Prosecution Insights
Last updated: July 17, 2026
Application No. 18/905,108

PLANT REGULATORY ELEMENTS AND USES THEREOF

Non-Final OA §102§112§DP
Filed
Oct 02, 2024
Priority
May 13, 2011 — provisional 61/485,876 +6 more
Examiner
BOGGS, RUSSELL T
Art Unit
1663
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Monsanto Technology LLC
OA Round
1 (Non-Final)
73%
Grant Probability
Favorable
1-2
OA Rounds
1y 1m
Est. Remaining
88%
With Interview

Examiner Intelligence

Grants 73% — above average
73%
Career Allowance Rate
485 granted / 664 resolved
+13.0% vs TC avg
Strong +15% interview lift
Without
With
+15.3%
Interview Lift
resolved cases with interview
Typical timeline
2y 10m
Avg Prosecution
21 currently pending
Career history
684
Total Applications
across all art units

Statute-Specific Performance

§101
4.1%
-35.9% vs TC avg
§103
30.4%
-9.6% vs TC avg
§102
14.4%
-25.6% vs TC avg
§112
29.9%
-10.1% vs TC avg
Black line = Tech Center average estimate • Based on career data from 664 resolved cases

Office Action

§102 §112 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application is being examined under the pre-AIA first-to-invent provisions. Status Claims 1-15 as amended on 9 December 2024 are examined herein. Examiner’s Notes Citations to Applicant’s specification are abbreviated herein “Spec.” Occasionally, “SIN:” is used as an abbreviation “SEQ ID NO:” herein. Election/Restrictions A restriction requirement for an election of species was posted on 4 March 2026. Applicant elected without traverse SEQ ID NO:167 (“CUCme.19-1:1:3”) in the response posted 23 April 2026. See the alignment below regarding SEQ ID NO:28. Due to the high degree of sequence identity, SEQ ID NO:28 is rejoined to the elected species. US-14-117-342-28 [US-18-905-108-28] (NOTE: this sequence has 6 duplicates in the database searched. See complete list at the end of this report) Sequence 28, US/14117342 Publication No. US20150135362A1 GENERAL INFORMATION APPLICANT: Flasinski, Stanislaw APPLICANT: Foat, Barrett C APPLICANT: Oufatolle, Mohammed APPLICANT: Shultz, Randall W APPLICANT: Wei, Xiaoping APPLICANT: Wu, Wei APPLICANT: Yang, Shiaw-Pyng TITLE OF INVENTION: PLANT REGULATORY ELEMENTS AND USES THEREOF FILE REFERENCE: MONS:304US CURRENT APPLICATION NUMBER: US/14/117,342 CURRENT FILING DATE: 2013-11-12 PRIOR APPLICATION NUMBER: PCT/US2012/037561 PRIOR FILING DATE: 2012-05-11 PRIOR APPLICATION NUMBER: 61/485,876 PRIOR FILING DATE: 2011-05-13 NUMBER OF SEQ ID NOS: 212 SEQ ID NO 28 LENGTH: 2005 TYPE: DNA ORGANISM: Cucumis melo Query Match 98.4%; Score 1971.8; Length 2005; Best Local Similarity 99.3%; Matches 1991; Conservative 0; Mismatches 12; Indels 2; Gaps 1; Qy 1 CAGTGTGCTGGAATTCGCCCTTATCCAAGGAGATTAATGTCGAGAGATTATTATCGAGGT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 CAGTGTGCTGGAATTCGCCCTTATCCAAGGAGATTAATGTCGAGAGATTATTATCGAGGT 60 Qy 61 TTGAATTTATTTTGTCCAATCATATGATTCCAAGAGCTGACCATCAATTCAACAGAACAT 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 TTGAATTTATTTTGTCCAATCATATGATTCCAAGAGCTGACCATCAATTCAACAGAACAT 120 Qy 121 GAACCGGAACCTCATACCTATTGTAATGGTTCACAGCATCCTAATACAGAACATGAACCG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 GAACCGGAACCTCATACCTATTGTAATGGTTCACAGCATCCTAATACAGAACATGAACCG 180 Qy 181 AAACCTCTTACCCATTGTAATGGTTCACAGCATCTTTATACGTATTATAGGTAGTACCAT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 AAACCTCTTACCCATTGTAATGGTTCACAGCATCTTTATACGTATTATAGGTAGTACCAT 240 Qy 241 TGAAGATGCATTTAAATGCTGTCCATGCTCTGTTCTCTAAAAAGTTGGACTTGGACTTGG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 TGAAGATGCATTTAAATGCTGTCCATGCTCTGTTCTCTAAAAAGTTGGACTTGGACTTGG 300 Qy 301 ACGTCAGCTGAAAGTATGAAATGCACTGTAGCCAACGAAGCTATGTTTTCAGGCTTCAAC 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 ACGTCAGCTGAAAGTATGAAATGCACTGTAGCCAACGAAGCTATGTTTTCAGGCTTCAAC 360 Qy 361 ATGGTTTTAGGAAAGTGGAGGCTCTTTGGTTGAAGGGTTGAATGAATGCTTTTCTAATTC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 ATGGTTTTAGGAAAGTGGAGGCTCTTTGGTTGAAGGGTTGAATGAATGCTTTTCTAATTC 420 Qy 421 CAGCATGATCTTCAAATTTCGACACAAAAAGCTTAAGTATTTTGTTCCGTTATTCTTTTA 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 CAGCATGATCTTCAAATTTCGACACAAAAAGCTTAAGTATTTTGTTCCGTTATTCTTTTA 480 Qy 481 