which is able to receive transmissions 24 hours/day, 7 days/week. Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). Any inquiry concerning this communication or earlier communications from the examiner should be directed to Jennifer E. Graser whose telephone number is (571) 272-0858. The examiner can normally be reached on Monday-Friday from 8:00 AM-4 PM. If attempts to reach the examiner by telephone are unsuccessful, the examiner's supervisor, Thomas Visone, can be reached at (571) 270-0684. Any inquiry of a general nature or relating to the status of this application should be directed to the Group receptionist whose telephone number is (571) 272-0500. /JENNIFER E GRASER/ Primary Examiner, Art Unit 1645 6/3/26 Application/Control Number: 18/895,960 Page 2 Art Unit: 1645 Application/Control Number: 18/895,960 Page 3 Art Unit: 1645 Application/Control Number: 18/895,960 Page 4 Art Unit: 1645 Application/Control Number: 18/895,960 Page 5 Art Unit: 1645 Application/Control Number: 18/895,960 Page 6 Art Unit: 1645 Application/Control Number: 18/895,960 Page 7 Art Unit: 1645 Application/Control Number: 18/895,960 Page 8 Art Unit: 1645 Application/Control Number: 18/895,960 Page 9 Art Unit: 1645 Application/Control Number: 18/895,960 Page 10 Art Unit: 1645 Application/Control Number: 18/895,960 Page 11 Art Unit: 1645 Application/Control Number: 18/895,960 Page 12 Art Unit: 1645 Application/Control Number: 18/895,960 Page 13 Art Unit: 1645 Application/Control Number: 18/895,960 Page 14 Art Unit: 1645 Application/Control Number: 18/895,960 Page 15 Art Unit: 1645 Application/Control Number: 18/895,960 Page 16 Art Unit: 1645 Application/Control Number: 18/895,960 Page 17 Art Unit: 1645