DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
Priority Acknowledgment is made of applicant's claim for foreign priority of App. No. CN202210423670.9 (04/22/2022) and PCT/CN2022/130494 (11/08/2022) under 35 U.S.C. 119 (a)-(d). The certified copy has been filed in the instant application, filed on November 4th, 2024.
Examiner notes that although a certified translation of the priority application has not been filed, in light of the Applicant’s acknowledgement of the document translation [see Applicant Arguments/Remarks Made in an Amendment filed 06/02/2026, pg. 8] and in the interest of compact prosecution, the examination will continue during the preparation period.
Status of Claims
The amendments submitted on June 2nd, 2026 have been entered.
Claim 8 has been canceled.
Claims 1-7 and 9-11 are pending and examined in this Office action.
The text of those sections of Title 35 U.S. Code, not included in this action, can be found in a prior Office action.
Withdrawn Objections/Rejections
The objection to the specification regarding the inclusion of browser-executable code is withdrawn in light of the amendments to the specification.
The objections to claims 1, 4, 6, and 10 regarding the sequence identifier formatting and claims 5, 11, and 3 regarding grammatical and formatting issues are withdrawn in light of the claim amendments.
The rejection of claim 6 under 35 USC § 101 is withdrawn in light of the claim amendments.
The rejection of claims 6-11 under 35 USC § 112(b) for indefiniteness is withdrawn in light of the claim amendments.
The rejection of claim 11 under 35 USC § 112(b)
Modified Objections/Rejections
Drawings
The objection to the drawings is modified as the Applicant amended the figures in question. However, as stated in the Non-Final Rejection filed 03/06/2026, any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet. Corrective action is required. This rejection is modified in light of the amendments to the drawings.
New Objections/Rejections
Claim Objection
The claims are objected to because the lines are crowded too closely together after page 3 of the claim set, making reading difficult. Substitute claims with lines one and one-half or double spaced on good quality paper are required. See 37 CFR 1.52(b).
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 4-5 and 10-11 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. This is a new rejection necessitated by amendments to the claims.
Claims 4 and 10 recite a target sequence selected from a fragment of one of the nucleotide sequences as set forth in SEQ ID NO: 1, 3, 5, 9, or 10. It is not clear that a singular target sequence of any of the sequences would allow for the necessary mutations disclosed in the specification, especially given that claim 1 recites (a) – (e) in the alternative. A target sequence selected from a fragment nucleotide sequences as set forth in SEQ ID NO: 1, 3, or 9 would not be able to effectively target the gene sequence in SEQ ID NO: 5. Similarly, it appears that section (d) would require more than one target sequence given the requirement of a combination of mutations of different genes (i.e., ZmYUC2 and ZmYUC4).
Further, claims 5 and 11 states that the gene mutant sequence is set forth in any of SEQ ID NOs: 11-14. It is not clear if the Applicant intends to claim that the gene mutant sequence of any of the SEQ ID NOs. could confer the phenotype when derived from any of the gene sequences of claim 1 or claim 6. As the gene sequences of ZmYUC2 and ZmYUC4 are different, and ZmYUC2 requires an additional mutation of ZmYUC4, it is not clear that the claimed subject material of claims 5 and 11 would reflect the singular or combined mutations. Can the gene mutant sequences of SEQ ID NOs: 11-14 be derived from any of SEQ ID NOs: 1, 3, 9, 5 or 10? Can any single gene mutant sequence in claims 5 and 11 confer the phenotype claimed in claims 1 and 6?
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1-2 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Alexandrov, N. et al. US Patent Application No. US 20120159672 A1. “Sequence-determined DNA Fragments and Corresponding Polypeptides Encoded Thereby.” Published 06/21/2012. This is a new rejection necessitated by amendments to the claims.
Claim 1 recites a gene mutant sequence that is derived from mutation of a gene nucleotide sequence, and generates a phenotype of an increased brace root growth angle and lodging resistance in maize plants containing the gene mutant sequence, wherein the gene nucleotide sequence is selected from one of the following sequences: (a) a polynucleotide sequence as set forth in SEQ ID No: 5.
Claim 2 recites the gene mutant sequence of claim 1, wherein the gene mutant sequence is derived through the mutation comprising substitution, deletion, and/or addition or one or more nucleotides in the nucleotide sequence of the gene.