ATCCTTGTATTGTTATATATTCTTTTCTCTGAACTGAATGTACGATGATTGCAGGGGTCG 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 ATCCTTGTATTGTTATATATTCTTTTCTCTGAACTGAATGTACGATGATTGCAGGGGTCG 540 Qy 541 AGAGCAAGTCCGATATAATGAAACACGTAAGGACGTGATTGAATGAAAAACTATGAGCAG 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 AGAGCAAGTCCGATATAATGAAACACGTAAGGACGTGATTGAATGAAAAACTATGAGCAG 600 Qy 601 AGATACAAAGTCTAACTTACGGGATGAACGATGAGAGGTTTGACCAAGAGCTGTGACGCC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 AGATACAAAGTCTAACTTACGGGATGAACGATGAGAGGTTTGACCAAGAGCTGTGACGCC 660 Qy 661 TGTATATTTCAACAAAAGTTGATGACTAACATCACATGTCAGAGTAATCAAAGAAATGCA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 TGTATATTTCAACAAAAGTTGATGACTAACATCACATGTCAGAGTAATCAAAGAAATGCA 720 Qy 721 GCCGCACATATATATATCTATATATATATCGAGTTTTTTTTTTTTTTTTTTTTTTTTTTT 780 ||||||||||||||||||||||||||||||| | ||||||||||||||||||| |||| Db 721 GCCGCACATATATATATCTATATATATATCGTTTAGTTTTTTTTTTTTTTTTTTTATTTT 780 Qy 781 TTTTTTTATCTAAT--ATATTTTAATCTATTTTCCTCTGCCCTCCTCCCCCTCCTCTTCC 838 |||||||||||||| ||| | ||||||||||||||||||||||||||||||||||| Db 781 TTTTTTTATCTAATTATATTTTAATTCTATTTTCCTCTGCCCTCCTCCCCCTCCTCTTCC 840 Qy 839 CCCACCCTTCTTCTGCACATAGTAGCCAAGGATTGATCGGTTTCTTTTGATTCGGGGGGA 898 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 CCCACCCTTCTTCTGCACATAGTAGCCAAGGATTGATCGGTTTCTTTTGATTCGGGGGGA 900 Qy 899 AAATGTTGTACAATTTTTGCTTCCATAGAAGCTTGAAAGTTTTGCAGATTATGTTGTAAA 958 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 AAATGTTGTACAATTTTTGCTTCCATAGAAGCTTGAAAGTTTTGCAGATTATGTTGTAAA 960 Qy 959 ATTACCCTTGTGTACTCACACTAGTTCTTCTCGTGGAAACTTATATTACAATGGTTGAGT 1018 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 ATTACCCTTGTGTACTCACACTAGTTCTTCTCGTGGAAACTTATATTACAATGGTTGAGT 1020 Qy 1019 TTTAAGGGGCATATTCACACTGGTAACTACCATTTTCTAATTTATGAATGCCGAGTTTCT 1078 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1021 TTTAAGGGGCATATTCACACTGGTAACTACCATTTTCTAATTTATGAATGCCGAGTTTCT 1080 Qy 1079 CTCCATGAAAGACCTTTCAAATGCCCTTTCCTCCGCGGTGCGTTTGTTGTTGTAAATGTG 1138 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1081 CTCCATGAAAGACCTTTCAAATGCCCTTTCCTCCGCGGTGCGTTTGTTGTTGTAAATGTG 1140 Qy 1139 CAGTGTCGTTGGATACACGATTGTGTGAAAGGGAAAAGGGAATACGATTAACTCTTAAAT 1198 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1141 CAGTGTCGTTGGATACACGATTGTGTGAAAGGGAAAAGGGAATACGATTAACTCTTAAAT 1200 Qy 1199 TCAACCCCTATCTCCATCAGTATCAATCACATTTCAGCAACTAGCTCTTGAATAACATTG 1258 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1201 TCAACCCCTATCTCCATCAGTATCAATCACATTTCAGCAACTAGCTCTTGAATAACATTG 1260 Qy 1259 AGATTCTTGTTTAATCCACGTACTACTACTACTATTACTACTATTTGACAGTTGATATCT 1318 ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| Db 1261 AGATTCTTGTTTAATCCACGTACTACTACTACTATTACTACTATTTGACAGCCGATATCT 1320 Qy 1319 CAAATAACATCCATATTTATCAAATTGGTATTTTAAGGACTTTTAATTTCTTCGTACATA 1378 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1321 CAAATAACATCCATATTTATCAAATTGGTATTTTAAGGACTTTTAATTTCTTCGTACATA 1380 Qy 1379 TTTCATTATAATTTAACTACTCTGACCATCATTGAAAATTTCACAAAGAAGACATTTTAA 1438 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1381 TTTCATTATAATTTAACTACTCTGACCATCATTGAAAATTTCACAAAGAAGACATTTTAA 1440 Qy 1439 ATTGAATTGAGTTGAATTAAGTTGATATAATGGTTGAACGTTGGATTTAATTTATAATTT 1498 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1441 ATTGAATTGAGTTGAATTAAGTTGATATAATGGTTGAACGTTGGATTTAATTTATAATTT 1500 Qy 1499 AGTGGTGTATGGGTCCATTGTAATAATTCTTAAAAAAAATATCATATTCTGAATTCTAAA 1558 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1501 AGTGGTGTATGGGTCCATTGTAATAATTCTTAAAAAAAATATCATATTCTGAATTCTAAA 1560 Qy 1559 GAACCATCTAAGACCAAAACTAAGGGGTCACCAATGAGTATGGTAAAGTCAACAAAGTTT 1618 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1561 GAACCATCTAAGACCAAAACTAAGGGGTCACCAATGAGTATGGTAAAGTCAACAAAGTTT 1620 Qy 1619 GTCTACTTTTCTTATCCTTATCATCAAGAGTGCAATATGATATCAAAGATAAATTGTACG 1678 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1621 GTCTACTTTTCTTATCCTTATCATCAAGAGTGCAATATGATATCAAAGATAAATTGTACG 1680 Qy 1679 TGGGCGTCATCCATTGGGTAAGACCAAGAAGCAAAATATCATAGAGAAGTTGTTTTAGTA 1738 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1681 TGGGCGTCATCCATTGGGTAAGACCAAGAAGCAAAATATCATAGAGAAGTTGTTTTAGTA 1740 Qy 1739 GCCATAGGAAGGAAGGAAGCAAAATAATAATATAGATTTGAAATTGTGGATGATAAACTG 1798 