Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Claims 1-18 are pending and under examination.
Priority
This application, filed on 10/25/2024, claims priority to REPUBLIC OF KOREA 10-2024-0128433 filed 9/23/2024 and REPUBLIC OF KOREA 10-2023-0143934 filed 10/25/2023. The effective filing date for art purposes is October 25, 2024.
Information Disclosure Statement
The information disclosure statement filed on 10/25/2024 complies with 37 CFR 1.98(a)(2), which requires a legible copy of each cited foreign patent document; each non-patent literature publication or that portion which caused it to be listed; and all other information or that portion which caused it to be listed. All references were considered.
Drawings
The drawings are objected to because FIG. 15B and FIG. 16B are pixelated, making the text difficult to read.
As per 37 C.F.R. 1.84(b)(1), photographs, including photocopies of photographs,
are not ordinarily permitted in utility and design patent applications. The Office will
accept photographs in utility and design patent applications, however, if photographs
are the only practicable medium for illustrating the claimed invention. For example, photographs or photomicrographs of: electrophoresis gels, blots (e.g., immunological, western, Southern, and northern), auto- radiographs, cell cultures (stained and unstained), histological tissue cross sections (stained and unstained), animals, plants, in vivo imaging, thin layer chromatography plates, crystalline structures, and, in a design patent application, ornamental effects, are acceptable. If the subject matter of the application admits of illustration by a drawing, the examiner may require a drawing in place of the photograph. The photographs must be of sufficient quality so that all details in the photographs are reproducible in the printed patent. FIG. 4, FIG. 10A, FIG. 14A, FIG. 14B, FIG. 15A and FIG. 16A are black and white photographs, however the quality of the images do not allow all the details to be visualized.
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Specification
The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code (“http://crispr.mit.edu”; p.23, [00136]). Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code. Reference to websites should be limited to the top-level domain name without any prefix such as “http://” or other browser-executable code. See MPEP §608.01.
The abstract of the disclosure is objected to because line numbers (5, 10) appear in the left margin. A corrected abstract of the disclosure is required and must be presented on a separate sheet, apart from any other text. See MPEP § 608.01(b).
Claim Objections
Claims 1-18 are objected to because of the following informalities:
Line numbers appear in the left margin (5, 10, 15, 20, 25) on each of claim pages 1-3.
Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
Claim 4 is rejected under 35 U.S.C. 112(b) as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor regards as the invention.
Claim 4 contains the trademark/trade name Matrigel. Where a trademark or trade name is used in a claim as a limitation to identify or describe a particular material or product, the claim does not comply with the requirements of 35 U.S.C. 112(b). See Ex parte Simpson, 218 USPQ 1020 (Bd. App. 1982). The claim scope is uncertain since the trademark or trade name cannot be used properly to identify any particular material or product. A trademark or trade name is used to identify a source of goods, and not the goods themselves. Thus, a trademark or trade name does not identify or describe the goods associated with the trademark or trade name. In the present case, the trademark/trade name is used to identify/describe an extracellular matrix and, accordingly, the identification/description is indefinite.
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 2 is rejected under 35 U.S.C. 112(d) as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Claim 2 recites “the method of claim 1, wherein the hepatic organoids express cytochrome P450 labelled with the fluorescent protein”. Claim 2 depends from claim 1, which requires hepatic organoids derived from a human pluripotent stem cell line expressing cytochrome P450 fused to a fluorescent protein”. Thus, by requiring the hepatic organoids to express cytochrome P450 labelled with the fluorescent protein, claim 2 does not further limit claim 1 from which it depends, and is an improper dependent claim.
Applicant may cancel the claim, amend the claim to place the claim in proper dependent form, rewrite the claim in independent form, or present a sufficient showing that the dependent claim complies with the statutory requirements.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-2, 7-13 and 18 are rejected under 35 U.S.C. 103 as being unpatentable over Park et al. (WO2021256668A1 published on 12/23/2021) in view of Thompson et al. (“Human liver model systems in a dish”, Development, Growth & Differentiation, 2021, Vol. 63, Issue 1, pp.47-58). As the original Park reference is in Korean, an English translation is relied upon for support.