Regarding claim 1, Alexandrov explicitly discloses Zea mays SEQ ID NO: 35842 with 98.6% identity to SEQ ID NO: 5 of the instant application (see alignment below). Alexandrov teaches that the polynucleotides can be from maize mutants (i.e., derived from mutation of a gene nucleotide sequence) [¶86]. As this sequence has 4 mismatches to SEQ ID NO: 5, it is taken to read on a gene mutant of the gene nucleotide sequence. Alexandrov teaches that manipulation of the disclosed genes can result in increased lodging resistance [¶384].
Query Match 98.6%; Score 1248.6; Length 1616;
Best Local Similarity 99.6%;
Matches 1262; Conservative 0; Mismatches 4; Indels 1; Gaps 1;
Qy 1 ATGGGGCTCCTCCCTACCGACCGCATGGATAGCCTCTTCTCCCCGCGCTGCGTGTGGGTG 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 192 ATGGGGCTCCTCCCTACCGACCGCATGGATAGCCTCTTCTCCCCGCGCTGCGTGTGGGTG 251
Qy 61 ACCGGGCCCATCATTGTGGGCGCGGGGCCGTCGGGGCTAGCCGTGGCGGCGTGCCTGCGG 120
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
Db 252 ACCGGGCCCATCATCGTGGGCGCGGGGCCGTCGGGGCTAGCCGTGGCGGCGTGCCTGCGG 311
Qy 121 GAGCAGGGCGTGCCGTTCGTCGTCCTGGAGCGCGCCGACTGTATCGCCTCGCTGTGGCAA 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 312 GAGCAGGGCGTGCCGTTCGTCGTCCTGGAGCGCGCCGACTGTATCGCCTCGCTGTGGCAA 371
Qy 181 CGGCGCACGTACAACCGCCTCAAGCTGCACCTACCCAAGCAGTTCTGCCAGCTCCCGCGC 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 372 CGGCGCACGTACAACCGCCTCAAGCTGCACCTACCCAAGCAGTTCTGCCAGCTCCCGCGC 431
Qy 241 ATGCCGTTCCCGGAAGACTACCCGGAGTACCCGACCCGCCGCCAGTTCGTCGACTACCTC 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 432 ATGCCGTTCCCGGAAGACTACCCGGAGTACCCGACCCGCCGCCAGTTCGTCGACTACCTC 491
Qy 301 GAGCGCTACGCCGCCGAGTTCGAGATCAAGCCGGAGTTCGGCACCACCGTGCTGTCGGCG 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 492 GAGCGCTACGCCGCCGAGTTCGAGATCAAGCCGGAGTTCGGCACCACCGTGCTGTCGGCG 551
Qy 361 CGCTACGACGAGACGTCGGGCCTCTGGCGCGTCGTCACCAACGGCGGAGCCGGCGGCGAC 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 552 CGCTACGACGAGACGTCGGGCCTCTGGCGCGTCGTCACCAACGGCGGAGCCGGCGGCGAC 611
Qy 421 ATGGAGTACATCGGGCGCTGGCTCGTGGTCGCCACGGGCGAGAACGCGGAGGCCGTGGTG 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 612 ATGGAGTACATCGGGCGCTGGCTCGTGGTCGCCACGGGCGAGAACGCGGAGGCCGTGGTG 671
Qy 481 CCCGACATCCCGGGCCTCGCCGGCTTCGACGGCGAGGTGACCCACGTGAGCGAGTACAAG 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 672 CCCGACATCCCGGGCCTCGCCGGCTTCGACGGCGAGGTGACCCACGTGAGCGAGTACAAG 731
Qy 541 TCCGGCGAGGCCTACGCCGGCAAGCGCGTGCTGGTGGTCGGCTGCGGCAACTCCGGGATG 600
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 732 TCCGGCGAGGCCTACGCCGGCAAGCGCGTGCTGGTGGTCGGCTGCGGCAACTCCGGGATG 791
Qy 601 GAGGTGTCGCTGGACCTGGCCGAGCACGGCGCGCGCCCGGCCATGGTGGTGCGCGACGCC 660