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1741 GCCATAGGAAGGAAGGAAGCAAAATAATAATATAGATTTGAAATTGTGGATGATAAACTG 1800 Qy 1799 CCAAATGGGAATTCAAAATAAACTAAATAAATAAAATAAAAAGAGAAATCTTGGGAGTTT 1858 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1801 CCAAATGGGAATTCAAAATAAACTAAATAAATAAAATAAAAAGAGAAATCTTGGGAGTTT 1860 Qy 1859 CCATTTTAGCCAATGAGGAAACAGATAGAGATCTCATCAAGATAAGGACCCTATTCTCTT 1918 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1861 CCATTTTAGCCAATGAGGAAACAGATAGAGATCTCATCAAGATAAGGACCCTATTCTCTT 1920 Qy 1919 CTTCATCTATAAAACAAAAACAAATCAAACCCTCATTTCACTCATTCAAAACAAAAAGTA 1978 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1921 CTTCATCTATAAAACAAAAACAAATCAAACCCTCATTTCACTCATTCAAAACAAAAAGTA 1980 Qy 1979 CTCCAAAGTCAAACTAACAAATACG 2003 ||||||||||||||||||||||||| Db 1981 CTCCAAAGTCAAACTAACAAATACG 2005 The requirement is deemed proper and is therefore made FINAL. Claims 1-17 as amended on 29 December 2024 are examined herein. Applicant is reminded that upon the cancellation of claims, the inventorship should be amended in compliance with 37 CFR 1.48(b) if one or more of the currently named inventors is no longer an inventor of at least one claim remaining in the application. Any amendment of inventorship must be accompanied by a request under 37 CFR 1.48(b) and by the fee required under 37 CFR 1.17(i). This would also apply if electing SEQ ID NOs:167 / 28 changes the inventorship. The last two lines of claims 7, 10, 12-13 and 15-16 appear to be redundant because claim 1 already specifies “operably linked to a heterologous transcribable polynucleotide molecule.” (3rd to last and 4th to last in claim 16). Thus in these claims the limitation “the DNA molecule of claim 1” is interpreted to read on the DNA molecule as described in parts (a), (b), and (c). Therefore in the above claims only one heterologous transcribable polynucleotide molecule is required. DESIGNATION & ACTIVITY Table 1 which sets forth the terminology, stretches from page 30 to page 39 (Table 1). At the bottom of page 37, Applicant describes SEQ ID NO:167 as a promoter & leader from the chlorophyll a/b binding protein, i.e., P-CUCme.19-1:1:3. In Table 7 on page 47, Applicant teaches it as part of the pMON140832 vector. In Table 8 on page 49, Applicant presents expression results. See also page 50, Table 9. For SEQ ID NO:28, From Table 1, page 31, SEQ ID NO:28 is a promoter & leader from the chlorophyll a/b binding protein, i.e., P-CUCme.19-1:1:2. Independent results are not taught; in several tables of results as seen above, SEQ ID NO:27 is recited in the row above SEQ ID NO:167. Given the high degree of sequence identity, there is no reason to doubt that SEQ ID NO:28 will have comparable activity to SEQ ID NO:167. Improper Markush Group 1. Claims 1-16 are rejected on the basis that they contain an improper Markush grouping of alternatives. See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). A Markush grouping is proper if the alternatives defined by the Markush group (i.e., alternatives from which a selection is to be made in the context of a combination or process, or alternative chemical compounds as a whole) share a "single structural similarity" and a common use. A Markush grouping meets these requirements in two situations. First, a Markush grouping is proper if the alternatives are all members of the same recognized physical or chemical class or the same art-recognized class, and are disclosed in the specification or known in the art to be functionally equivalent and have a common use. Second, where a Markush grouping describes alternative chemical compounds, whether by words or chemical formulas, and the alternatives do not belong to a recognized class as set forth above, the members of the Markush grouping may be considered to share a "single structural similarity" and common use where the alternatives share both a substantial structural feature and a common use that flows from the substantial structural feature. See MPEP § 2117. The Markush groupings in claims 1, 2 and 3, e.g. SEQ ID NOs: 1-199, 211 and 212 are improper because the alternatives defined by the Markush grouping do not share both a single structural similarity