Prosecution Insights
Last updated: October 02, 2026
Application No. 18/908,523

METHOD FOR SELECTING TARGET SITES FOR SITE-SPECIFIC GENOME MODIFICATION IN PLANTS

Non-Final OA §103§112
Filed
Oct 07, 2024
Priority
Sep 30, 2016 — provisional 62/402,724 +2 more
Examiner
ZHONG, WAYNESHAOBIN
Art Unit
1662
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Monsanto Technology LLC
OA Round
1 (Non-Final)
72%
Grant Probability
Favorable
1-2
OA Rounds
11m
Est. Remaining
94%
With Interview

Examiner Intelligence

Grants 72% — above average
72%
Career Allowance Rate
393 granted / 544 resolved
+12.2% vs TC avg
Strong +22% interview lift
Without
With
+21.5%
Interview Lift
resolved cases with interview
Typical timeline
2y 10m
Avg Prosecution
27 currently pending
Career history
566
Total Applications
across all art units

Statute-Specific Performance

§101
8.9%
-31.1% vs TC avg
§103
31.7%
-8.3% vs TC avg
§102
10.4%
-29.6% vs TC avg
§112
36.1%
-3.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 544 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Information Disclosure Statement The Information Disclosure Statements filed on 12/12/2024 and 8/4/2026 have been entered and considered. Initialed copies of the form PTO-1449 are enclosed with this action. Restriction/Status of claims On 8/4/2026, the applicant elected Group II, claims 12-15, 19-32, without traverse. The applicant also elected species with traverse: I. Non-genic plant genomic sequence SEQ ID NO: 130; II. Target site (v.), corresponding to a target site within a region of the plant genome of low DNA methylation; III. Genomic modification enzyme: an endonuclease, specifically a transcription activator-like effector nuclease (TALEN), and more specifically SEQ ID NO: 35; for continued examination. The applicant argues that there would not be a significant search or examination burden to search and examine all of the identified species together. The argument is fully considered but not deemed persuasive. For example, claim 12 recites corn genomic sequence selected from the group consisting of SEQ ID NOs: 123 - 172, 294, 299-551, 555 and 556 or a soybean genomic sequence selected from the group consisting of SEQ ID NOs: 252 - 282 and 554. Only SEQ ID NOs: 299-551 has 253 SEQ ID NOs, which is part of the recited sequences. The 253 sequences have different structures and are in different positions of the genomes of 2 different plants. They would be a significant search and examination burden. Nevertheless, upon further consideration, SEQ ID NO: 123, the first corn sequence in the claimed list, is joined SEQ ID NO: 130 and examined. In addition, in view of the specification ([0134], Table 1), SEQ ID NOs: 5 and 64 are 5’ and 3’ TALEN binding sites of the soybean genome for editing SEQ ID NO: 123; SEQ ID NOs: 35 and 94 are 5’ and 3’ TALEN binding sites of the corn genome for editing SEQ ID NO: 130. Thus, SEQ ID NOs: 5, 64 and 94 are joined SEQ ID NO: 35 and examined. In sum, SEQ ID NOs: 123 and 130, along with SEQ ID NOs: 5, 64, 35, 94, are examined in the office action. In addition, as stated in the office action of 5/6/2026, “upon the allowance of a generic claim, the applicant will be entitled to consideration of claims to additional species which depend from or otherwise require all the limitations of an allowable generic claim as provided by 37 CFR 1.141”. In summary, claims 12-15, 19-28, 30-32 are examined in this office action. Non-elected claims and species are withdrawn. Claim 29 is exclusively drawn to non-elected soybean species, thus, is withdrawn. Claims 6-8, 16-18 had been canceled by the applicant. Priority Instant application 18908523, filed 10/07/2024, is a Continuation of 16338335, filed 03/29/2019, now abandoned. 16338335 is a National Stage entry of PCT/US2017/054378, International Filing Date: 09/29/2017. PCT/US2017/054378 Claims Priority from Provisional Application 62402724, filed 09/30/2016. 62402724 disclosed the claimed subjected matter including the elected SEQ ID NOs: 123, 130, 5, 64, 35, 94. Thus, the priority date of 09/30/2016 is recognized. Claim Rejections - 35 USC § 112 Indefiniteness The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. Claims 28-29 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor, or for pre-AIA the applicant regards as the invention. Claim 29 is withdrawn, but is included for compact prosecution. Claim 28 recites Table 1; and Claim 29 recites Table 2. According to MPEP 2173.05(s), where possible, claims are to be complete in themselves. Incorporation by reference to a specific figure or table "is permitted only in exceptional circumstances where there is no practical way to define the invention in words and where it is more concise to incorporate by reference than duplicating a drawing or table into the claim. Incorporation by reference is a necessity doctrine, not for applicant’s convenience." Ex parte Fressola, 27 USPQ2d 1608, 1609 (Bd. Pat. App. & Inter. 1993). In this case, elected species of corn sequences SEQ ID NOs: 123, 130, 5, 64, 35, 94 are one of the limited number of sequences listed in Table 1 (the specification, after [0134]). Thus, it is practical to recite SEQ ID NOs without reciting table(s). It is practical to define the invention in words to make the claims complete. Appropriate corrections are required. Scope of Enablement The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. Claims 12-15, 19-32 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for a method of making a transgenic corn or soybean plant cell comprising a DNA of interest targeted to at least one non-genic corn or soybean plant genomic sequence, does not reasonably provide enablement for a method of making a transgenic plant cell of any plant species comprising a DNA of interest targeted to at least one non-genic plant genomic sequence of any plant species. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention commensurate in scope with these claims. Claim 29 is withdrawn, but is included for compact prosecution. The claims are broadly drawn to a method of making a transgenic plant cell comprising a DNA of interest targeted to at least one non-genic plant genomic sequence, …. wherein the non-genic plant genomic sequence is a corn genomic sequence selected from the group consisting of SEQ ID NOs: 123-172, 294, 299-551, 555 and 556 or a soybean genomic sequence selected from the group consisting of SEQ ID NOs: 252-282 and 554. According to the specification ([0031]), the term "non-genie plant genomic sequence" or "non-genie plant sequence" or "intergenic sequence" or "intergenic region" refers to a native DNA sequence found in the genome of a plant, devoid of any open reading frames, gene sequences, or gene regulatory sequences. Furthermore, the non-genie sequence does not comprise any intron sequence (specifically, introns are excluded from the definition of non-genie). The non-genie sequence cannot be transcribed or translated into protein. According to claim 12 and sequence listing SEQ ID NOs: 123-172, 294, 299-551, 555 and 556, 252-282 and 554 are corn or soybean sequences. Other plants except corn (Maize) do not comprise SEQ ID NO: 123-172, 294, 299-551, 555 or 556, other plants except soybean (Glycine max) do not comprise SEQ ID NO: 252-282 or 554. Accordingly, the specification at best only provides guidance of making a transgenic corn or soybean plant cell in the non-genic sequence of SEQ ID NO: 123-172, 294, 299-551, 555 or 556, 252-282 or 554. However, the specification or prior art does not provide guidance of making a transgenic plant cell of any plant species in the non-genic sequence of SEQ ID NO: 123-172, 294, 299-551, 555 or 556, 252-282 or 554. It is highly unlikely plants except corn or soybean do not even comprise those sequences. MPEP 2164 provides the Enablement Requirement. MPEP section 2164.01 states “Any analysis of whether a particular claim is supported by the disclosure in an application requires a determination of whether that disclosure, when filed, contained sufficient information regarding the subject matter of the claims as to enable one skilled in the pertinent art to make and use the claimed invention” The standard for determining whether the specification meets the enablement requirement was cast in the Supreme Court decision of Mineral Separation v. Hyde, 242 U.S. 261, 270 (1916) which postured the question: is the experimentation needed to practice the invention undue or unreasonable? That standard is still the one to be applied. In re Wands, 858 F.2d 731, 737, 8 USPQ2d 1400, 1404 (Fed. Cir. 1988). Accordingly, even though the statute does not use the term “undue experimentation,” it has been interpreted to require that the claimed invention be enabled so that any person skilled in the art can make and use the invention without undue experimentation. Therefore, given the claim breadth, lack of guidance in the specification, insufficient working examples in the instant specification, unpredictability in the prior art, and the quantity of experimentation needed to make or use the invention based on the content of the disclosure, undue experimentation would have been required by one skilled in the art to make and use the invention as broadly claimed. Dependent claims do not cure the deficiency, thus, are included. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or non-obviousness. Claims 12-15, 20-25, 27-28, 30-32, 30-32 are rejected under 35 U.S.C. 103 as being unpatentable over Bull et al (US Patent 8754289, granted and published 6/17/2014), in view of Liang et al (Targeted Mutagenesis in Zea mays Using TALENs and the CRISPR/Cas System. Journal of Genetics and Genomics 41, p63-68, 2014). Claim 12 is drawn to a method comprising: i. selecting a target site located within a haplotype window associated with a neutral to positive impact on one or more agronomic traits; ii. introducing a site-specific genome modification enzyme into a plant cell, wherein the site- specific genome modification enzyme cleaves the target site in the non-genic plant genomic sequence; iii. introducing a DNA of interest; iv. targeting the DNA of interest to the target site, wherein the cleavage of the target site facilitates integration of the DNA of interest into the non-genic plant genomic sequence; and v. selecting transgenic cells comprising the DNA of interest integrated into the non-genic plant genomic sequence, wherein the non-genic plant genomic sequence is a corn genomic sequence SEQ ID NO: 123 or 130 (elected), for making a transgenic plant cell comprising a DNA of interest targeted to at least one non-genic plant genomic sequence (preamble). According to the specification ([0025]-[0026]), “the term "haplotype" refers to a chromosomal region within a haplotype window defined by at least one polymorphic marker. ….. Changes in a haplotype, brought about by recombination for example, may result in the modification of a haplotype so that it comprises only a portion of the original (parental) haplotype operably linked to the trait, for example, via physical linkage to a gene, QTL, or transgene. Any such change in a haplotype would be included in our definition of what constitutes a haplotype so long as the functional integrity of that genomic region is unchanged or improved. The term "haplotype window" refers to a chromosomal region that is established by statistical analyses known to those of skill in the art and is in linkage disequilibrium. ….. Haplotype windows are mapped along each chromosome in the genome”. According to specification ([0031]), the term "non-genie plant genomic sequence" or "non-genie plant sequence" refers to a native DNA sequence found in the genome of a plant, devoid of any open reading frames, gene sequences, or gene regulatory sequences. Furthermore, the non-genie sequence does not comprise any intron sequence (specifically, introns are excluded from the definition of non-genie). The non-genie sequence cannot be transcribed or translated into protein. According to instant specification ([0034]), “DNA of interest” refers to a nucleic acid/DNA sequence that has been selected for targeted insertion into a host sequence. Bull et al teach that “At least one progeny plant may then be selected, the progeny plant having detectable expression of the transgene or its phenotype and comprising in its genome the T-type genomic region of the first plant and at least one T-type genomic or haplotype of the second plant” (col 2, 4th para), and that “A transgene of the T-type genomic region is further defined as conferring a preferred property like herbicide tolerance, disease resistance, insect or pest resistance, altered fatty acid, protein or carbohydrate metabolism, increased grain yield, increased oil, increased nutritional content, increased growth rates, enhanced stress tolerance, or altered morphological characteristics, or any combination of these” (col 2, last para; col 3, 1st para). Bull et al further teach a polynucleotide sequence from corn (Zea mays) having 100% local identity to instant SEQ ID NO: 123 (reference SEQ ID NO: 49). See “Sequence Matches” at the end of office action. Bull et al characterized the sequence (reference SEQ ID NO: 49) as Haplotype C1W36H2, and then taught and demonstrated selecting corn plant having transgene associated with Haplotype C1W36H2 (Example 4, Application to Corn Breeding, col 26-28, Table 5, Table 6). Thus, the transgenic insertion is in the part of the haplotype window comprising non-genic sequence of SEQ ID NO: 123. Bull et al teach making novel transgenic events comprising gene of interest conferring insect resistance by selecting or directing the transgene into linkage with a recipient haplotype that has a breeding value that is not negative with respect to yield (col 7, last para, col 8 1st para), reading on “neutral impact”. The transgenic events in the haplotypes read on site-specific genome modification. Thus, Bulls et al teach a motivation to select such desirable site that is within or associated to haplotype window having neutral impact on agronomic traits. Bull et al also teach, claim and demonstrate transforming a soybean plant and introducing a transgene, and selecting a transgenic plant having in its genome a transgene and a genetic marker that are genetically linked to a haplotype (col 13, 2nd para; col 14, 2nd para; Example 3 in col 25-26; claim 1). Bull et al teach selecting the plants having the specific transgenic events in the haplotypes for breeding and making progenies (Col 2, 3rd to 4th paras; Example 4, col 26-28, claims 1-3). Thus, Bull et al teach steps of claim 12 and teach a motivation that the site is within or associated to haplotype windows having neutral impact on agronomic traits, except do not explicitly teach steps ii: introducing a site-specific genome modification enzyme into a plant cell, wherein the site-specific genome modification enzyme cleaves the target site; and v. targeting the DNA of interest to the target site, wherein the cleavage of the target site facilitates integration of the DNA of interest into the non-genic plant genomic sequence. Bull et al nevertheless suggest site-specific integration of transgenes in the haplotype windows by using site-specific endonuclease like zinc finger nuclease (col 21, last para; whole col 22). Introducing a site-specific genome modification enzyme into a plant cell to produce transgenic plant had been taught and demonstrated in prior art. For example, Liang et al taught in detail using TALEN and CRISPR to introduce transgenes into corn cells in site-specific manner (p67, Materials and Methods), and demonstrated success (p65-66, Results and Discussions, p66, fig 3). Liang et al further teach the detailed mechanisms and advantages of using TALEN (p64, Fig 1) and using CRISPR (p66, Fig 3), thus, provide additional motivation for one ordinary skill in the art to perform such methods. Regarding dependent claims, Bull et al teach that haplotype windows are at least 10 CM apart from one another (col 10, last para), the limitation of claim 13. Bull et al teach that transgene and the haplotype are linked at a distance of 0 to within about 5 CM (claim 7), the limitation of claims 14. The gene conferring insect resistance of Bull et al above teaches the limitation of claim 15 (pest resistance) and claim 21. The haplotype windows and gene target regions of Bull et al are at least 1000 nucleotides in size (Tables 1 and 2 in col 23-24), the limitation of claim 20. The zinc finger of Bull et al and TALEN and CRISPR of Liang et al above teach the limitation of claim 22-23. Bull et al further teach using a recombinase, specifically Cre recombinase or FLP recombinase for the genomic modification (col 22, 1st to 3rd para), the limitations of claims 22 (again) and claims 24-25. Bull et al further teach using transposase attached to a DNA binding domain for recognition (col 22, 3rd para), the limitations of claims 27. Regarding claim 29, as analyzed above, the claim recites Table 1 and is deemed indefinite. Table 1 (page 43) lists SEQ ID NOs: 123 and 5, 64. By the examiner’s alignment, SEQ ID NOs: 5 (25 bp) and 64 (25 bp) are fragments of SEQ ID NO: 123 (2928 bp) having 100% sequence matches. See “Sequence Matches” at the end of office action. As analyzed above, Bull et al teach SEQ ID NO: 123 as being associated with haplotype window and target site. Thus, using SEQ ID NOs: 5 and 64 as being associated with haplotype window and target site is also deemed obvious. The gene conferring insect resistance of Bull et al above is a transgene (Example 4, col 26-28), the limitation of claim 30. Liang et al teach that the DNA of interest is integrated into the target site both via a non-homologous end joining and a via a homologous recombination (p63, right col, 1st para), the limitations of claims 31-32. An invention would have been obvious to one ordinary skill in the art if any teaching, suggestion or motivation in prior art leading the one to combine the teaching(s) or suggestion(s) of the cited references to arrive