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 792 GAGGTGTCGCTGGACCTGGCCGAGCACGGCGCGCGCCCGGCCATGGTGGTGCGCGACGCC 851
Qy 661 GTCCACGTCCTCCCGCGCGAGGTGCTGGGCACGTCCACCTTCGGGCTCGCCGTGCTGCTC 720
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 852 GTCCACGTCCTCCCGCGCGAGGTGCTGGGCACGTCCACCTTCGGGCTCGCCGTGCTGCTC 911
Qy 721 ATGCGCTGGCTCCCGCTCTGGCTCGTCGACTGGCTCATGGTGCTCCT-GGCGTGGCTCGT 779
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
Db 912 ATGCGCTGGCTCCCGCTCTGGCTCGTCGACTGGCTCATGGTGCTCCTCGGCGTGGCTCGT 971
Qy 780 CCTCGGCAACCTCGCCAGGCTCGGCCTCCGCCGCCCCGCCGCCGGCCCGCTCCAGCTCAA 839
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 972 CCTCGGCAACCTCGCCAGGCTCGGCCTCCGCCGCCCCGCCGCCGGCCCGCTCCAGCTCAA 1031
Qy 840 GGAGACGCACGGCCGCACACCAGTCCTCGACTACGGCGCGCTCGCGCGCATCCGCGCCGG 899
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1032 GGAGACGCACGGCCGCACACCAGTCCTCGACTACGGCGCGCTCGCGCGCATCCGCGCCGG 1091
Qy 900 CGACATCACCGTCGTCCCTGCGGTGACACGGTTCGCCGGCAAGGGCGGACAGGTTGAGGT 959
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1092 CGACATCACCGTCGTCCCTGCGGTGACACGGTTCGCCGGCAAGGGCGGACAGGTTGAGGT 1151
Qy 960 CGCCGACGGCCGCACGCTCGGCTTCGACGCCGTCATCCTCGCCACCGGATATCGCAGCAA 1019
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1152 CGCCGACGGCCGCACGCTCGGCTTCGACGCCGTCATCCTCGCCACCGGATATCGCAGCAA 1211
Qy 1020 CGTGCCGCAGTGGCTCCAGGGCAACGATTTCTTCAACAAGGACGGGTACCCCAAGACGGC 1079
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Db 1212 CGTGCCGCAGTGGCTCCAGGGCAACGATTTCTTCAACAAGGACGGATACCCCAAGACGGC 1271
Qy 1080 GTTCCCGCACGGGTGGAAGGGCGAGAGTGGGCTGTACGCCGTGGGCTTCACCCGGCGCGG 1139
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||
Db 1272 GTTCCCGCACGGGTGGAAGGGCGAGAGTGGGCTGTACGCCGTGGGGTTCACCCGGCGCGG 1331
Qy 1140 CCTCTCCGGCGCCTCCGCCGACGCCGTGCGCATCGCCAAGGACCTCGGGAACGTCTGGAG 1199
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Db 1332 CCTCTCCGGCGCCTCCGCCGACGCCGTGCGCATCGCCACGGACCTCGGGAACGTCTGGAG 1391
Qy 1200 GGAGGAGACCAAGCCCACCAAGAGGGCCGGCGCCTGCCACAGGCGCTGCATCTCGGTCGT 1259
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1392 GGAGGAGACCAAGCCCACCAAGAGGGCCGGCGCCTGCCACAGGCGCTGCATCTCGGTCGT 1451
Qy 1260 CTTCTAA 1266
|||||||
Db 1452 CTTCTAA 1458
Regarding claim 2, it additionally could be the gene mutant sequence derived from a mutation of SEQ ID NO: 5, with 4 nucleotide bases that could have been mutated from the gene nucleotide sequence of SEQ ID NO: 5 by any mutation (see claim interpretation in Office action filed 03/06/2026). Thus, any mutation of any number of nucleotides may have occurred to a sequence derived from SEQ ID NO: 5 to obtain a gene mutant sequence 98.6% identity to SEQ ID NO: 5. Alexandrov additionally teaches that sequences disclosed may have insertions or deletions (i.e. mutation comprising deletion) [¶636] (cf. instant claim 2).