and a common use under the following reasoning. Applicant fails to teach that such a diverse group of sequences will function equivalently to drive transgenic expression in a plant. See, for example, Tables 3, 4, and 5 (pp. 42-44) with a variety of different activities displayed. Also see Table 8 on pages 48-49 with SEQ ID NO:167 listed (p. 49) Spec., pp. 51-52. Also when the elected species were searched against the Office databases, except for the highly identical (and thus rejoined) species, none of the other sequences display a significant degree of sequence identity (probably less than 3%). To overcome this rejection, Applicant may set forth each alternative (or grouping of patentably indistinct alternatives) within an improper Markush grouping in a series of independent or dependent claims and/or present convincing arguments that the group members recited in the alternative within a single claim in fact share a single structural similarity as well as a common use. Claims depending on the claims reciting an improper Markush group are included in this rejection. Amending the claims to recite only SEQ ID NO:28 and SEQ ID NO:167 would obviate the rejection. Claim Rejections - 35 USC § 112(a), written description The following is a quotation of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), first paragraph: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same and shall set forth the best mode contemplated by the inventor of carrying out his invention. 2. Claims 1, 2 and 4-16 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention. Claim 1 is drawn to a DNA molecule comprising a Markush group of different sequences; the group includes SEQ ID NO:167 and SEQ ID NO:28. The claimed genera includes a variant at least 85% sequence identical to, e.g., SEQ ID NO:167, or a fragment of, e.g., SEQ ID NO:167 where the fragment has gene- regulatory activity. The preamble also recites gene- regulatory functional activity. Claim 1 also requires an operably linked heterologous transcribable DNA molecule. Applicant defines “gene regulatory activity” broadly: has the ability to affect the transcription and/or translation of an operably linked transcribable polynucleotide molecule. The term "gene regulatory activity" thus refers to the ability to affect the expression pattern of an operably linked transcribable polynucleotide molecule by affecting the transcription and/or translation of that operably linked transcribable polynucleotide molecule. As used herein, a transcriptional regulatory expression element group (EXP) may be comprised of expression elements, such as enhancers, promoters, leaders and introns, operably linked. Thus a transcriptional regulatory expression element group may be comprised, for instance, of a promoter operably linked 5' to a leader sequence, which is in tum operably linked 5' to an intron sequence. The intron sequence may be comprised of a sequence beginning at the point of the first intron/exon splice junction of the native sequence and further may be comprised of a small leader fragment comprising the second intron/exon splice junction so as to provide for proper intron/exon processing to facilitate transcription and proper processing of the resulting transcript. Leaders and introns may positively affect transcription of an operably linked transcribable polynucleotide molecule as well as translation of the resulting transcribed RNA. The pre-processed RNA molecule comprises leaders and introns, which may affect the post-transcriptional processing of the transcribed RNA and/or the export of the transcribed RNA molecule from the cell nucleus into the cytoplasm. Following post-transcriptional processing of the transcribed RNA molecule, the leader sequence may be retained as part of the final messenger RNA and may positively affect the translation of the messenger RNA molecule. Spec., p. 7 (quote from OCRed document). Dependent claims 2-3 require a higher degree of sequence identity than 85%. Dependent claims 4-6 further limit the identity of the heterologous sequence. Dependent claims 7-9 read on a transgenic plant cell with 8-9 broadly limiting the identity of the plant