the claimed invention. It would have been obvious for one ordinary skill in the art to modify the invention of Bull et al, such that the method comprises using site-specific nuclease TALEN and CRISPR to modify genome of corn cells as suggested by Bull et al and explicitly taught in detail and demonstrated by Liang et al. One ordinary skill in the art would have been motivated to do so because Liang et al not only demonstrated success but also teach the detailed mechanisms and advantages of using TALEN and using CRISPR. The expectation of success would have been high, because using site-specific nuclease including TALEN and CRISPR are mature and routine methods taught and demonstrated for example by Liang et al. Therefore, the invention would have been obvious to one ordinary skill in the art. Claim 19 is rejected under 35 U.S.C. 103 as being unpatentable over Bull et al in view of Liang et al as applied to claim 12 above, and further in view of He et al (Regulation and function of DNA methylation in plants and Animals. Cell Research. 21:442-465, 2011). The teachings of Bull et al in view of Liang et al as they are applied to claim 12 are set forth previously herein and are incorporated by reference. Claim 19 limits claim 12, wherein the v. the target site is within a region of the plant genome of a low DNA methylation (elected species). Bull et al in view of Liang et al are silent or do not teach the particular limitation. He et al teach and demonstrated that in plants, reducing methylation increased expression of a target gene/transgene (p447, right col, 2nd para). In this case, ordinary skill in the art would have recognized that low methylation would have had the effect of increasing expression of a target gene/transgene as taught by He et al. Upon such recognition, it would have been obvious to one ordinary skill in the art to slightly modify the invention of Bull et al such that the method would include target site is within a region of the plant genome of a low DNA methylation region as taught by He et al. One ordinary skill in the art would have been motivated to do so to get the advantage of increasing expression of a target gene/transgene as taught by He et al. The expectation of success would have been high because Bull et al and He et al demonstrated success respectively. Adapting low DNA methylation region would only have been expected to increase expression of a target gene/transgene of Bull et al or Liang et al. Therefore, the dependent claim would have been obvious to one ordinary skill in the art. Claim 26 is rejected under 35 U.S.C. 103 as being unpatentable over Bull et al in view of Liang et al as applied to claims 12 and 24 above, and further in view of Rubtsova et al (Expression of active Streptomyces phage phiC31 integrase in transgenic wheat plants. Plant Cell Rep. 27:1821–1831, 2008). The teachings of Bull et al in view of Liang et al as they are applied to claims 12 and 24 are set forth previously herein and are incorporated by reference. Claim 26 limits claim 24, wherein the serine recombinase attached to a DNA recognition motif is selected from the group consisting of a PhiC31 integrase, and so on. Bull et al in view of Liang et al are silent or do not teach the particular limitation. Rubtsova et al teach a detailed method of using a PhiC31 integrase from phage to make site-specific genome modification in wheat, a crop plant like corn or soybean (p1821, Abstract; p1822-1825, Materials and Methods). Rubtsova et al demonstrated success (p1825-1827, Results; p1826-1828, figs 2-4, Table 1). Rubtsova et al teach that PhiC31 integrase is also called PhiC31 recombinase (p1821, Abstract). Rubtsova et al teach that recombinases like Cre and FLP (taught by Bull et al) are reversible recombinases, but PhiC31 recombinase is an irreversible recombinase, thus, the transgenes are expressed more stably and reliably in a site-specific manner, which can be an advantage (p1822, left col, last para, right col, first para). In this case, it would have been obvious for one ordinary skill in the art to modify the invention rendered obvious by Bull et al in view of Liang et al, such that PhiC31 recombinase is used as an alternative of Cre or FLP recombinase, as taught and demonstrated by Rubtsova et al. One ordinary skill in the art would have been motivated to do so for the advantage of more stable and reliable site-specific gene integration as demonstrated by Rubtsova et al. The expectation of success would have been high because Bull et al in view of Liang et al demonstrated success with recombinases like Cre and FLP, and Rubtsova et al demonstrated success with PhiC31 recombinase. Therefore, the dependent claim would have been obvious to one ordinary skill in the art. Remarks The following reference is relevant to instant application. For compact prosecution, the reference is filed but not cited by the examiner: Brinker et al (US 20110067134, published 3/17/2011). Brinker et al teach the subject matter of site-specific gene modification is haplotype windows in soybean transgenic event. Sequence Matches Against instant SEQ ID NO: 123 US-12-640-069-49/c (NOTE: this sequence has 2 duplicates in the database searched. See complete list at the end of this report) Sequence 49, US/12640069 Patent No. 8754289 GENERAL INFORMATION APPLICANT: Bull, Jason APPLICANT: Butruille, David APPLICANT: Eathington, Samuel R APPLICANT: Edwards, Marlin D APPLICANT: Gupta, Anju APPLICANT: Johnson, Richard APPLICANT: Kennard, Wayne APPLICANT: Rinehart, Jennifer APPLICANT: Wu, Kunsheng TITLE OF INVENTION: METHODS AND COMPOSITIONS TO ENHANCE PLANT BREEDING FILE REFERENCE: 46-21(52898)C CURRENT APPLICATION NUMBER: US/12/640,069 CURRENT FILING DATE: 2009-12-17 PRIOR APPLICATION NUMBER: 11/441,915 PRIOR FILING DATE: 2006-05-26 PRIOR APPLICATION NUMBER: 60/685,584 PRIOR FILING DATE: 2005-05-27 NUMBER OF SEQ ID NOS: 63 SEQ ID NO 49 LENGTH: 784 TYPE: DNA ORGANISM: Zea mays Query Match 26.8%; Score 784; Length 784; Best Local Similarity 