Examiner notes that Applicant traversed the previous rejection of claims 1 and 2 under 35 USC § 102 sharing 96% identity with SEQ ID NO: 9 in the Applicant Arguments/Remarks Made in an Amendment filed 06/02/2026. Applicant contends that Alexandrov’s sequence does not meet the conditions for stringent hybridization, which “typically require >98-99% complementarity over the hybridized region.” [Applicant Arguments/Remarks Made in an Amendment filed 06/02/2026, pg. 11, ¶4]. The Applicant has not provided a definition that necessitates a complementarity over the hybridized region in the instant specification. Further, the above sequence, SEQ ID NO: 35842, is within the recited range of 98-99%. Lastly, the Applicant contends that Alexandrov fails to mention any maize, brace roots, root growth angle, or lodging resistance which means Alexandrov does not disclose the inventive concept – a YUC-mediated regulation mechanism controlling brace root growth angle through localized expression at the root tup. Examiner notes that these are limitations pulled from the instant specification. Claims 1 and 2 do not recite that the gene nucleotide sequence is a YUC gene or that there is localized expression at the root tip.
Due to the breadth of the claims, Alexandrov’s sequence with 98.6% identity is taken to read on a gene mutant sequence that is derived from mutation of a gene nucleotide sequence and the structure of the sequence would lead to the function as claimed.
Response to Applicant’s Arguments
The Applicant’s arguments filed June 2nd, 2026 have been fully considered but were not found persuasive.
Regarding the rejection of claims 1-7 and 9-11 under 35 USC § 112(a) – The Applicant argues that the amended claim recites that the ZmYUC4 and ZmYUC2 and ZmYUC4 mutations in combination can significantly increase brace root growth angle and lodging resistance, demonstrating that the claim scope does not overreach beyond the disclosure. The Applicant argues that the specification provides precise target sites along with four validated mutant sequences, which allows a person of skill in the art to implement alternative mutagenesis techniques without undue experimentation. The Applicant argues that the specification fully defines “stringent hybridization” and that the claim is limited by the functionality of the hybridized polynucleotide sequence.
The Examiner respectfully disagrees. With regard to the amended claim 1 reciting that ZmYUC4 and ZmYUC2 and ZmYUC4 mutations in combination can significantly increase brace root growth angle and lodging resistance, the Applicant has amended the claims to be drawn to a gene mutant sequence that generates a phenotype of increase brace root growth angle and lodging resistance in maize plants and is derived from any mutation of a gene nucleotide sequence set forth in SEQ ID NO: 5 or 10, an encoded amino acid sequence of the gene set forth in SEQ ID NO: 6, a polynucleotide sequence that hybridizes to the gene nucleotide sequence, a polynucleotide sequence set forth in SEQ ID NO: 1, 3, 9 (or amino acid sequences 2 or 4) used in combination with a gene mutant sequence comprising a mutation of the polynucleotide sequence set forth in SEQ ID NO: 5 or 10.
While the Applicant has now specified that a mutation to SEQ ID NO: 1, 3, or 9, or corresponding amino acid sequences 2 or 4 requires a simultaneous mutation to the genomic or transcript sequence of SEQ ID NO: 5 or 10, this amendment does not demonstrate that the claim scope is tightly calibrated to what the specification actually teaches and enables.
The instant specification reduces to practice particular mutations of polynucleotide sequences of SEQ ID NO. 1-6 and 9-10 to generate either single or double mutant maize plants. The ZmYUC4 gene (genomic nucleotide sequence as set forth in SEQ ID No: 10) had only one transcript (nucleotide sequence as set forth in SEQ ID NO. 5, amino acid sequence as set forth in SEQ ID NO. 6), whereas the ZmYUC2 gene (genomic DNA sequence as set forth in SEQ ID NO. 9) had two transcripts: ZmYUC2-T001 (nucleotide sequence as set forth in SEQ ID NO. 1,amino acid sequence as set forth in SEQ ID NO. 2) and ZmYUC2-T002 (nucleotide sequence as set forth in SEQ ID NO. 3, amino acid sequence as set forth in SEQ ID NO. 4) [pg. 15, ¶88].