cells. Dependent claim 10 reads on a transgenic plant comprising the DNA molecule and repeats that it is operably linked a heterologous transcribable polynucleotide molecule. Dependent claim 11 reads on a progeny. Dependent claim 12 focuses on a transgenic seed. Dependent claim 13 is drawn to a method of producing a commodity product using the composition of claim 1; claim 14 further limits the commodity product. Dependent claim 15 is drawn to a commodity product with the polynucleotide of claim 1. Dependent claim 16 is drawn to a method of using the molecule of claim1 to drive transcription. The Federal Circuit held that a written description of an invention "’requires a precise definition, such as by structure, formula [or] chemical name,’ of the claimed subject matter sufficient to distinguish it from other materials." Regents of the Univ. of Cal. v. Eli Lilly & Co., 119 F.3d 1559, 1568, 43 USPQ2d 1398, 1405 (Fed. Cir. 1997) (quoting Fiers v. Revel, 984 F.2d 1164, 1171, 25 USPQ2d 1601, 1606 (Fed. Cir. 1993)). The court also stated "naming a type of material generally known to exist, in the absence of knowledge as to what that material consists of is not a description of that material." Id., 119 F.3d at 1568, 43 USPQ2d at 1406. The court held that “[a] description of a genus of cDNAs may be achieved by means of a recitation of a representative number of cDNAs, defined by nucleotide sequence, falling within the scope of the genus or of a recitation of structural features common to members of the genus, which features constitute a substantial portion of the genus.” Id., 119 F. 3d at 1569, 43 USPQ2d at 1406. The claimed genera include all fragments of SEQ ID NO:167 and SEQ ID NO:28. The claimed genera also include sequence variants of SEQ ID NO:167 and SEQ ID NO:28 sharing as little as 85% identity with one of those sequences. Therefore, focusing on fragments, in contrast to the broad genera claimed, Applicant provides limited description. According to the specification, Applicant identified gene regulatory elements from C. melo including the claimed promoter / combination. Spec., para. 005. SEQ ID NO:167 is 2,003 bp long. If the first approximately 85% base pairs were held constant, and the remaining 300 (approximately 15%) were varied, that would result in 3004 different variants. However, that is only a small fraction of the number claimed, because different regions could be held constant. Furthermore, fragments of SEQ ID NO:167 are claimed without any lower limit to the length. Table 1 sets forth the identities of SEQ ID NOs described by the specification. E.g., id., p. 30 et seq. At the bottom of page 37 in Table 1, Applicant describes SEQ ID NO:167 as a promoter & leader from the chlorophyll a/b binding protein and is identified as “P-CUCme.19-1:1:3. In Table 7 on page 47, Applicant teaches it as part of the pMON140832 vector. In Table 8 on page 49, Applicant presents expression results. See also page 50, Table 9. For SEQ ID NO:28, From Table 1, page 31, SEQ ID NO:28 is a promoter & leader also from the chlorophyll a/b binding protein, designated as “P-CUCme.19-1:1:2.” Independent results are not taught. Given the high degree of sequence identity, there is no reason to doubt that SEQ ID NO:28 will have comparable activity to SEQ ID NO:167. Applicant also fails to describe any independent activity of the isolated leader(s), promoter or intron sequence, or sequence variants or fragments thereof. In the promoter art, several publications describe that changes to the primary structure of a promoter sequence comprised in SEQ ID NO:167 or SEQ ID NO:28, changes that would still fall within the scope of claim 1, might have significant effects on the variant or fragment nucleotide sequence’s ability to be active as a promoter or otherwise provide gene regulatory activity. See, e.g., Donald & Cashmore (1990) EMBO J 9:1717-26, abstract; Kim et al. (1994) Plant Mol Biol 24:105-17, abstract; and Dolferus et al. (1994) Plant Physiol 105:1075-87, abstract. Thus without essential motifs, one of the claimed fragments may not be active. Additionally, although Applicant sets no limit on the fragment size, it is generally