Regarding claim 1, Park teaches a method comprising the steps of 1) contacting a test substance with a human induced pluripotent stem cell line transformed with a cytochrome P450 protein labelled with a fluorescent protein; 2) measuring the signal intensity of the fluorescent protein in the human induced pluripotent stem cell line transformed with the cytochrome P450 protein labeled with the fluorescent protein in contact with the test substance; and 3) provide an AHR modulator screening method comprising the step of selecting a test substance whose signal intensity of the fluorescent protein is changed compared to a control sample (English translation p.2, last 3 paragraphs).
Park teaches human dermal fibroblast-derived human induced pluripotent stem cells (hiPSCs) were differentiated into hepatocytes (English translation p.5, 1. Culture of human induced pluripotent stem cells and differentiation into hepatocytes). Park teaches for embryoid body formation, CYP1A1-mCherry hiPSCs were dissociated, seeded and cultured to form cell aggregates, which were cultured for 7 days to form embryoid bodies (English translation p.5, 4th paragraph of Experiment Method – 1. Culture of human induced pluripotent stem cells and differentiation in hepatocytes).
Park does not teach hepatic organoids.
However, Thompson teaches human model liver systems (title). Thompson teaches many hPSC-generated hepatic 3D models rely on a stepwise directed differentiation approach that attempts to recapitulate in vivo development (p.4, 1st paragraph). Thompson further teaches that embryoid bodies are 3D aggregates of hPSCs capable of differentiating into all 3 germ layers; and further that embryoid body/spheroid culture is used to differentiate hPSCs into definitive endoderm (DE) (p.4, 1st paragraph). Thompson teaches the next step is differentiation of DE into a hepatic endoderm stage, to transition into hepatoblast stage and then into hepatocyte-like cells (p.4, 2nd paragraph). Thompson teaches that organoids are self-organizing mini-organs derived from stem cells that can recapitulate many of the functions and cell-types seen in the original organ (p.4, last paragraph).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to further differentiate the hepatic endoderm cells taught by Park using the method of Thompson to obtain hepatic endoderm organoids, because Thompson teaches that organoids are self-organizing mini-organs that recapitulate many of the functions and cell-types seen in the original organ. Each of Park and Thompson teach generating 3D cultures from hPSCs. One of ordinary skill in the art would have reasonably expect that combining the teachings of Park and Thompson to further culture the embryoid bodies taught by Park would predictably result in hepatic endoderm organoids, because it would amount to a combination of known steps in a predictable way to continue the maturation of the cells of Park and Thompson, and it was known in the art at the time of invention that hPSCs could be differentiated to form hepatic endoderm organoids.
Regarding claim 2, Park teaches a human induced pluripotent stem cell line transformed with cytochrome P450 protein labeled with fluorescent protein, CYP1A1-mCherry hiPSC cell line (English translation p.2, 1st paragraph).
Regarding claim 7, Park teaches the fluorescent protein may be selected from green fluorescence protein (GFP), blue fluorescence protein (CFP), yellow fluorescence protein (YFP), red fluorescence protein (DsRed), more preferably mCherry protein (English translation, p.4, mid-way).
Regarding claims 8 and 10, Park teaches CYP1A1-mCherry fusion protein (English translation p.7, Example 1).
Regarding claim 9, Park teaches a vector used to make a CYP1A1-mCherry hiPSC cell line (English translation, p.3, 2nd paragraph). Park teaches using CRISPR-Cas9 system, targeting the locus in the CRISPR-Cas9 system is mediated by a 20-base guide RNA that recognizes the DNA sequence and the Cas9 protein involved in DNA cleavage (English translation p.2, 4th paragraph). Park teaches Locus sgRNA sequence guide #1 GCATTGATCCTCCTGTCCAT GGG (Subject), which has 100% identity to instant SEQ ID NO:1 (Query) as shown in the alignment below.
PNG
media_image1.png
114
407
media_image1.png
Greyscale
Regarding claim 11, Park teaches step 3) provide an AHR modulator screening method comprising the step of selecting a test substance whose signal intensity of the fluorescent protein is changed compared to a control sample (English translation p.2, last paragraph).
Regarding claim 12, Park teaches that in hepatocytes differentiated from the human induced pluripotent stem cell line transformed with the cytochrome P450 protein labeled with the fluorescent protein treated with a known AHR agonist, the intensity of the fluorescent protein increased in proportion to the activity of cytochrome P450 (English translation p.5, 2nd paragraph).