100.0%; Matches 784; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1923 GACATCTATTGGAAAGATGGATAGTGCTAGAAAGCGTTTTTTTTGGAAGAGGGAAATATC 1982 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 784 GACATCTATTGGAAAGATGGATAGTGCTAGAAAGCGTTTTTTTTGGAAGAGGGAAATATC 725 Qy 1983 ATTTGATTAGATGGACTAAGATCACTAAACCTAGCTAAGAAAAAAAAGATTAATTACATA 2042 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 724 ATTTGATTAGATGGACTAAGATCACTAAACCTAGCTAAGAAAAAAAAGATTAATTACATA 665 Qy 2043 CTTGTCACCCTGTTTTTATAAAATTAGATAGGTAATTCATTTTGATGTCATTGAGCGACA 2102 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 664 CTTGTCACCCTGTTTTTATAAAATTAGATAGGTAATTCATTTTGATGTCATTGAGCGACA 605 Qy 2103 TGAAAATAAACTACTTTATAACTCTTTAAATTTGGAGTGGCATACTTCTAATTAACCCCA 2162 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 604 TGAAAATAAACTACTTTATAACTCTTTAAATTTGGAGTGGCATACTTCTAATTAACCCCA 545 Qy 2163 AACCAGATATATTTACTTAAGCAGCAGGTCTACGGTGTCGGCCAATGAAAAATCCACCAT 2222 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 544 AACCAGATATATTTACTTAAGCAGCAGGTCTACGGTGTCGGCCAATGAAAAATCCACCAT 485 Qy 2223 TTTTTTGGCATACTAGATGGTGTGGCTATAGGTTACTTTAAAGACACACTTTTCTCATTT 2282 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 484 TTTTTTGGCATACTAGATGGTGTGGCTATAGGTTACTTTAAAGACACACTTTTCTCATTT 425 Qy 2283 TTTTTAAAAAAAACGAGGACCGTGATTGTTCAGTTGAAGCCATGAAATATAAAAACTAGA 2342 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 424 TTTTTAAAAAAAACGAGGACCGTGATTGTTCAGTTGAAGCCATGAAATATAAAAACTAGA 365 Qy 2343 GCCTCATTTTTAGGAGATGGCTACGTGAAGATTTACAGAGTCAGCTTAGAAGATTGCAAG 2402 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 364 GCCTCATTTTTAGGAGATGGCTACGTGAAGATTTACAGAGTCAGCTTAGAAGATTGCAAG 305 Qy 2403 ATATCGTTCTAAAAAATAACGATGGCCAGTTGGTAATTGCGAGTGAGATAAATCTGGAAA 2462 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 304 ATATCGTTCTAAAAAATAACGATGGCCAGTTGGTAATTGCGAGTGAGATAAATCTGGAAA 245 Qy 2463 TTTCCCTAAGAAACTGTTTTGTATGGGCAAAGTTTTAATATAATCTAAAAAGGCAAAACA 2522 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 244 TTTCCCTAAGAAACTGTTTTGTATGGGCAAAGTTTTAATATAATCTAAAAAGGCAAAACA 185 Qy 2523 ACCGTGGAGTGAAGGTCTTCACGTGGTTGGTATTACAAGATAGAAGATACCCTCTTCGTT 2582 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 184 ACCGTGGAGTGAAGGTCTTCACGTGGTTGGTATTACAAGATAGAAGATACCCTCTTCGTT 125 Qy 2583 TTTTTTATTTATCACGTTTTAGTTTAAAATTAAACTAGCAGATGATAAATATTCAAGAAC 2642 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 124 TTTTTTATTTATCACGTTTTAGTTTAAAATTAAACTAGCAGATGATAAATATTCAAGAAC 65 Qy 2643 GAAGGTAGTACTTACTATTCTCTCTAAAGATAATCTCTGTACGAACAGTACATGAAATTA 2702 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 64 GAAGGTAGTACTTACTATTCTCTCTAAAGATAATCTCTGTACGAACAGTACATGAAATTA 5 Qy 2703 TGTT 2706 |||| Db 4 TGTT 1 CG163171 LOCUS CG163171 991 bp DNA linear GSS 21-AUG-2003 DEFINITION PUKBT78TD ZM_0.6_1.0_KB Zea mays genomic clone ZMMBTa0783M12, genomic survey sequence. ACCESSION CG163171 VERSION CG163171.1 DBLINK BioSample: SAMN00182290 KEYWORDS GSS. SOURCE Zea mays ORGANISM Zea mays Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; PACMAD clade; Panicoideae; Andropogonodae; Andropogoneae; Tripsacinae; Zea. REFERENCE 1 (bases 1 to 991) AUTHORS Whitelaw,C.A., Quackenbush,J., Van Aken,S., Utterback,T., Resnick,A., Fraser,C.M., Yuan,Y., San Miguel,P., Ma,J. and Bennetzen,J. TITLE Maize Genomics Consortium JOURNAL Unpublished COMMENT Other_GSSs: PUKBT78TB Contact: Cathy Whitelaw TIGR 9712 Medical Center Drive, Rockville, MD 20850, USA Tel: 301-838-5843 Fax: 301-838-0208 Email: whitelaw\@tigr.org Seq primer: TF Class: sheared ends. FEATURES Location/Qualifiers source 1..991 /organism="Zea mays" /mol_type="genomic DNA" /strain="B73" /db_xref="taxon:4577" /clone="ZMMBTa0783M12" /clone_lib="SAMN00182290 ZM_0.6_1.0_KB" /note="Vector: pCR4-TOPO; Site_1: EcoRI; 0.6-1.0 kb high CoT selected genomic DNA library" ORIGIN Query Match 33.6%; Score 983; Length 991; Best Local Similarity 100.0%; Matches 983; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1946 GTGCTAGAAAGCGTTTTTTTTGGAAGAGGGAAATATCATTTGATTAGATGGACTAAGATC 2005 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 GTGCTAGAAAGCGTTTTTTTTGGAAGAGGGAAATATCATTTGATTAGATGGACTAAGATC 60 Qy 2006 ACTAAACCTAGCTAAGAAAAAAAAGATTAATTACATACTTGTCACCCTGTTTTTATAAAA 2065 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 ACTAAACCTAGCTAAGAAAAAAAAGATTAATTACATACTTGTCACCCTGTTTTTATAAAA 120 Qy 2066 TTAGATAGGTAATTCATTTTGATGTCATTGAGCGACATGAAAATAAACTACTTTATAACT 2125 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 TTAGATAGGTAATTCATTTTGATGTCATTGAGCGACATGAAAATAAACTACTTTATAACT 180 Qy 2126 CTTTAAATTTGGAGTGGCATACTTCTAATTAACCCCAAACCAGATATATTTACTTAAGCA 2185 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 CTTTAAATTTGGAGTGGCATACTTCTAATTAACCCCAAACCAGATATATTTACTTAAGCA 240 Qy 2186 GCAGGTCTACGGTGTCGGCCAATGAAAAATCCACCATTTTTTTGGCATACTAGATGGTGT 2245 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 GCAGGTCTACGGTGTCGGCCAATGAAAAATCCACCATTTTTTTGGCATACTAGATGGTGT 300 Qy 2246 GGCTATAGGTTACTTTAAAGACACACTTTTCTCATTTTTTTTAAAAAAAACGAGGACCGT 2305 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 GGCTATAGGTTACTTTAAAGACACACTTTTCTCATTTTTTTTAAAAAAAACGAGGACCGT 360 Qy 2306 GATTGTTCAGTTGAAGCCATGAAATATAAAAACTAGAGCCTCATTTTTAGGAGATGGCTA 2365 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 GATTGTTCAGTTGAAGCCATGAAATATAAAAACTAGAGCCTCATTTTTAGGAGATGGCTA 420 Qy 2366 CGTGAAGATTTACAGAGTCAGCTTAGAAGATTGCAAGATATCGTTCTAAAAAATAACGAT 2425 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 CGTGAAGATTTACAGAGTCAGCTTAGAAGATTGCAAGATATCGTTCTAAAAAATAACGAT 480 Qy 2426 GGCCAGTTGGTAATTGCGAGTGAGATAAATCTGGAAATTTCCCTAAGAAACTGTTTTGTA 2485 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 GGCCAGTTGGTAATTGCGAGTGAGATAAATCTGGAAATTTCCCTAAGAAACTGTTTTGTA 540 Qy 2486 TGGGCAAAGTTTTAATATAATCTAAAAAGGCAAAACAACCGTGGAGTGAAGGTCTTCACG 2545 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 TGGGCAAAGTTTTAATATAATCTAAAAAGGCAAAACAACCGTGGAGTGAAGGTCTTCACG 600 Qy 2546 TGGTTGGTATTACAAGATAGAAGATACCCTCTTCGTTTTTTTTATTTATCACGTTTTAGT 2605 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 TGGTTGGTATTACAAGATAGAAGATACCCTCTTCGTTTTTTTTATTTATCACGTTTTAGT 660 Qy 2606 