accepted that plant promoters require a certain minimum length to be active. For example, Cho & Cosgrove found that deletions below 145 bp in their studied promoter were inactive. Cho & Cosgrove (2002) Plant Cell 14:3237-53, 3246. However, the TATA Box is generally accepted to have some level of gene regulatory activity. Applicant is however broadly claiming gene regulatory activity which certainly includes promoters but also includes, for example, enhancers and RNAi agents. As seen above, Applicant claims large genera of sequences related to SEQ ID NO:167 / SEQ ID NO:28 and fragments thereof. In contrast to the breadth of the claims, Applicant only describes one sequence, SEQ ID NO:167, as active. Applicant fails to describe activities of sequence variants or fragments thereof. An ordinary artisan would not envision the full scope of the claimed sequences as routinely active in the instant invention. Applicant thus fails to describe a representative number of species in comparison to the size of the genera claimed. However, in addition to describing a representative number of species, there is an alternate route to satisfying the written description requirement. In the 1997 UC v. Lilly decision the Federal Circuit set forth a two-prong approach to satisfying the written description requirement in a 1997 decision. The court held that in the event that a sufficient number of species are not described, the written description requirement may be satisfied by describing structural features that are necessary and/or sufficient for activity for members of the claimed genus. U.C. v. Lilly, 119 F. 3d at 1569, 43 USPQ2d 1406 (Fed. Cir. 1997). The court held that “[a] description of a genus of cDNAs may be achieved by means of a recitation of a representative number of cDNAs, defined by nucleotide sequence, falling within the scope of the genus or of a recitation of structural features common to members of the genus, which features constitute a substantial portion of the genus.” Id. However, in the case of the instant invention, neither the specification nor the art describes conserved structures that are necessary and/or sufficient for the promoter activity of SEQ ID NO:167 / SEQ ID NO:28 except of course a requirement for a TATA box. The promoter art in general describes a promoter as a linear assembly of structures related to binding transcription factors, with the bulk of the binding sites upstream of the TATA box which directs RNA polymerase II binding. The combination of these structures generally determines the activity and the specificity of the promoter. See, e.g. Potenza et al. (2004) In Vitro Cell Dev Biol Plant 40:1-22, 2 and Fincher et al., US 6,462,258 B1, issued 8 October 2002, cols. 9-10. Applicant fails to describe or correlate any individual structural feature(s) of the claimed sequences as necessary and/or sufficient for the gene regulatory activity in the instant invention. Nor does the art describe universal necessary and sufficient structural features required for a promoter. For example, in an introduction to a 2007 publication of an in silico analysis of plant promoters, Saha et al. teaches that computational analysis of promoters is only a starting point for physical analysis, and experimental verification is still required. Saha et al. (2007) In Silica Biol 7(1 ):7-19, 8. Applicant only describes the full-length promoter + leader that is SEQ ID NO:167 / SEQ ID NO:28. To summarize, the claims read on sequence variants of SEQ ID NO:167 / SEQ ID NO:28, as well as fragments thereof, where the fragments require gene regulatory activity. In contrast to the size of the genera claimed, Applicant only describes only the SEQ ID NO:167 / SEQ ID NO:28 sequences themselves. Thus Applicant fails to describe a representative number of species when compared to the size of the genera claimed. Applicant also fails to describe the structural elements in SEQ ID NO:212 / SEQ ID NO:173 that are necessary and/or sufficient for full activity. Given the lack of written description in the specification plus the lack of knowledge in the prior art as it relates to SEQ ID NO:167 / SEQ ID NO:28, one of skill in the art would not believe that Applicant was in possession of the broad genera claimed at the time of filing the instant application. Dependent claims are included in this rejection because none provide further limitations obviating this rejection. Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of pre-AIA 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (b) the invention was patented or described in a printed publication in this or a foreign country or in public use or on sale in this country, more than one year prior to the date of application for patent in the United States. 3. Claims 1 and 4-16 are rejected under 35 U.S.C. 102(b) as being anticipated by Adams et al., US Patent No. 5,489,520, issued 6 February 1996 together with the evidence supplied by the teachings of Odell et al. (1985) Nature 313:810-12 as to the presence of a TATA box. Claim 1 is drawn to a DNA molecule comprising SEQ ID NO:167 or SEQ ID NO:28, or a variant at least 85% sequence identical to one of those sequences or a fragment of one of those sequences, wherein molecules falling within the scope of those genera are required to have gene-regulatory activity. Claim 1 also requires an operably linked heterologous transcribable DNA molecule. Claim 1 is drawn to a nucleic acid molecule comprising a fragment of, e.g. SEQ ID NO:212, and a heterologous nucleic acid to be transcribed. The claim is reasonably interpreted so that promoter activity or related elements qualifies as “gene-regulatory activity.” There is no lower limit to the size of the fragment claimed and thus it is reasonable to interpret one embodiment of a fragment of SEQ ID NO:167 (and SEQ ID NO:28) as a TATA box. This interpretation is confirmed by Applicant in the specification where Applicant describes plant promoters as having a “TATA box.” Spec., para. 0032. Adams et al. discloses a construct using the 35S CMV promoter to drive expression of the bar gene (Fig. 1); Adams et al. cites to the Odell et al. publication as the source of the 35S CMV promoter. Adams et al., col. 4. Odell et al. teaches that the 35S CMV promoter has a TATA box. Odell et al., p. 810. Thus Adams et al. discloses a promoter with a TATA box wherein this promoter is placed in a construct with the other required elements of claim 1. Adams et al., Fig. 1. Therefore Adams et al. anticipates claim 1. The bar gene is of agronomic interest since it provides herbicide resistance (col. 7) and thus Adams et al. anticipates claims 4-5. Adams et al. discloses a transgenic maize plant and therefore cells thereof as well as progeny thereof (Fig. 7A & col. 16) and thus anticipates claims 7-8 and 10-11. Adams et al.’s Figure 7C depicts a seed and thus Adams et al. anticipates claims 12 and 15. Instant claim 13 is a method claim which only requires obtaining a transgenic plant and producing a product such as seeds from it and thus claims 13-14 are anticipated. Since PAT activity is demonstrated in the transgenic plant (Fig. 7A & col. 16), claim 16 is also anticipated. In paragraph 8, Adams et al. discloses transformation of dicots and thus anticipates claim 9. Adams et al. also discloses pest resistance genes (para. 0040) and thus anticipates claim 6. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory obviousness-type double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); and In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on a nonstatutory double patenting ground provided the conflicting application or patent either is shown to be commonly owned with this application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. Effective January 1, 1994, a registered attorney or agent of record may sign a terminal disclaimer. A terminal disclaimer signed by the assignee must fully comply with 37 CFR 3.73(b). The USPTO internet Web site contains terminal disclaimer forms which may be used. Please visit http://www.uspto.gov/forms/. The filing date of the application will determine what form should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to http://www.uspto.gov/patents/process/file/efs/guidance/eTD-info-I.jsp. 4. Claims 1, and 4-16 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1 and 