Regarding claim 13, Park teaches the reporter system of the present invention uses the fluorescence level of CYP1A1-mCherry to detect AHR in living cells (i.e. the cells are alive) (English translation p.5, paragraph 13). Park further teaches that an AHR modulator can be better screened by performing screening on the hepatocytes derived from the cell line while the cells are alive (abstract).
Regarding claim 18, Park teaches a human induced pluripotent stem cell line transformed with cytochrome P450 protein labeled with fluorescent protein, CYP1A1-mCherry hiPSC cell line (English translation p.2, 1st paragraph). Park further teaches that in hepatocytes differentiated from the human induced pluripotent stem cell line transformed with the cytochrome P450 protein labeled with the fluorescent protein treated with a known AHR agonist, the intensity of the fluorescent protein increased in proportion to the activity of cytochrome P450 (English translation p.5, 2nd paragraph).
Park does not teach hepatic organoids.
However, Thompson teaches human model liver systems (title). Thompson teaches many hPSC-generated hepatic 3D models rely on a stepwise directed differentiation approach that attempts to recapitulate in vivo development (p.4, 1st paragraph). Thompson further teaches that embryoid bodies are 3D aggregates of hPSCs capable of differentiating into all 3 germ layers; and further that embryoid body/spheroid culture is used to differentiate hPSCs into definitive endoderm (DE) (p.4, 1st paragraph). Thompson teaches the next step is differentiation of DE into a hepatic endoderm stage, to transition into hepatoblast stage and then into hepatocyte-like cells (p.4, 2nd paragraph). Thompson teaches that organoids are self-organizing mini-organs derived from stem cells that can recapitulate many of the functions and cell-types seen in the original organ (p.4, last paragraph).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the method of Park to create hepatic organoids taught by Thompson, because Thompson teaches that organoids are self-organizing mini-organs that recapitulate many of the functions and cell-types seen in the original organ. One of ordinary skill in the art would have found it beneficial to utilize a hepatic organoid model taught by Thompson to more closely mimic the liver organ structure.
Claims 3-4 and 14-15 are rejected under 35 U.S.C. 103 as being unpatentable over Park et al. (WO2021256668A1 published on 12/23/2021) in view of Thompson et al. (“Human liver model systems in a dish”, Development, Growth & Differentiation, 2021, Vol. 63, Issue 1, pp.47-58) as applied to claim 1 above, and further in view of Michalopoulos et al. (“Histological Organization in Hepatocyte Organoid Cultures”, American Journal of Pathology, 2001, Vol. 159, No. 5, pp.1877-1887). As the original Park reference is in Korean, an English translation is relied upon for support.
The teachings of Park et al. and Thompson et al. are discussed above.
Regarding claims 3-4, Park and Thompson do not teach a medium containing no extracellular matrix (claim 3) or no Matrigel (claim 4).
However, Michalopoulos teaches hepatocytes and other cellular elements isolated by collagenase perfusion on the liver and maintained in defined culture conditions undergo a series of complex changes to reconstruct tissue with specific architecture (abstract). Michalopoulos teaches culturing hepatocytes in HGM medium supplemented with HGF and EGF (p.1878, 2nd column – roller bottle cultures). Michalopoulos teaches the HGM medium consisted of Dulbecco’s modified Eagle’s medium supplemented with purified bovine albumin, glucose, galactose, ornithine, proline, nicotinamide, ZnCl2, ZnSO4:7H2O, CuSO4:5H2O, MnSO4, glutamine, dexamethasone, penicillin and streptomycin (i.e. no extracellular matrix or Matrigel) (p.1878, 2nd column – Composition of the HGM Cell Culture Medium). Michalopoulos teaches that the model described results in standard, reproducible and stereotypic histology, which allows an opportunity to study the role of different molecules on hepatic tissue formation (p.1878, 1st column top paragraph).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to replace the culture medium of Park with the culture medium taught by Michalopoulos, because Michalopoulos teaches culturing hepatocytes in HGM medium without any extracellular matrix results in standard, reproducible and stereotypic histology. One of ordinary skill in the art would have found it beneficial to culture hepatocytes in a medium that resulted in reproducible liver tissue formation.