TTAAAATTAAACTAGCAGATGATAAATATTCAAGAACGAAGGTAGTACTTACTATTCTCT 2665 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 TTAAAATTAAACTAGCAGATGATAAATATTCAAGAACGAAGGTAGTACTTACTATTCTCT 720 Qy 2666 CTAAAGATAATCTCTGTACGAACAGTACATGAAATTATGTTGCTGCAGGCGTTATGGTGT 2725 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 CTAAAGATAATCTCTGTACGAACAGTACATGAAATTATGTTGCTGCAGGCGTTATGGTGT 780 Qy 2726 TATTGTTTCATTGCACCTTATTTAATTGAAGGCTGAGTTTGAATCTTAGTCGTTGACTCT 2785 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 TATTGTTTCATTGCACCTTATTTAATTGAAGGCTGAGTTTGAATCTTAGTCGTTGACTCT 840 Qy 2786 AAGGTTCATACTAATCTAATCAGTAGAACACACATACTTTTATGTTTTATTAAATAAAAT 2845 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 AAGGTTCATACTAATCTAATCAGTAGAACACACATACTTTTATGTTTTATTAAATAAAAT 900 Qy 2846 CTATTTATATAATATATAGAAATAGTAGCAGTGTATTATTTCATCATGACAAGGCCACAA 2905 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 CTATTTATATAATATATAGAAATAGTAGCAGTGTATTATTTCATCATGACAAGGCCACAA 960 Qy 2906 AGGTGAATCAAGCGCCTCACGTT 2928 ||||||||||||||||||||||| Db 961 AGGTGAATCAAGCGCCTCACGTT 983 Instant SEQ ID NO: 5 Against instant SEQ ID NO: 123 Score Expect Identities Gaps Strand 50.1 bits(25) 4e-11 25/25(100%) 0/25(0%) Plus/Plus Query 1 TATGCTTGAGGACAATTCCCTGTGT 25 ||||||||||||||||||||||||| Sbjct 1424 TATGCTTGAGGACAATTCCCTGTGT 1448 Instant SEQ ID NO: 64 Against instant SEQ ID NO: 123 Score Expect Identities Gaps Strand 50.1 bits(25) 4e-11 25/25(100%) 0/25(0%) Plus/Minus Query 1 TTCCTTCAATAGACAACCGACCAAG 25 ||||||||||||||||||||||||| Sbjct 1493 TTCCTTCAATAGACAACCGACCAAG 1469 Against instant SEQ ID NO: 130 CG442537/c LOCUS CG442537 647 bp DNA linear GSS 17-SEP-2003 DEFINITION OGTBF41TV ZM_0.7_1.5_KB Zea mays genomic clone ZMMBMa0854H10, genomic survey sequence. ACCESSION CG442537 VERSION CG442537.1 DBLINK BioSample: SAMN00182289 KEYWORDS GSS. SOURCE Zea mays ORGANISM Zea mays Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; PACMAD clade; Panicoideae; Andropogonodae; Andropogoneae; Tripsacinae; Zea. REFERENCE 1 (bases 1 to 647) AUTHORS Whitelaw,C.A., Quackenbush,J., Van Aken,S., Utterback,T., Resnick,A., Fraser,C.M., Budiman,M.A., Bedell,J.A., Rohlfing,T., Citek,R.W., Nunberg,A., Robbins,D. and Lakey,N. TITLE Consortium for Maize Genomics JOURNAL Unpublished COMMENT Contact: Cathy Whitelaw TIGR 9712 Medical Center Drive, Rockville, MD 20850, USA Tel: 301-838-5843 Fax: 301-838-0208 Email: whitelaw\@tigr.org Seq primer: TF Class: methylation filtered. FEATURES Location/Qualifiers source 1..647 /organism="Zea mays" /mol_type="genomic DNA" /strain="B73" /db_xref="taxon:4577" /clone="ZMMBMa0854H10" /clone_lib="SAMN00182289 ZM_0.7_1.5_KB" /note="Vector: pBCSK-; Site_1: HincII; 0.7-1.5 kb methylation filtered genomic DNA library" ORIGIN Query Match 18.3%; Score 647; Length 647; Best Local Similarity 100.0%; Matches 647; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 407 GACATGTCTTCATTATTGACGGAACATTCAAAAGCCGGATCGACATCAAGAAATGTTTGG 466 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 647 GACATGTCTTCATTATTGACGGAACATTCAAAAGCCGGATCGACATCAAGAAATGTTTGG 588 Qy 467 TTCCAGCCAACTAAATTTTAGTTTATCACATCAAACGTATATTCGAATAATAATTACAGA 526 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 587 TTCCAGCCAACTAAATTTTAGTTTATCACATCAAACGTATATTCGAATAATAATTACAGA 528 Qy 527 TATTAAATGCAGTCTAATTATAAAACTAACTATACAAATAAAAACTAAAAGACAAGCCTA 586 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 527 TATTAAATGCAGTCTAATTATAAAACTAACTATACAAATAAAAACTAAAAGACAAGCCTA 468 Qy 587 ATCAAGCCATTATTTAATATTCATAATTATTTTAAATACTTGATGTGACAGTTCGGAACG 646 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 467 ATCAAGCCATTATTTAATATTCATAATTATTTTAAATACTTGATGTGACAGTTCGGAACG 408 Qy 647 AAACATCTCCTTACTGGCTAACAAATAACAACCAACCCACCATAAAAGAGCATCCACGCG 706 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 407 AAACATCTCCTTACTGGCTAACAAATAACAACCAACCCACCATAAAAGAGCATCCACGCG 348 Qy 707 TAAAGATGCACGGATCGGGAGCAGCTAGCGCGGGGAAGCTTTGCTTGGCTGCCGCACGCA 766 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 347 TAAAGATGCACGGATCGGGAGCAGCTAGCGCGGGGAAGCTTTGCTTGGCTGCCGCACGCA 288 Qy 767 CGAGTTCGCAACCAATCCATCGGGACTCAGAAAATGGGATCTGGGTCGGCATATGCTCCA 826 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 287 CGAGTTCGCAACCAATCCATCGGGACTCAGAAAATGGGATCTGGGTCGGCATATGCTCCA 228 Qy 827 GCTCTACGACGATCCTTCGTACTAGCAATCGTCGTCGCCGGTAACAAACATCTCCAGACA 886 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 227 GCTCTACGACGATCCTTCGTACTAGCAATCGTCGTCGCCGGTAACAAACATCTCCAGACA 168 Qy 887 CTAGGGATCTGATCGGAAGGGGGAAACTGTAATAAAAAGGATTTAAAAAAACGCTACTGG 946 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 167 CTAGGGATCTGATCGGAAGGGGGAAACTGTAATAAAAAGGATTTAAAAAAACGCTACTGG 108 Qy 947 ACCCCTTACACGACTGTACCGAAGTTATTGGTCGCGTACAAAAATATCCCGACAAGAAAG 1006 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 107 ACCCCTTACACGACTGTACCGAAGTTATTGGTCGCGTACAAAAATATCCCGACAAGAAAG 48 Qy 1007 AGCATCGCAATCAGGCGTCTGCGTGTGCCGATGGGTCTGCAGCAACG 1053 ||||||||||||||||||||||||||||||||||||||||||||||| Db 47 AGCATCGCAATCAGGCGTCTGCGTGTGCCGATGGGTCTGCAGCAACG 1 US-11-504-538-6707/c (NOTE: this sequence has 1 duplicate in the database searched. See complete list at the end of this report) Sequence 6707, US/11504538 Publication No. US20080083042A1 GENERAL INFORMATION APPLICANT: Laurie, Cathy C. TITLE OF INVENTION: Maize Polymorphisms and Methods of Genotyping FILE REFERENCE: 38-10(52018)B CURRENT APPLICATION NUMBER: US/11/504,538 CURRENT FILING DATE: 2006-08-14 NUMBER OF SEQ ID NOS: 10380 SEQ ID NO 6707 LENGTH: 799 TYPE: DNA ORGANISM: Zea mays Query Match 22.5%; Score 797.4; Length 799; Best Local Similarity 99.9%; Matches 798; Conservative 0; Mismatches 1; Indels 0; Gaps 0; Qy 244 AAGAAACCCTATAAAAGGTTACGTCGGCTAGTATCAAACATATGCCTGAGTCACTCTACC 303 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 799 AAAAAACCCTATAAAAGGTTACGTCGGCTAGTATCAAACATATGCCTGAGTCACTCTACC 740 Qy 304 TTTCTATATAATAAATTTATGCCCTTATAATGATAACGAGAAGAAAATGAGAAAAAAGAA 363 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 739 TTTCTATATAATAAATTTATGCCCTTATAATGATAACGAGAAGAAAATGAGAAAAAAGAA 680 Qy 364 TAAAATATTTCTTGTTTACCGATAAGGGGAAAAAATAGTCTTTGACATGTCTTCATTATT 