1-8 of Adams et al., US Patent No. 5,489,520, issued 6 February 1996 together with the evidence supplied by the teachings of Odell et al. (1985) Nature 313:810-12. Although the claims at issue are not identical, they are not patentably distinct from each other because as seen above, the above claims are anticipated by the ‘520 Patent. Anticipation is the epitome of obviousness (MPEP § 1207.03(a)(ll)(2) (quoting In re May, 574 F.2d 1082, 1089 (CCPA 1978) (citing In re Pearson, 494 F.2d 1399, 1402 (CCPA 1974)) 5. Claims 1, and 4-16 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-11 of Fischhoff & Perlak, U.S. Patent No. 5,500,365 together with the evidence supplied by the teachings of Odell et al. (1985) Nature 313:810-12. Although the claims at issue are not identical, they are not patentably distinct as per the following analysis. Claim 1 is drawn to a nucleic acid molecule comprising a fragment of SEQ ID NO:167 / SEQ ID NO:28 and a heterologous nucleic acid to be transcribed. The claim is interpreted so that promoter activity or related elements qualifies as “gene-regulatory activity.” There is no lower limit to the size of the fragment claimed and thus it is reasonable to interpret one embodiment of a fragment of SEQ ID NOs:167 or 28 as a TATA box. This interpretation is confirmed by Applicant in the specification where Applicant describes plant promoters as having a “TATA box.” Spec., para. 0032. Fischhoff & Perlak discloses a construct using the 35S CMV promoter to drive expression of a Bt gene. E.g. col. 13. Fischhoff & Perlak cites to the Odell et al. publication in reference to the 35S CMV promoter. Fischhoff & Perlak, col. 14. Odell et al. teaches that the 35S promoter has a TATA box. Odell et al. p. 810. Thus Fischhoff & Perlak teaches a promoter with a TATA box wherein this promoter is placed in a construct with the other required elements of claim 1. Fischhoff & Perlak, Fig. 5. Therefore claims 1 and 4 are obvious. Fischhoff & Perlak teaches a transgenic cotton plant and progeny thereof (Col. 1 & col. 32) and thus claims 7, 9-12 and 15 are obvious. Instant claim 13 is a method claim which only requires obtaining a transgenic plant and producing a product and thus claims 13-14 and 15 are also obvious. Since Bt protein activity is demonstrated in the transgenic plant (Col. 31), claim 6 is also obvious. Further, Fischhoff & Perlak teaches transgenic expression of herbicide genes (para. 03) and thus claim 5 is obvious. Fischhoff & Perlak teaches transformation of dicots (para. 035) and thus anticipates claim 9 is obvious. Conclusion 11. No claim is allowed. Allowable Subject Matter 12. SEQ ID NO:167 and SEQ ID NO:28 each appear to be free of the prior art made of record when used to control expression of an operably heterologous transcribable sequence of nucleotides. For example as a promoter element with, in the case of SEQ ID NO:167. Any inquiry concerning this communication or earlier communications from the examiner should be directed to RUSSELL T BOGGS whose telephone number is (571)272-2805. The examiner can normally be reached Monday - Friday, 0800 to 1830 Mtn. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad Abraham can be reached at 571-270-0708. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /RUSSELL T BOGGS/Examiner, Art Unit 1663
Read full office action

Prosecution Timeline

Oct 02, 2024
Application Filed
Jun 23, 2026
Non-Final Rejection mailed — §102, §112, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12662684
ENHANCING THE EFFECTIVENESS OF BLENDED REFUGE
4y 8m to grant Granted Jun 23, 2026
Patent 12653127
PLANTS AND SEEDS OF CORN VARIETY CV621819
2y 6m to grant Granted Jun 16, 2026
Patent 12642237
SOYBEAN CULTIVAR 20142104
2y 3m to grant Granted Jun 02, 2026
Patent 12635628
PLANTS AND SEEDS OF HYBRID CORN VARIETY CH010499
2y 5m to grant Granted May 26, 2026
Patent 12635629
CANOLA HYBRID 18GM0769N
2y 6m to grant Granted May 26, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
73%
Grant Probability
88%
With Interview (+15.3%)
2y 10m (~1y 1m remaining)
Median Time to Grant
Low
PTA Risk
Based on 664 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month