Regarding claim 14, Park teaches the hiPSC cell line maintained cell differentiation potential into three germ layers through embryoid body formation analysis (English translation p.4, 3rd paragraph from bottom). Park teaches differentiating the cultured hiPSCs into hepatocytes, for endoderm (DE; definitive endoderm) differentiation, hiPSCs were treated with BSA and sodium butyrate (English translation p.5, 1. Culture of human induced pluripotent stem cells and differentiation into hepatocytes). Park further teaches DE cells were differentiated into hepatic endoderm cells, then formed into embryoid body formations (English translation p.5, 1. Culture of human induced pluripotent stem cells and differentiation into hepatocytes).
Park does not teach differentiating the hepatic endoderm cells into hepatic endoderm organoids.
However, Thompson teaches human model liver systems (title). Thompson teaches many hPSC-generated hepatic 3D models rely on a stepwise directed differentiation approach that attempts to recapitulate in vivo development (p.4, 1st paragraph). Thompson further teaches that embryoid bodies are 3D aggregates of hPSCs capable of differentiating into all 3 germ layers; and further that embryoid body/spheroid culture is used to differentiate hPSCs into definitive endoderm (DE) (p.4, 1st paragraph). Thompson teaches the next step is differentiation of DE into a hepatic endoderm stage, to transition into hepatoblast stage and then into hepatocyte-like cells (p.4, 2nd paragraph). Thompson teaches that organoids are self-organizing mini-organs derived from stem cells that can recapitulate many of the functions and cell-types seen in the original organ (p.4, last paragraph).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to further differentiate the hepatic endoderm cells taught by Park using the method of Thompson to obtain hepatic endoderm organoids, because Thompson teaches that organoids are self-organizing mini-organs that recapitulate many of the functions and cell-types seen in the original organ. Each of Park and Thompson teach generating 3D cultures from hPSCs. One of ordinary skill in the art would have reasonably expect that combining the teachings of Park and Thompson to further culture the embryoid bodies taught by Park would predictably result in hepatic endoderm organoids, because it would amount to a combination of known steps in a predictable way to continue the maturation of the cells of Park and Thompson, and it was known in the art at the time of invention that hPSCs could be differentiated to form hepatic endoderm organoids.
Regarding claim 15, Park et al. does not teach subculturing differentiated hepatic endoderm organoids.
Thompson teaches step-wise directed differentiation of 3D hPSC derived hepatic organoids (p.8, Figure 3). Thompson teaches that self-renewal of the hepatocyte progenitors is critical for generating and expanding large numbers of viable hepatocytes (p.5, 2nd paragraph). Thompson further teaches hepatic organoids could be passaged for 1 year by collecting the 3D spheroids that formed and further differentiating them in media (p.5, 2nd paragraph).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to further expand the hepatic endoderm organoids taught by Thompson using the method of Thompson, because Thompson teaches that self-renewal of hepatocyte progenitors is critical for generating and expanding large numbers of viable hepatocytes. One of ordinary skill in the art would have found it beneficial to subculture differentiated hepatic organoids to generate large numbers of viable hepatocytes for the screening assays taught by Park.
Claim 16 is rejected under 35 U.S.C. 103 as being unpatentable over Park et al. (WO2021256668A1 published on 12/23/2021) in view of Thompson et al. (“Human liver model systems in a dish”, Development, Growth & Differentiation, 2021, Vol. 63, Issue 1, pp.47-58) and Michalopoulos et al. (“Histological Organization in Hepatocyte Organoid Cultures”, American Journal of Pathology, 2001, Vol. 159, No. 5, pp.1877-1887) as applied to claims 3 and 14 above, and further in view of Huch et al. (“Long-Term Culture of Genome-Stable Bipotent Stem Cells from Adult Human Liver”, Cell, 2015, Vol. 160, Issue 1, pp.299-312).
Regarding claim 16, Park, Thompson and Michalopoulos do not teach wherein the split ratio during the subculturing is 1:6.