The instant specification reduces to practice the mutation of the gene nucleotide sequences using CRISPR/Cas9 resulting in the four gene mutant sequences with SEQ ID NOs: 11-14, each with a unique insertion or deletion resulting in premature termination or frame shift mutations in the mutants, specific to either ZmYUC2 or ZmYUC4 [¶95]. As detailed in the Office action filed 03/06/2026, any mutation in the claimed gene nucleotide sequences may not result in the desired effect of generating a phenotype of an increased brace root growth angle and lodging resistance in maize plants, and may result in no change or even deleterious effects. As Applicant argues in the response to the rejection under 35 USC § 103 in the Applicant Arguments/Remarks Made in an Amendment filed 06/02/2026 [pg. 11, last paragraph-pg. 12], multiple YUC mutations in Arabidopsis resulted in agravitropic roots in contrast to the maize mutants of the instant application, showing extreme variability. The Applicant argues that the present invention provides unexpected technical results [Id., pg. 12, end of second paragraph], indicating that contrary to the broadly claimed invention, one of ordinary skill in the art would not expect that any mutation would result in an unexpected technical result. The Applicant has not reduced to practice that any mutation of the genomic sequence of ZmYUC4, or ZmYUC2 and ZmYUC4 synergistically, would result in the function of generating a phenotype of increase brace root growth angle and lodging resistance in maize plants.
Additionally, although the claims recite a gene mutant sequence comprising a mutation of the polynucleotide sequence as set forth in SEQ ID NO: 5 or 10, the instant specification describes multiple mutations to a singular gene. For example, one of the mutated gene sequences (SEQ ID NO: 13) is a result of a deletion of two bases at different positions in the ZmYUC4 gene. Further, claims 5 and 11 narrow the claims, yet indicate that any of SEQ ID NOs: 11-14 can be the gene mutant sequence derived from any of the polynucleotides set forth in claims 1 and 6. The Applicant has not described that SEQ ID NOs: 11-14 may be a mutant sequence derived from any of the gene nucleotide sequences of claims 1 and 6, as these are specific to either ZmYUC2 or ZmYUC4. As the validated mutant sequences as described in the specification are limited to multiple, specific mutations that allow for the generation of the desired phenotype, and SEQ ID NOs: 11-14 correspond the specific ZmYUC genes (2 or 4), the amendment has not demonstrated that the claim scope is tightly calibrated to what the specification teaches.
With regard to the Applicant’s argument that the specification provides precise target sites along with four validated mutant sequences, which would allow a person of skill in the art to implement alternative mutagenesis techniques without undue experimentation, the specification provides the specific mutations in the mutants as a result of CRISPR-Cas9-mediated genetic editing [Embodiment 3]. Of the four validated mutant sequences, the Applicant shows that two of the mutant sequences alone were insufficient to provide the desired phenotype. Although these are now claimed in combination with the other sequences, this data shows the unpredictability in the structure conferring the claimed function. As traditional chemical and physical mutagenesis are fundamentally undirected and given the unpredictability in the mutated sequence conferring the function, one of ordinary skill in the art would not expect any mutation to generated the claimed phenotype.
The genus of a gene mutant sequence derived from any mutation of a gene nucleotide sequence is extremely broad. For example, one of SEQ ID NO: 10 (the genomic nucleotide sequence for ZmYUC4) is 2063 nucleotides long, allowing for any substitutions, additions, or deletions of any nucleotides within the sequence. For single point mutations alone, there are a total of 6,189 possible point mutations (2063 positions can mutate to 3 other possible bases). The instant disclosure has not reduced to practice any species of the claimed genus other than the mutations comprised in SEQ ID NOs: 11-14. The Applicant argues that the specification sets forth clear functional screening criteria. The functional screening criteria of the instant application relies on field phenotypic analysis of the mutant plants. It would be undue experimentation for one of ordinary skill to rely on field phenotypic analysis of plants mutated with any possible substitution, addition, or deletion to see if the structure can lead to the function.
With regard to the Applicant’s argument that the specification has “fully defined” stringent hybridization, the Applicant contends in the rejection under 35 USC § 102 that a sequence having 96% identity is insufficient to meet the claimed stringent conditions. The Applicant states that “those conditions (e.g., washing at 65°C in 0.1 x SSC) typically requires >98-99% complementarity over the hybridized region.” [Applicant Arguments/Remarks Made in an Amendment filed 06/02/2026; pg. 11, ¶4]. However, this range is variable across the art. For example, International Publication No. WO 2026131663 A1 states that examples of high stringent hybridization conditions are conditions under which primarily only those nucleic acid molecules that have at least 90% or at least 95% sequence identity undergo hybridization [pg. 12, lns. 3-6]. Although the Applicants have indicated a particular range within their presented arguments, there does not appear to be adequate support in the specification for an explicit range.