423 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 679 TAAAATATTTCTTGTTTACCGATAAGGGGAAAAAATAGTCTTTGACATGTCTTCATTATT 620 Qy 424 GACGGAACATTCAAAAGCCGGATCGACATCAAGAAATGTTTGGTTCCAGCCAACTAAATT 483 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 619 GACGGAACATTCAAAAGCCGGATCGACATCAAGAAATGTTTGGTTCCAGCCAACTAAATT 560 Qy 484 TTAGTTTATCACATCAAACGTATATTCGAATAATAATTACAGATATTAAATGCAGTCTAA 543 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 559 TTAGTTTATCACATCAAACGTATATTCGAATAATAATTACAGATATTAAATGCAGTCTAA 500 Qy 544 TTATAAAACTAACTATACAAATAAAAACTAAAAGACAAGCCTAATCAAGCCATTATTTAA 603 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 499 TTATAAAACTAACTATACAAATAAAAACTAAAAGACAAGCCTAATCAAGCCATTATTTAA 440 Qy 604 TATTCATAATTATTTTAAATACTTGATGTGACAGTTCGGAACGAAACATCTCCTTACTGG 663 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 439 TATTCATAATTATTTTAAATACTTGATGTGACAGTTCGGAACGAAACATCTCCTTACTGG 380 Qy 664 CTAACAAATAACAACCAACCCACCATAAAAGAGCATCCACGCGTAAAGATGCACGGATCG 723 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 379 CTAACAAATAACAACCAACCCACCATAAAAGAGCATCCACGCGTAAAGATGCACGGATCG 320 Qy 724 GGAGCAGCTAGCGCGGGGAAGCTTTGCTTGGCTGCCGCACGCACGAGTTCGCAACCAATC 783 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 319 GGAGCAGCTAGCGCGGGGAAGCTTTGCTTGGCTGCCGCACGCACGAGTTCGCAACCAATC 260 Qy 784 CATCGGGACTCAGAAAATGGGATCTGGGTCGGCATATGCTCCAGCTCTACGACGATCCTT 843 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 259 CATCGGGACTCAGAAAATGGGATCTGGGTCGGCATATGCTCCAGCTCTACGACGATCCTT 200 Qy 844 CGTACTAGCAATCGTCGTCGCCGGTAACAAACATCTCCAGACACTAGGGATCTGATCGGA 903 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 199 CGTACTAGCAATCGTCGTCGCCGGTAACAAACATCTCCAGACACTAGGGATCTGATCGGA 140 Qy 904 AGGGGGAAACTGTAATAAAAAGGATTTAAAAAAACGCTACTGGACCCCTTACACGACTGT 963 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 139 AGGGGGAAACTGTAATAAAAAGGATTTAAAAAAACGCTACTGGACCCCTTACACGACTGT 80 Qy 964 ACCGAAGTTATTGGTCGCGTACAAAAATATCCCGACAAGAAAGAGCATCGCAATCAGGCG 1023 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 79 ACCGAAGTTATTGGTCGCGTACAAAAATATCCCGACAAGAAAGAGCATCGCAATCAGGCG 20 Qy 1024 TCTGCGTGTGCCGATGGGT 1042 ||||||||||||||||||| Db 19 TCTGCGTGTGCCGATGGGT 1 Against instant SEQ ID NO: 5 RESULT 1 BZ961692/c LOCUS BZ961692 664 bp DNA linear GSS 25-MAR-2003 DEFINITION PUGHD74TB ZM_0.6_1.0_KB Zea mays genomic clone ZMMBTa383M04, genomic survey sequence. ACCESSION BZ961692 VERSION BZ961692.1 DBLINK BioSample: SAMN00182290 KEYWORDS GSS. SOURCE Zea mays ORGANISM Zea mays Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; PACMAD clade; Panicoideae; Andropogonodae; Andropogoneae; Tripsacinae; Zea. REFERENCE 1 (bases 1 to 664) AUTHORS Whitelaw,C.A., Quackenbush,J., Van Aken,S., Utterback,T., Resnick,A., Fraser,C.M., Yuan,Y., San Miguel,P., Ma,J. and Bennetzen,J. TITLE Maize Genomics Consortium JOURNAL Unpublished COMMENT Other_GSSs: PUGHD74TD Contact: Cathy Whitelaw TIGR 9712 Medical Center Drive, Rockville, MD 20850, USA Tel: 301-838-5843 Fax: 301-838-0208 Email: whitelaw\@tigr.org Seq primer: TR Class: sheared ends. FEATURES Location/Qualifiers source 1..664 /organism="Zea mays" /mol_type="genomic DNA" /strain="B73" /db_xref="taxon:4577" /clone="ZMMBTa383M04" /clone_lib="SAMN00182290 ZM_0.6_1.0_KB" /note="Vector: pCR4-TOPO; Site_1: EcoRI; 0.6-1.0 kb high CoT selected genomic DNA library" ORIGIN Query Match 100.0%; Score 25; Length 664; Best Local Similarity 100.0%; Matches 25; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 TATGCTTGAGGACAATTCCCTGTGT 25 ||||||||||||||||||||||||| Db 321 TATGCTTGAGGACAATTCCCTGTGT 297 US-11-514-704-5355 Sequence 5355, US/11514704 Patent No. 7750207 GENERAL INFORMATION APPLICANT: MONSANTO TECHNOLOGY, LLC APPLICANT: Wu, Kunsheng APPLICANT: Dasgupta, Santanu APPLICANT: Cherian, Shoba APPLICANT: Jayaprakash, Targolli L TITLE OF INVENTION: Zea mays Ribulose Bisphosphate Carboxylase TITLE OF INVENTION: Activase Promoter FILE REFERENCE: 38-21(53660)C CURRENT APPLICATION NUMBER: US/11/514,704 CURRENT FILING DATE: 2006-09-01 NUMBER OF SEQ ID NOS: 25043 SEQ ID NO 5355 LENGTH: 1321 TYPE: DNA ORGANISM: Zea mays FEATURE: NAME/KEY: misc_feature LOCATION: (34)..(34) OTHER INFORMATION: n is a, c, g, or t Query Match 68.0%; Score 17; Length 1321; Best Local Similarity 100.0%; Matches 17; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 7 TGAGGACAATTCCCTGT 23 ||||||||||||||||| Db 1109 TGAGGACAATTCCCTGT 1125 Against instant SEQ ID NO: 64 US-11-504-538-884/c (NOTE: this sequence has 1 duplicate in the database searched. See complete list at the end of this report) Sequence 884, US/11504538 Publication No. US20080083042A1 GENERAL INFORMATION APPLICANT: Laurie, Cathy C. TITLE OF INVENTION: Maize Polymorphisms and Methods of Genotyping FILE REFERENCE: 38-10(52018)B CURRENT APPLICATION NUMBER: US/11/504,538 CURRENT FILING DATE: 2006-08-14 NUMBER OF SEQ ID NOS: 10380 SEQ ID NO 884 LENGTH: 800 TYPE: DNA ORGANISM: Zea mays Query Match 100.0%; Score 25; Length 800; Best Local Similarity 100.0%; Matches 25; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 TTCCTTCAATAGACAACCGACCAAG 25 ||||||||||||||||||||||||| Db 749 TTCCTTCAATAGACAACCGACCAAG 725 Against instant SEQ ID NO: 35 RESULT 1 US-15-120-110A-61 (NOTE: this sequence has 2 duplicates in the database searched. See complete list at the end of this report) Sequence 61, US/15120110A Patent No. 11186843 GENERAL INFORMATION APPLICANT: Monsanto Technology LLC TITLE OF INVENTION: COMPOSITIONS AND METHODS FOR SITE DIRECTED GENOMIC MODIFICATION FILE REFERENCE: MONS:350US CURRENT APPLICATION NUMBER: US/15/120,110A CURRENT FILING DATE: 2017-09-26 PRIOR APPLICATION NUMBER: 61/945,700 PRIOR FILING DATE: 2014-02-27 NUMBER OF SEQ ID NOS: 295 SEQ ID NO 61 LENGTH: 23 TYPE: DNA ORGANISM: Zea mays Query Match 100.0%; Score 19; Length 23; Best Local Similarity 100.0%; Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 TCTCCTATCATAACGTTTG 19 ||||||||||||||||||| Db 4 TCTCCTATCATAACGTTTG 22 Against instant SEQ ID NO: 94 RESULT 1 BI012947/c LOCUS BI012947 343 bp mRNA linear EST 09-MAY-2010 