However, Huch teaches single mouse Lgr5+ liver stem cells can be expanded as epithelial organoids in vitro and differentiated into functional hepatocytes in vitro and in vivo (abstract). Huch teaches cultures expanded as budding organoids for many months in culture at a weekly split ratio of 1:6 (p.301, 1st column last paragraph).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to utilize a split ratio of 1:6 taught by Huch for subculturing because Huch teaches expanding budding organoids for many months in culture. One of ordinary skill in the art would have found it beneficial to use a 1:6 split ratio to be expand organoid cultures for many months.
Claims 5-6 and 17 are rejected under 35 U.S.C. 103 as being unpatentable over Park et al. (WO2021256668A1 published on 12/23/2021) in view of Thompson et al. (“Human liver model systems in a dish”, Development, Growth & Differentiation, 2021, Vol. 63, Issue 1, pp.47-58) and Michalopoulos et al. (“Histological Organization in Hepatocyte Organoid Cultures”, American Journal of Pathology, 2001, Vol. 159, No. 5, pp.1877-1887) as applied to claim 3 above, and further in view of Schneeberger et al. (“Large-Scale Production of LGR5-Positive Bipotential Human Liver Stem Cells”, Hepatology, 2020, Vol. 72, No.1, pp.257-270).
The teachings of Park et al., Thompson et al. and Michalopoulos et al. are discussed above.
Regarding claims 5-6, Thompson teaches that bioreactors offer alternatives to standard cultures.
Park, Thompson and Michalopoulos do not teach culturing in a bioreactor.
However, Schneeberger teaches human organoids derived from leucine-rich repeat-containing G protein-coupled receptor 5-positive adult stem cells represent an exciting new cell source for liver regeneration, however culturing large numbers of organoids with current protocols is tedious (abstract). Schneeberger teaches establishing a method for the expansion of large quantities of human liver organoids in liver flasks, providing improved oxygenation and rapid organoid proliferation (abstract). Schneeberger teaches bioreactors offer certain advantages including minimization of gradient formation, increased transport of oxygen and nutrients, and prevention of cell sedimentation (p.258, 2nd column top paragraph). Schneeberger teaches disposable 125-mL spinner flasks were inoculated with 2.5 million cells in 25mL expansion medium, with rotation speed set to 85 rpm (p.257, 2nd column last paragraph to p.258 1st column top paragraph).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the method of Park, Thompson and Michalopoulos to use a bioreactor for culture as taught by Schneeberger, because Schneeberger teaches bioreactors provided improved oxygenation and rapid organoid proliferation. One of ordinary skill in the art would have found it beneficial to use a bioreactor culture method to minimize gradient formation, increase transport of oxygen and nutrients and prevent cell sedimentation to obtain rapid organoid proliferation.
Regarding claim 17, Thompson teaches hepatic organoids could be passaged for 1 year by collecting the 3D spheroids that formed and further differentiating them in media (p.5, 2nd paragraph).
Park, Thompson and Michalopoulos do not teach not teach wherein the hepatic endoderm organoids are single cells.
Schneeberger teaches organoid culture and differentiation in spinner flasks (p.258, 2nd column last paragraph heading). Schneeberger further teaches single cell seeding of disposable 125-mL spinner flasks containing expansion medium (p.258, 2nd column last paragraph).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to culture organoids as single cells as taught by Schneeberger, because Schneeberger teaches large-scale expansion of human adult stem cell-derived liver organoids. Each of Park, Thompson, Michalopoulos and Schneeberger teach the culture of hepatic organoids. One of ordinary skill in the art would reasonably expect that culturing single cell organoids would predictably result in hepatic organoids that could be readily expanded for use in a screening assay, because it was known in the art at the time of invention that single cell organoids could be expanded using bioreactors to obtain large volumes of organoids for further use.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1-2, 7-8, 10-13 and 18 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-3, 7-8 and 10 of U.S. Patent No. 12,680,081 in view of Thompson et al. (“Human liver model systems in a dish”, Development, Growth & Differentiation, 2021, Vol. 63, Issue 1, pp.47-58).