Additionally, the method of claim 6 does not require mutation of the genes and instead simply claims decreasing or inhibiting expression or protein function of a lodging gene achieved by gene editing, RNA interference, or promoter mutation. As the method of claim 6 has not been amended to require any specific mutation, the scope of the method is vastly different from the invention that has been reduced to practice. Although the Applicant argues that the specification provides precise target sites, the method of claim 6 does not necessitate mutation or the use of a target site, merely requiring a decrease or inhibition of a lodging-related gene as set forth in SEQ ID NOs: 5 or 10 or encoded amino acid sequence of the gene. Part (d) of claim 6 requires a gene mutant sequence but these limitations are recited in the alternative. The amendments to the claims do not remedy this deficiency. The exception to this is claim 11, which sets forth the mutated sequences of SEQ ID NOs: 11-14. However, as noted above, the disclosure does not indicate that a mutation to any of SEQ ID NOs: 1-5 and 9-10 could result in any mutated sequence of SEQ ID NOs: 11-14.
Lastly, Examiner notes that Applicant did not explicitly acknowledge the rejection over the broadly claimed target sequence in view of the target sequences shown in Fig. 4A [pg. 14, last paragraph – pg. 13]. As the instant specification does not reduce to practice any other mutations than those of the gene mutant sequences set forth in SEQ ID NOs: 11-14, it does not reduce to practice the possible target sequences that can be arranged from the sequence arrangement rule claimed in claims 4 and 9.
Examiner notes that amending the claims with more specificity to the mutant sequences that were reduced to practice (gene mutant sequences of SEQ ID NO: 11-14) may aid in rendering the claim scope linked to the instant specification.
Thus, the rejection of claims 1-7 and 8-11 under 35 USC § 112(a) is maintained.
Summary
Claims 3-5 are deemed free of the prior art given the failure of the prior art to teach or reasonably suggest a gene mutant sequence derived from a mutation of the gene nucleotide sequences of SEQ ID NO: 5 or 10, or encoded amino acid sequence, SEQ ID NO: 6, or a combined mutation of SEQ ID NO: 5 or 10 and SEQ ID NOs: 1, 3, and 9 or encoded amino acid sequences SEQ ID NO: 2 or 4 generated by techniques comprising physical mutagenesis, chemical mutagenesis, ZFN, TALEN, and/or CRISPR/Cas gene editing with the sequence as set forth in claim 4, wherein the gene mutant sequence generates a phenotype of an increased brace root growth angle and lodging resistance in maize plants. Claim 5 remains free of the prior art as noted in the previous Office Action.
Claims 6-7 and 9-11 are deemed free of the prior art given the failure of the prior art to teach or reasonably suggest a method for enhanced lodging resistance in maize by decreasing or inhibiting expression or protein function of a lodging-related gene wherein the polynucleotide sequence is SEQ ID NO: 5, 10 or an encoded amino acid sequence of the gene, SEQ ID NO: 6; or a combined mutation of SEQ ID NO: 5 or 10 and SEQ ID NOs: 1, 3, and 9 or encoded amino acid sequences SEQ ID NO: 2 or 4; wherein the lodging related gene is expressed in a quiescent center and/or root cap at the top of a brace root of maize and the inhibiting is achieved by gene editing, RNA interference, or promoter mutation. Claim 11 remains free of the prior art as noted in the previous Office Action.
Examiner notes that although these claims are deemed free of the prior art, they remain rejected under 35 USC § 112(a) for failing to meet the written description requirement.
Claims 1-7 and 9-11 are rejected.
Applicants’ amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR § 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Contact Information
Any inquiry concerning this communication or earlier communications from the examiner should be directed to EMILY K. JOHNSON whose telephone number is (571)272-5761. The examiner can normally be reached Monday - Friday 7:30 am - 5:00 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at 571-270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/EMILY K JOHNSON/Examiner, Art Unit 1662
/BRATISLAV STANKOVIC/Supervisory Patent Examiner, Art Units 1616 & 1662