DEFINITION PM4-ET0675-130101-001-a07 ET0675 Homo sapiens cDNA, mRNA sequence. ACCESSION BI012947 VERSION BI012947.1 DBLINK BioSample: SAMN00163646 KEYWORDS EST. SOURCE Homo sapiens (human) ORGANISM Homo sapiens Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo. REFERENCE 1 (bases 1 to 343) AUTHORS Dias Neto,E., Garcia Correa,R., Verjovski-Almeida,S., Briones,M.R., Nagai,M.A., da Silva,W. Jr., Zago,M.A., Bordin,S., Costa,F.F., Goldman,G.H., Carvalho,A.F., Matsukuma,A., Baia,G.S., Simpson,D.H., Brunstein,A., deOliveira,P.S., Bucher,P., Jongeneel,C.V., O'Hare,M.J., Soares,F., Brentani,R.R., Reis,L.F., de Souza,S.J. and Simpson,A.J. TITLE Shotgun sequencing of the human transcriptome with ORF expressed sequence tags JOURNAL Proc. Natl. Acad. Sci. U.S.A. 97 (7), 3491-3496 (2000) PUBMED 10737800 COMMENT Contact: Simpson A.J.G. Laboratory of Cancer Genetics Ludwig Institute for Cancer Research Rua Prof. Antonio Prudente 109, 4 andar, 01509-010, Sao Paulo-SP, Brazil Tel: +55-11-2704922 Fax: +55-11-2707001 Email: asimpson\@ludwig.org.br This sequence was derived from the FAPESP/LICR Human Cancer Genome Project. This entry can be seen in the following URL (http://www.ludwig.org.br/scripts/gethtml2.pl?t1=PM4&t2=PM4-ET0675- 130101-001-a07&t3=2001-01-13&t4=1) Seq primer: puc 18 forward. FEATURES Location/Qualifiers source 1..343 /organism="Homo sapiens" /mol_type="mRNA" /db_xref="taxon:9606" /clone_lib="SAMN00163646 ET0675" /dev_stage="Adult" /note="Organ: lung_tumor; Vector: puc18; Site_1: SmaI; Site_2: SmaI; A mini-library was made by cloning products derived from ORESTES PCR (U.S. Letters Patent application No. 196,716 - Ludwig Institute for Cancer Research) profiles into the pUC 18 vector. Reverse transcription of tissue mRNA and cDNA amplification were performed under low stringency conditions." ORIGIN Query Match 100.0%; Score 19; Length 343; Best Local Similarity 100.0%; Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 TGAGTTTGAGACCCACCTG 19 ||||||||||||||||||| Db 28 TGAGTTTGAGACCCACCTG 10 RESULT 2 AZ799712 LOCUS AZ799712 350 bp DNA linear GSS 16-FEB-2001 DEFINITION 2M0057N14F Mouse 10kb plasmid UUGC1M library Mus musculus genomic clone UUGC2M0057N14 F, genomic survey sequence. ACCESSION AZ799712 VERSION AZ799712.1 DBLINK BioSample: SAMN00177855 KEYWORDS GSS. SOURCE Mus musculus (house mouse) ORGANISM Mus musculus Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Glires; Rodentia; Myomorpha; Muroidea; Muridae; Murinae; Mus; Mus. REFERENCE 1 (bases 1 to 350) AUTHORS Dunn,D., Aoyagi,A., Barber,M., Beacorn,T., Duval,B., Hamil,C., Islam,H., Longacre,S., Mahmoud,M., Meenen,E., Pedersen,T., Reilly,M., Rose,M., Rose,R., Stokes,R., Tingey,A., von Niederhausern,A., Wright,D. and Weiss,R. TITLE Mouse whole genome scaffolding with paired end reads from 10kb plasmid inserts JOURNAL Unpublished COMMENT Contact: Robert B. Weiss University of Utah Genome Center University of Utah Rm. 308, Biomedical Polymers Research Bldg., 20 S. 2030 E., SLC, UT 84112, USA Tel: 801 585 5606 Fax: 801 585 7177 Email: ddunn\@genetics.utah.edu Insert Length: 10000 Std Error: 0.00 Plate: 0057 row: N column: 14 Seq primer: CGTTGTAAAACGACGGCCAGT Class: plasmid ends. FEATURES Location/Qualifiers source 1..350 /organism="Mus musculus" /mol_type="genomic DNA" /strain="C57BL/6J" /db_xref="taxon:10090" /clone="UUGC2M0057N14" /sex="male" /clone_lib="SAMN00177855 Mouse 10kb plasmid UUGC1M library" /lab_host="E. Coli strain XL10-Gold, T1-resistant, F-" /note="Vector: PWD42nv; Purified genomic DNA from M. musculus C57BL/6J (male) was obtained from the Jackson Laboratory Mouse DNA Resource (http://www.jax.org/resources/documents/dnares/). The DNA was hydrodynamically sheared by repeated passage through a 0.005 inch orifice at constant velocity. The sheared DNA was blunt end-repaired with T4 DNA polymerase and T4 polynucleotide kinase. Adaptor oligonucleotides were ligated to the blunt ends in high molar excess. The adaptored DNA was purified and size-selected for a 9.5 to 10.5 kb range using preparative agarose gel electrophoresis. Vector DNA was prepared from a derivative of pWD42 (gi|4732114|gb|AF129072.1), a copy-number inducible derivative of plasmid R1. The vector was ligated with adaptors complementary to the insert adaptors and purified. The sheared, adaptored mouse DNA was annealed to adaptored vector DNA, and transformed into chemically-competent E. coli XL10-Gold (Stratagene) cells and selected for ampicillin resistance." ORIGIN Query Match 100.0%; Score 19; Length 350; Best Local Similarity 100.0%; Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 TGAGTTTGAGACCCACCTG 19 ||||||||||||||||||| Db 91 TGAGTTTGAGACCCACCTG 109 Conclusion No claim is allowed. Contact information Any inquiry concerning this communication or earlier communications from the examiner should be directed to WAYNE ZHONG whose telephone number is (571)270-0311. The examiner can normally be reached 8:30am to 5:00pm EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic, can be reached on 571-270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /Wayne Zhong/ Primary Examiner, Art Unit 1662
Read full office action

Prosecution Timeline

Oct 07, 2024
Application Filed
Sep 14, 2026
Non-Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12745740
PEPPER HYBRID DRPB3992 AND PARENTS THEREOF
2y 3m to grant Granted Sep 29, 2026
Patent 12733641
CELL DEATH INHIBITOR AND CELL DEATH INHIBITION METHOD
4y 8m to grant Granted Sep 15, 2026
Patent 12723251
MATERIALS AND METHODS FOR PUFA PRODUCTION, AND PUFA-CONTAINING COMPOSITIONS
3y 7m to grant Granted Sep 01, 2026
Patent 12716071
METHODS FOR PLANT TRANSFORMATION
5y 11m to grant Granted Aug 25, 2026
Patent 12709756
PLANT CELLS, PLANTS, AND SEEDS HAVING TARGETED ENHANCER ELEMENT INSERTIONS
3y 6m to grant Granted Aug 18, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
72%
Grant Probability
94%
With Interview (+21.5%)
2y 10m (~11m remaining)
Median Time to Grant
Low
PTA Risk
Based on 544 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month