Patented claim 1 recites “ a human induced pluripotent stem cell (hiPSC) line for screening an AHR (aryl hydrocarbon receptor) modulator, the cell line expressing a fluorescent protein-tagged CYP1A1 protein, wherein the fluorescent-tagged CYP1A1 protein is produced by CRISPR-Cas9-mediated knock-in at the CYP1A1 locus using: (i) a single guide RNA selected from SEQ ID NOs: 1-3; and (ii) a targeting vector comprising a fluorescent protein insertion cassette, the cell line having been deposited under the accession number KCTC 14186BP” (relevant to instant claims 2, 10, 18).
Patented claim 1 does not teach hepatic organoids.
However, Thompson teaches human model liver systems (title). Thompson teaches many hPSC-generated hepatic 3D models rely on a stepwise directed differentiation approach that attempts to recapitulate in vivo development (p.4, 1st paragraph). Thompson further teaches that embryoid bodies are 3D aggregates of hPSCs capable of differentiating into all 3 germ layers; and further that embryoid body/spheroid culture is used to differentiate hPSCs into definitive endoderm (DE) (p.4, 1st paragraph). Thompson teaches the next step is differentiation of DE into a hepatic endoderm stage, to transition into hepatoblast stage and then into hepatocyte-like cells (p.4, 2nd paragraph). Thompson teaches that organoids are self-organizing mini-organs derived from stem cells that can recapitulate many of the functions and cell-types seen in the original organ (p.4, last paragraph).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to create hepatic organoids taught by Thompson using the cell line of patented claim 1, because Thompson teaches that organoids are self-organizing mini-organs that recapitulate many of the functions and cell-types seen in the original organ. One of ordinary skill in the art would have found it beneficial to utilize a hepatic organoid model taught by Thompson to more closely mimic the liver organ structure.
Patented claim 2 recites “the human induced pluripotent stem cell line for screening an AHR modulator according to claim 1, wherein the fluorescent protein is selected from the group consisting of green fluorescence protein (GFP), cyan fluorescence protein (CFP), yellow fluorescence protein (YFP) and red fluorescence protein (RFPD)” (relevant to instant claim 7).
Patented claim 3 recites “the human induced pluripotent stem cell line for screening an AHR modulator according to claim 1, wherein the fluorescent protein is mCherry” (relevant to instant claims 7-8).
Patented claim 7 recites “an AHR modulator screening method comprising the following steps:
1) contacting a test substance to the human induced pluripotent stem cell line (hiPSC line) of claim 1 (relevant to instant claim 1a);
2) measuring the signal intensity of the fluorescent protein in the human induced pluripotent stem cell line contacted with the test substance (relevant to instant claim 1b); and
3) selecting a test substance that changes the signal intensity of the fluorescent protein compared to a control sample (relevant to instant claims 11-12).
Patented claim 7 does not teach hepatic organoids.
However, Thompson teaches human model liver systems (title). Thompson teaches many hPSC-generated hepatic 3D models rely on a stepwise directed differentiation approach that attempts to recapitulate in vivo development (p.4, 1st paragraph). Thompson further teaches that embryoid bodies are 3D aggregates of hPSCs capable of differentiating into all 3 germ layers; and further that embryoid body/spheroid culture is used to differentiate hPSCs into definitive endoderm (DE) (p.4, 1st paragraph). Thompson teaches the next step is differentiation of DE into a hepatic endoderm stage, to transition into hepatoblast stage and then into hepatocyte-like cells (p.4, 2nd paragraph). Thompson teaches that organoids are self-organizing mini-organs derived from stem cells that can recapitulate many of the functions and cell-types seen in the original organ (p.4, last paragraph).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to utilize hepatic organoids taught by Thompson in the method of patented claim 7, because Thompson teaches that organoids are self-organizing mini-organs that recapitulate many of the functions and cell-types seen in the original organ. One of ordinary skill in the art would have found it beneficial to utilize a hepatic organoid model taught by Thompson to more closely mimic the liver organ structure.
Patented claim 10 recites “the AHR modulator screening method according to claim 7, wherein the screening method is performed while the cells are alive” (relevant to instant claim 13).
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to DEEPA MISHRA whose telephone number is (571) 272-6464. The examiner can normally be reached Monday - Friday 9:30am - 3:30pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Louise W. Humphrey can be reached at (571) 272-5543. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/LOUISE W HUMPHREY/Supervisory Patent Examiner, Art Unit 1657
/DEEPA MISHRA/Examiner, Art Unit 1657
Prosecution Insights